ID: 1007993932

View in Genome Browser
Species Human (GRCh38)
Location 6:46286549-46286571
Sequence TGTTTTGGCCAGAATAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007993932 Original CRISPR TGTTTTGGCCAGAATAAAGA TGG Intronic
900122440 1:1054557-1054579 TGTTTTGGGGAGACTAGAGAGGG + Intronic
903574159 1:24327716-24327738 TGATAGGGCCAGAAGAAAGAAGG - Intronic
903801756 1:25974004-25974026 TCTCTTGACCAGAATATAGAAGG + Intronic
906429300 1:45742027-45742049 TGCTTTTGCCATAAAAAAGAAGG + Intronic
907739228 1:57148023-57148045 AGTTTTGGTCAAGATAAAGATGG - Intronic
908905931 1:69008860-69008882 TCTTTTGGCCAAAATTGAGATGG - Intergenic
909836023 1:80255887-80255909 TGGTTTCCCCAGGATAAAGAGGG + Intergenic
912645328 1:111386786-111386808 TGATCTGACCAGAATAAAGTTGG + Intergenic
914323038 1:146583724-146583746 TGTTTTGACCAGAATAACTTTGG - Intergenic
916347662 1:163812277-163812299 TATTTTGGCCAAAATGATGATGG + Intergenic
917484522 1:175443671-175443693 TGTTTTGGCCTTGAGAAAGAGGG + Intronic
918069555 1:181124911-181124933 TGTCTGGGACAGAAGAAAGATGG - Intergenic
918675527 1:187280326-187280348 TGTTTTGGCAAGAAGATAAATGG - Intergenic
919737117 1:200959610-200959632 TGTGGTGGGCAGAATAGAGACGG + Intergenic
920025094 1:202988379-202988401 TATTTTGGCCAGAAAAAGGAAGG - Intergenic
920239757 1:204537648-204537670 TGTTATGGGCAGAACAGAGAAGG - Intronic
921260108 1:213378853-213378875 TGTTTTCTCCAGAATGAACATGG - Intergenic
921568058 1:216744664-216744686 TGTATTGCCAGGAATAAAGATGG - Intronic
923827582 1:237516929-237516951 TGCTGTGTGCAGAATAAAGACGG - Intronic
924422548 1:243923262-243923284 TGATTTGGCCTTAAAAAAGAAGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063492218 10:6475014-6475036 TGTCTTGGCAAGAGGAAAGAAGG - Intronic
1064813312 10:19227195-19227217 TGTTTTAGAAAGAATAAAGTTGG + Intronic
1069310314 10:67026944-67026966 TGTCTTATACAGAATAAAGAAGG - Intronic
1069400006 10:68034150-68034172 TGTTGGGGACAGAATAAATATGG - Exonic
1071290135 10:84182676-84182698 TGTTTTGTCCAGAATGAATGTGG - Intronic
1071745278 10:88411776-88411798 TGTTTTGGGAAGAAGTAAGAAGG + Intronic
1071750091 10:88465620-88465642 TGTTTTAGTTAGAATACAGATGG + Intronic
1073717980 10:106129555-106129577 TGTTTTGGAGTAAATAAAGAGGG + Intergenic
1074093596 10:110287386-110287408 TGTTTTTGCCTTCATAAAGAAGG - Intergenic
1074243321 10:111661684-111661706 AGTTTTGGCAGGTATAAAGAAGG - Intergenic
1074259153 10:111834382-111834404 TGTTTTGTCCACAGTAAAAATGG - Intergenic
1074264203 10:111884895-111884917 GGATTGGGCAAGAATAAAGATGG + Intergenic
1075571349 10:123548621-123548643 TGGTGTGGCCAGAAGAAACAAGG - Intergenic
1077997823 11:7469087-7469109 TGTCTTTTCCAGGATAAAGAAGG + Intergenic
1079053698 11:17186702-17186724 TGTTTTGGTCTGACTAAAAAGGG - Intronic
1080196348 11:29613898-29613920 TGTTTTGTTCAGTGTAAAGATGG - Intergenic
1080706235 11:34697214-34697236 TGTCTTGTCCAGAAGAAGGAGGG - Intergenic
