ID: 1007995373

View in Genome Browser
Species Human (GRCh38)
Location 6:46302236-46302258
Sequence CCTGAAATGGAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007995369_1007995373 9 Left 1007995369 6:46302204-46302226 CCTGAGCAACTGGGCGGGTGATT 0: 1
1: 0
2: 0
3: 8
4: 237
Right 1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG No data
1007995364_1007995373 19 Left 1007995364 6:46302194-46302216 CCATCTGTGGCCTGAGCAACTGG 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007995373 Original CRISPR CCTGAAATGGAGAAAATGGC AGG Intronic
No off target data available for this crispr