1081881350 11:46455572-46455594 TGTCATGGCCAGAATGAAAATGG + Intronic
1082029783 11:47595629-47595651 TGTTTTGGGCTGGATAATGAGGG + Intergenic
1082802074 11:57422099-57422121 GGTTGTGGCCAGAATAATGGTGG - Intronic
1084117678 11:67051510-67051532 CCATTTGGCCAGAATAAAGTGGG + Intergenic
1088246438 11:107822506-107822528 TGTTCTGGGGAGAAGAAAGAGGG - Intronic
1091220395 11:133927081-133927103 TCTTTTGGCCAGGATGAAGCGGG - Exonic
1091548618 12:1520989-1521011 TGCATTGGCCATAATAAAGAAGG - Intergenic
1092724129 12:11468272-11468294 TTTTTTTGCCAGAATGAAGATGG - Intronic
1093560563 12:20533955-20533977 TGATTTGCTCAGAAAAAAGACGG - Intronic
1093756887 12:22862790-22862812 TCTTATGGGCAGAATAAAAATGG - Intergenic
1094377490 12:29805801-29805823 TGTTTTGGCCAAAAAACAAATGG + Intergenic
1095567267 12:43639875-43639897 TGTTTTGACAAAAATATAGAAGG + Intergenic
1095570441 12:43678030-43678052 TGTTTTATCCAGTATAAAAATGG - Intergenic
1097065484 12:56317389-56317411 TGTTTTGCAAAGAATGAAGAAGG + Exonic
1097861366 12:64521759-64521781 TCCTTTGGTCAAAATAAAGAGGG - Intergenic
1097927623 12:65147403-65147425 TGTTTCAGGCAGAAAAAAGAAGG + Intergenic
1098718562 12:73864450-73864472 TTGTTTGGCCAGAATAATAAAGG - Intergenic
1098971312 12:76859885-76859907 GTTCTTGGCCAGAAAAAAGATGG - Intronic
1100074218 12:90759011-90759033 TTTTTAGGGCAGAATAATGAAGG + Intergenic
1100231481 12:92612701-92612723 TGTGCTGGGCAGGATAAAGAAGG - Intergenic
1100339406 12:93664019-93664041 TCCTGTGGCCAGATTAAAGATGG + Intergenic
1102855221 12:116287740-116287762 TTTTTTTGGTAGAATAAAGAAGG - Intergenic
1106076161 13:26462901-26462923 TGTGATGGCCAGAACAAAGAAGG - Intergenic
1106216400 13:27705016-27705038 TATTTTTACCACAATAAAGAAGG + Intergenic
1108087864 13:46814058-46814080 TTTTTTGGTCAGAAAAAACAAGG - Intergenic
1108995321 13:56725264-56725286 TATATTGGCAAGAATAAGGAAGG + Intergenic
1109728710 13:66381040-66381062 TTTTTTGACAAGAGTAAAGATGG - Intronic
1109926872 13:69153554-69153576 TGTTGTGGATAGAATAGAGAGGG + Intergenic
1110100979 13:71601599-71601621 TGTTTTGTTTAGAAAAAAGACGG - Intronic
1111439480 13:88260985-88261007 TGTATTGGGCAAAATAGAGAAGG - Intergenic
1116196175 14:41728714-41728736 TGTTTTGGCTTCAATATAGAAGG - Intronic
1117562381 14:56954376-56954398 TGGTGTAGCCAGATTAAAGATGG + Intergenic
1117696087 14:58364520-58364542 TCATTTGGCCAGAATGAAGCAGG + Exonic
1121843357 14:97152645-97152667 TTTTTTGGCCAGACTAAGGAAGG + Intergenic
1123393078 15:19897869-19897891 TGTTTTGTTCAGAAAAGAGATGG + Intergenic
1125293057 15:38171188-38171210 TGTTCTAGCCAGAATACAAATGG + Intergenic
1125456055 15:39859963-39859985 TTTTTTTGCCACAATAAAAAAGG + Intronic
1125855053 15:42940411-42940433 GGTTTTCGCCAGAATTAAAAAGG - Intergenic
1126167295 15:45664499-45664521 TGTTTAAAGCAGAATAAAGAGGG - Intronic
1126202002 15:45996939-45996961 TTTTATGTACAGAATAAAGAAGG - Intergenic
1126433393 15:48610588-48610610 TATTTTGGGCAGAACAGAGAAGG + Intronic
1126876136 15:53043735-53043757 TTTTTTGGCCTTAAAAAAGAAGG + Intergenic
1130602145 15:85283439-85283461 TGATTTGGTCAGATTAAAAATGG + Intergenic
1130766864 15:86879555-86879577 TGATTTGGTCAGATTAAAAATGG - Intronic
1131005601 15:88975093-88975115 TGTTTTGGGCAGACAAGAGAGGG - Intergenic
1131905787 15:97140713-97140735 TATTTTGGGGAAAATAAAGAAGG + Intergenic
1132031978 15:98445876-98445898 TGTTGTGGCAAGAACAAAGGAGG - Intronic
1133588427 16:7218221-7218243 TGATTTGGCCAAATTAATGAAGG - Intronic
1134293315 16:12921953-12921975 TGTTTTTGCCATCATAAGGATGG + Intronic
1135068617 16:19332888-19332910 TGCTTTGGCCTCAATGAAGAAGG - Intergenic
1135503474 16:23016734-23016756 TTGTTTGGCCAGAATAACAATGG + Intergenic
1138146591 16:54618200-54618222 TCTTTGTGCCAGAATAAAGCAGG - Intergenic
1140010522 16:71127126-71127148 TGTTTTGACCAGAATAACTTTGG + Intronic
1140913841 16:79477384-79477406 AGCTTTGCACAGAATAAAGAAGG + Intergenic
1141584513 16:85024679-85024701 TGGTCTGGCCAGAACAAGGAGGG - Intergenic
1144767549 17:17740811-17740833 GGTTTTCGCCAGAACAAAGCAGG + Intronic
1145846780 17:28045358-28045380 TGTTTAAGCCAAAACAAAGAAGG - Intronic
1148171185 17:45521623-45521645 TGGTATGCCTAGAATAAAGATGG + Intergenic
1148278490 17:46328172-46328194 TGGTATGCCTAGAATAAAGATGG - Intronic
1148300699 17:46546035-46546057 TGGTATGCCTAGAATAAAGATGG - Intronic
1148364835 17:47046926-47046948 TGGTATGCCTAGAATAAAGATGG - Intronic
1149326805 17:55539243-55539265 TGTTTTTGCTAGACTGAAGAAGG + Intergenic
1149734796 17:58983036-58983058 GTTTTTGATCAGAATAAAGAGGG + Exonic
1149972432 17:61232381-61232403 TATTTTGGCCAAAAAAAAGGTGG + Intronic
1150401804 17:64863216-64863238 TGGTATGCCTAGAATAAAGATGG + Intronic
1150511063 17:65753504-65753526 TGTTTCTTCCAGAATAGAGAGGG + Intronic
1150555232 17:66248375-66248397 TTTATTGGCCATAATAAGGATGG - Intronic
1151049479 17:70960795-70960817 TGTATTGATCAGAATAAAAAGGG + Intergenic
1153409044 18:4772933-4772955 TGTTTTGCCCTGATTCAAGAAGG + Intergenic
1156448940 18:37255700-37255722 TGCTTTCCCCAGAATAAGGAAGG + Intronic
1156712766 18:39966567-39966589 GGTTTTGGGGAGAATAAAAATGG + Intergenic
1157911018 18:51617426-51617448 TGTTTTGGCCAAACTAACGCAGG - Intergenic
1159172861 18:64795515-64795537 TGTTCTGGCCAGAATCAAACAGG - Intergenic
1164157274 19:22604295-22604317 TGGGTTGGCCAGAATAGAGGAGG + Intergenic
925503892 2:4539131-4539153 TGTTTGGCACAGAATACAGAGGG + Intergenic
926199190 2:10781054-10781076 TGTTCTGGGCAGAATGGAGAAGG + Intronic
926780696 2:16468696-16468718 TGTCTTGGCCAAATAAAAGATGG - Intergenic
926967857 2:18435605-18435627 TGTTTTGGACAGTATCCAGAAGG + Intergenic
927138753 2:20115588-20115610 TGGTGTGGCCAGAATAAGGAAGG + Intergenic
927534675 2:23846029-23846051 TGTTTTGGCCAGACACAGGAGGG + Intronic
927534742 2:23846571-23846593 TGTTTTGGCCAGACACAGGAGGG + Intronic
927534809 2:23847113-23847135 TGTTTTGGCCAGACACAGGAGGG + Intronic
928690715 2:33795809-33795831 TGTTTGGGCCAGGGTAAAGCAGG - Intergenic
929845230 2:45518671-45518693 TGTTTTGGACAGACTATAAAGGG + Intronic
930704506 2:54490880-54490902 TGCTGTGGCTGGAATAAAGAGGG + Intronic
931098897 2:58973356-58973378 TGCTTTAGGCAGAATTAAGATGG - Intergenic
932188746 2:69720842-69720864 TGGTATGGCCAGAGTACAGAGGG + Intronic
932544363 2:72691991-72692013 TGCTATGGAGAGAATAAAGAGGG - Intronic
932858287 2:75262204-75262226 TGTTGTAGACAGAATAAAGTAGG + Intergenic
933062160 2:77751557-77751579 TGTTTTAGGCAGCATAAAGTGGG + Intergenic
933566361 2:83955175-83955197 TGTTGTGGCTGGAATCAAGATGG + Intergenic
935353164 2:102172781-102172803 TGTTTTGCCAAGAATACACATGG + Exonic
935561443 2:104563886-104563908 TATTTGAGCCACAATAAAGAAGG - Intergenic
936492834 2:112988380-112988402 TGTTTTGTCCCCAAAAAAGAAGG - Intergenic
937941787 2:127291804-127291826 TGTTTTTGACAAAACAAAGAGGG - Intronic
941134233 2:161693803-161693825 TTTTTTAGCCATAAAAAAGAAGG - Intronic
942827098 2:180191995-180192017 TGTGATGACCACAATAAAGATGG - Intergenic
943096693 2:183437517-183437539 AGATTGGGCCAGAATACAGAGGG + Intergenic
944981015 2:205119980-205120002 TGTTTTGGTCAGAAACAAGAGGG - Intronic
945025653 2:205617329-205617351 TTTTTTGGAGGGAATAAAGAAGG - Intronic
945748655 2:213751722-213751744 TGTCTTGACAAGAATAAACAAGG + Intronic
946656288 2:221951570-221951592 TGGTGTGGCTAGAATAAAGCAGG + Intergenic
946963082 2:225005453-225005475 TGATTTGGCAAAAATCAAGATGG - Intronic
1170407455 20:16053890-16053912 TGTTTTTCCCATAATAAACAAGG + Intergenic
1170452217 20:16495281-16495303 TATTTTGGCCTGATTAAATAGGG - Intronic
1173598707 20:44277555-44277577 TGTTGTGGCCAGAGTAAAAGCGG - Intronic
1178183456 21:30191577-30191599 TGTTTTGCCAAGATTAAGGAAGG + Intergenic
1184893869 22:47395819-47395841 TGTTTGGGCCAGGAGAGAGATGG - Intergenic
950167107 3:10809722-10809744 TGTTAGGGCCAGAATCAAGATGG - Intergenic
951054599 3:18133077-18133099 TGTTTAGGCCATGTTAAAGATGG + Intronic
951558088 3:23941485-23941507 TATTTTGGTCAGAATGAGGAAGG + Intronic
951660451 3:25057986-25058008 TGGTTTGGGCAGCATCAAGAGGG - Intergenic
951723799 3:25732454-25732476 TGTTTTTGTCAGAAAACAGAAGG - Exonic
953432583 3:42851916-42851938 TGTTTTGGGCAGAAGGAAGGGGG - Intronic
954347745 3:50014546-50014568 TGTTTTAATCAGTATAAAGAAGG - Intronic
955917589 3:63922550-63922572 TTTTTTGCCCAGAAAAAAGGGGG - Intronic
957518317 3:81285649-81285671 TTTTTTTGCCAGACTGAAGATGG + Intergenic
959134681 3:102402712-102402734 GGTTTTTGCTTGAATAAAGATGG - Intronic
959854601 3:111136080-111136102 TGAGGTGGCCAGAAGAAAGATGG + Intronic
960070149 3:113420487-113420509 TGTTTTTGCAAAAATAAATAAGG + Intronic
960292355 3:115900961-115900983 TGTTTTTGCCAAAATTGAGAGGG - Intronic
961944768 3:130674183-130674205 TGTATTGGCCAGTACAAAAAAGG - Intronic
962731507 3:138287916-138287938 TGTTTTCGCCTGAATGAAAAAGG - Intronic
962800432 3:138885658-138885680 TATTTTGTCTATAATAAAGATGG - Intergenic
963411864 3:144938486-144938508 GATTTTGACCAAAATAAAGATGG - Intergenic
963558001 3:146820246-146820268 TGCTTTGGCTAGAATAGAGCAGG + Intergenic
964359736 3:155882123-155882145 TGCTTTGGCCAATATAATGAGGG - Intronic
966743037 3:183251604-183251626 TGACTTGGCCAGCATGAAGAAGG - Intronic
966866846 3:184262850-184262872 TAATTTGGCCAGATTAAGGAAGG - Intronic
967986664 3:195100379-195100401 TGCTTTGGCCAGGACAAGGAGGG + Intronic
970017043 4:11523196-11523218 TGTTTTGGCCATAATAACAGGGG + Intergenic
971206387 4:24573741-24573763 TGCTCTGGCTAGAATACAGAGGG - Intronic
974120331 4:57630462-57630484 TGTTTGGTAAAGAATAAAGAAGG - Intergenic
974773444 4:66446816-66446838 TGTTTTAGCCATTTTAAAGATGG - Intergenic
975716566 4:77210811-77210833 GGCTTTGGCCAGAGTAAAAAAGG + Intronic
976130089 4:81874734-81874756 TGTTGTGGCCTGAAAATAGATGG - Intronic
976774806 4:88697132-88697154 TGTTTTTCCCAGAATATCGATGG - Exonic
977023303 4:91784556-91784578 TGCTGTGACCAGAATAAACAGGG + Intergenic
977609896 4:99020769-99020791 TATTTTGGCCAGAAAACAGCAGG + Intronic
978744860 4:112181310-112181332 TTTTTTGGCCAAACCAAAGATGG - Intronic
978744861 4:112181317-112181339 TGGTTTGGCCAAAAAAAAAAAGG + Intronic
978990610 4:115077488-115077510 TGTTTAGGCCAAAATAAAATTGG - Intronic
979848811 4:125551113-125551135 TATTCTGTCCAGAATTAAGATGG + Intergenic
980847499 4:138341740-138341762 TGATTTGGTCAGAAGAAGGAAGG + Intergenic
982032599 4:151315549-151315571 TATTTTGGACAGAATTAGGATGG + Intronic
982394837 4:154905082-154905104 AGTTCTGGCCAGAACAATGAAGG - Intergenic
983237778 4:165199289-165199311 TGTTTTGGTCAGAATGGAGGAGG + Intronic
984353369 4:178623470-178623492 TTTTTTAACTAGAATAAAGATGG - Intergenic
984904040 4:184610459-184610481 TGCTTTGCCCAGACTACAGAGGG - Intergenic
984907862 4:184647083-184647105 TGTTTGGGCCTAAACAAAGATGG - Intronic
985286624 4:188342922-188342944 TGTGTTGGGCAGTATGAAGAGGG + Intergenic
986147321 5:5090739-5090761 TGGTGTGGCTAGAATAAAGCAGG - Intergenic
986222754 5:5784340-5784362 TGTTTTTGTTAGAATAAAAAAGG + Intergenic
986493766 5:8320708-8320730 ATTTGTGGACAGAATAAAGAAGG + Intergenic
987062590 5:14256849-14256871 GGCTTTTGCAAGAATAAAGAAGG + Intronic
988394677 5:30681345-30681367 TGTTTTCACCACAATAAACATGG + Intergenic
990152304 5:52832735-52832757 TATTTCTGCCAGAATAAAAAGGG - Intronic
992190951 5:74291292-74291314 TTTTTTGCTCAGAAAAAAGACGG + Intergenic
992313247 5:75524787-75524809 TCTTTTGGACAGAATAATGGGGG - Intronic
992425065 5:76648358-76648380 TGTTTTGGCAAGGAAAAAGTGGG - Intronic
992833547 5:80618589-80618611 AGTTTTGGCCAGAAGAATGTGGG + Intergenic
993136353 5:83970849-83970871 TGCTTTGGACAGAACAAAGTTGG + Intronic
994185490 5:96810546-96810568 TGCATTGGCCAGAACAAGGAGGG + Intergenic
994939471 5:106302962-106302984 TATTTTGACCATAATAAAAAAGG + Intergenic
995738069 5:115324781-115324803 GGTTTTGGCCAAAAGAAAGGTGG - Intergenic
996679482 5:126215664-126215686 TGTTTTGACCAGCAGAATGAGGG - Intergenic
996863731 5:128093829-128093851 TGTTTTGGGCACAATAGTGATGG - Intronic
997000088 5:129749015-129749037 TCTTTTGGTCAGCAAAAAGAAGG - Intronic
997009287 5:129857904-129857926 TGTTGGGGCCACAATAAAGGAGG + Intergenic
997844466 5:137274159-137274181 TGTCTTGGCCAGAGTACAAATGG - Intronic
999751235 5:154629473-154629495 AGTTTTGGACAGAATCAAGGAGG + Intergenic
1000751269 5:165098826-165098848 TGTTCTTACCACAATAAAGAGGG - Intergenic
1000937537 5:167321299-167321321 TGTTCAGGCCAGGATAAAAAAGG + Intronic
1001014950 5:168132033-168132055 TGTTTTGGCCAAATTATAGGGGG - Intronic
1001162583 5:169334109-169334131 GGTTTTGGAGAGAAGAAAGAAGG - Intergenic
1001249146 5:170132754-170132776 TGTTTTTTCCAAAATACAGATGG + Intergenic
1003316242 6:5014607-5014629 TCTGTTGGCCAGAGTAAATAAGG + Intergenic
1003666726 6:8118357-8118379 TGTTGTGGCCAGAAGGTAGATGG - Intergenic
1003768483 6:9268841-9268863 TGTTCTAGCCATAATAAAGCAGG - Intergenic
1005008864 6:21316534-21316556 TGCTTTGGACAGAATAAAAAAGG - Intergenic
1005908286 6:30284724-30284746 TGTTTTGACCAAAATACTGATGG - Intergenic
1006734931 6:36266814-36266836 CGTTTTGGCAAGAATAATCACGG + Intronic
1007154938 6:39733437-39733459 TTTTTTTGCCTGAAAAAAGAAGG - Intergenic
1007993932 6:46286549-46286571 TGTTTTGGCCAGAATAAAGATGG + Intronic
1008478963 6:51964464-51964486 TGCTTTGGAGAAAATAAAGAAGG - Intronic
1009742354 6:67762412-67762434 TGCTTTGGTCAGAATAATGCTGG - Intergenic
1013609769 6:111783712-111783734 TCTTTTGGGAAGAAGAAAGAGGG - Intronic
1014562190 6:122904888-122904910 GGTTTTGGCCATCATAAATAAGG + Intergenic
1015994443 6:138983994-138984016 TGTTTTGGTGAGAATACAGTGGG - Intronic
1016275540 6:142347932-142347954 TCTGTTGGCCAGAAAAAACATGG - Intronic
1018647069 6:165958864-165958886 TCTTTTGGGCAGAAGCAAGAGGG - Intronic
1020409783 7:7878404-7878426 TTTGTTGGCCACAATAGAGATGG + Exonic
1020578576 7:9966095-9966117 TGGTTTGGCAAGAATCAAAATGG - Intergenic
1022120834 7:27306474-27306496 TGTTTTGGTCAGAAAACATAAGG - Intergenic
1025139646 7:56451335-56451357 TCTATTGGCCAGAACAAATAAGG + Intergenic
1025239479 7:57259065-57259087 TCTATTGGCCAGAACAAATAAGG + Intergenic
1026081378 7:67224546-67224568 TGTTTTGGGGAGAAAAAAGAAGG - Intronic
1026695703 7:72589453-72589475 TGTTTTGGGGAGAAAAAAGAAGG + Intronic
1027768003 7:82370003-82370025 TATTTTAGCAAGAATAAAAATGG - Intronic
1028531628 7:91844878-91844900 TGTTTTGGCCAGTAAAAAGTAGG - Intronic
1031438849 7:121767447-121767469 AGTTGTGGGCAGAATAAAGGTGG - Intergenic
1031925218 7:127632467-127632489 AGTTTTGGCCAGAAGAAACATGG - Intergenic
1032860981 7:135879025-135879047 TTTTTTGCCCAGTATGAAGATGG + Intergenic
1034486695 7:151369702-151369724 TGTTTTGGCAAGAAGAAAAATGG - Intronic
1037408046 8:18564893-18564915 TTTTTTGGTCAGACTTAAGATGG - Intronic
1038185348 8:25268485-25268507 TGTTTTTGCATGAATAAATATGG - Intronic
1039756490 8:40528888-40528910 TTTTGTGACCAGAATAAGGAGGG - Intergenic
1040624355 8:49129271-49129293 TATTTTGGAAAGAAAAAAGAAGG + Intergenic
1040887887 8:52284918-52284940 TGATGTGGACAGAATATAGAAGG - Intronic
1044526335 8:93255747-93255769 TGTGTTTGCAAGAAAAAAGATGG + Intergenic
1044860143 8:96514994-96515016 TGCTTTACCCAGAATAAAGAAGG - Intronic
1045066404 8:98450283-98450305 TGTTTTTGCAAGAATGAAGAAGG - Intronic
1045361593 8:101438183-101438205 TGTTATGGGTAGAATAAACATGG - Intergenic
1045814383 8:106262338-106262360 TCTTTTGCCAAGAATAAAGGTGG - Intergenic
1046453470 8:114424863-114424885 TGTTTTTCCCAAAACAAAGATGG + Intergenic
1047035285 8:120931661-120931683 TGTGTTGGACAAAATAAAGGAGG + Intergenic
1048798303 8:138172049-138172071 TGTTCTGTGGAGAATAAAGAGGG + Intronic
1048958813 8:139558764-139558786 AGTTTTGGAGAAAATAAAGAAGG - Intergenic
1049284364 8:141766629-141766651 TCTTTTGTCCAGAATGAAAAGGG + Intergenic
1049960054 9:729685-729707 TGTTTTAGCTGGAATAATGATGG + Intronic
1051659377 9:19411020-19411042 TTTTTTGGCCAAAATAACCAAGG - Intronic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052434962 9:28414763-28414785 TGTTTTTGCCACAGTAATGATGG + Intronic
1052486496 9:29107477-29107499 TGTTTTCTCCAGAATATAAAAGG + Intergenic
1052581484 9:30360955-30360977 TGTTTTGGCCAAAAGAAACATGG + Intergenic
1057841285 9:98487363-98487385 TTTTTTGGCCAGAGTCAAGAGGG + Intronic
1058513727 9:105748168-105748190 CTTTGTGGCCACAATAAAGATGG - Exonic
1059619019 9:115983030-115983052 TGTTGTAGCCAGAGCAAAGAGGG - Intergenic
1187250873 X:17596956-17596978 AGTTCTGGCCAGAATATAGGTGG - Intronic
1187479583 X:19643027-19643049 TCTTCTGGCCAGAAGGAAGAGGG + Intronic
1188800391 X:34522697-34522719 TAATTTGTCCAGAATAAGGAAGG + Intergenic
1191077265 X:56468711-56468733 TAATTTGGCCAGGATAAACACGG + Intergenic
1193480464 X:82021218-82021240 TGTTTTCCTCAGAATAAAAATGG - Intergenic
1193677017 X:84467161-84467183 TGTTATGGCCAGATGACAGAGGG + Intronic
1194287452 X:92027478-92027500 TTTCTTGGCCATAATAAACATGG - Intronic
1194291834 X:92083007-92083029 TGGTTTTGACAGAATAAACATGG - Intronic
1195240549 X:102947497-102947519 GGTTCTGGCCAGTTTAAAGAGGG - Intergenic
1196070597 X:111517050-111517072 TGTTTTTGCCAATAAAAAGAAGG + Intergenic
1197379821 X:125726116-125726138 TATTTTGCTCAGAATAAAGTTGG + Intergenic
1198303814 X:135359873-135359895 TATCCTGGCCAGAAGAAAGATGG - Exonic
1198415276 X:136413538-136413560 TGATATGGCCAGCATAAAGTGGG - Intronic
1198587797 X:138142091-138142113 TTTTATGGCCATAAAAAAGATGG + Intergenic
1199322314 X:146455273-146455295 TGTATGGGCCTGAATAAAAATGG - Intergenic
1200604991 Y:5252045-5252067 TTTCTTGGCCATAATAAACATGG - Intronic
1200609350 Y:5307579-5307601 TGGTTTTGACAGAATAAACATGG - Intronic
1200853195 Y:7907131-7907153 TGTCTAAGCCAGAATATAGAGGG + Intergenic