ID: 1007996419

View in Genome Browser
Species Human (GRCh38)
Location 6:46312849-46312871
Sequence CTGCTCCCTACTTGGCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007996416_1007996419 13 Left 1007996416 6:46312813-46312835 CCTCATCTGTTAATAGAGAGGTA 0: 1
1: 0
2: 3
3: 14
4: 211
Right 1007996419 6:46312849-46312871 CTGCTCCCTACTTGGCATGTTGG 0: 1
1: 0
2: 2
3: 18
4: 140
1007996413_1007996419 19 Left 1007996413 6:46312807-46312829 CCGCCTCCTCATCTGTTAATAGA 0: 1
1: 0
2: 1
3: 16
4: 277
Right 1007996419 6:46312849-46312871 CTGCTCCCTACTTGGCATGTTGG 0: 1
1: 0
2: 2
3: 18
4: 140
1007996414_1007996419 16 Left 1007996414 6:46312810-46312832 CCTCCTCATCTGTTAATAGAGAG 0: 1
1: 1
2: 0
3: 13
4: 141
Right 1007996419 6:46312849-46312871 CTGCTCCCTACTTGGCATGTTGG 0: 1
1: 0
2: 2
3: 18
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007996419 Original CRISPR CTGCTCCCTACTTGGCATGT TGG Intronic
904823456 1:33259380-33259402 CTGCTTCCTCCTTTCCATGTGGG - Intronic
906179129 1:43803240-43803262 ATGCTCCCTACATGTCTTGTAGG + Intronic
907307265 1:53520300-53520322 TTGCCTCCTCCTTGGCATGTTGG - Intronic
907869746 1:58432519-58432541 CTGCTCCAGACTTGGCGGGTAGG - Intronic
912962694 1:114210035-114210057 CTGCTCCATCCTTTGCAAGTCGG + Intergenic
913968222 1:143394273-143394295 CTGTTCCCTCCTTGGCAGGTTGG - Intergenic
913972081 1:143423359-143423381 CTGCACCCTCCTGGGCATGGCGG + Intergenic
914062601 1:144219865-144219887 CTGTTCCCTCCTTGGCAGGTTGG - Intergenic
914066462 1:144248972-144248994 CTGCACCCTCCTGGGCATGGCGG + Intergenic
914112691 1:144717382-144717404 CTGCACCCTCCTGGGCATGGCGG - Intergenic
914116549 1:144746489-144746511 CTGTTCCCTCCTTGGCAGGTTGG + Intergenic
915737720 1:158095236-158095258 CTGCTCCCCACCTGCCATGGTGG - Exonic
917656074 1:177127009-177127031 ATGCTGTCTACTTGGCATGGGGG - Intronic
919765359 1:201123845-201123867 CTGCTCCGTACTTTGCCTTTCGG + Intronic
919811698 1:201412810-201412832 TTCCTCCCTACCTGCCATGTGGG - Intronic
920045694 1:203130782-203130804 ATGCACCCTACTTGCCCTGTGGG + Intronic
920679577 1:208062329-208062351 CTGCTCCCTTCCTGTGATGTGGG + Intronic
921005483 1:211088993-211089015 ATGCTCCGTACCTGGCATGTAGG - Intronic
923022248 1:230174244-230174266 CTGCTCCCCACGTGTCATGCGGG + Intronic
923426456 1:233874637-233874659 CAGCTGTCTACTTGGCAAGTTGG - Intergenic
1064040336 10:11957105-11957127 CTACTCCATACTGGGCATGGTGG - Intronic
1069819939 10:71221240-71221262 CTGGGCCCTGCTTGGCATCTGGG - Intronic
1070100698 10:73383339-73383361 CTGCTCCCTACATGAAATGAAGG + Exonic
1070714735 10:78711149-78711171 TGGCTCCCTCCTTGACATGTGGG - Intergenic
1073834840 10:107429391-107429413 CTGCTCCTTACTTGGGATTCAGG + Intergenic
1074301742 10:112239839-112239861 ATGCCCCCTGCTTGCCATGTTGG - Intergenic
1075312089 10:121422880-121422902 CTGCTGAGTACTTGGCATGGTGG - Intergenic
1075684097 10:124351990-124352012 GTGCTGCCTCATTGGCATGTTGG - Intergenic
1076271891 10:129160772-129160794 CTGCTCCCTATTTTTCAAGTTGG - Intergenic
1077303909 11:1859361-1859383 CTGCTCCATCCCTGGCAGGTGGG + Intronic
1080054168 11:27887933-27887955 CTGCTCCCAGCTTGTCATTTTGG - Intergenic
1083275564 11:61595224-61595246 CTGCCCACTCCTTGGCATGTGGG - Intergenic
1084463399 11:69308647-69308669 CTTCACCCTACATGGCTTGTTGG - Intronic
1084864445 11:72044356-72044378 CTAATTCCTACTTGGCATTTTGG + Intronic
1085919193 11:80931528-80931550 CTGGTCCTTACTTGTCATTTAGG - Intergenic
1087151014 11:94859625-94859647 CTGCTCCCACTTTGTCATGTCGG - Exonic
1089102396 11:115974407-115974429 CTGCTCCCTGCATGGGCTGTGGG - Intergenic
1090811068 11:130243928-130243950 CTGCTCCCTGCTTAACGTGTGGG + Intronic
1092105097 12:5915808-5915830 CTGCTCCCTCCATGCCATGTTGG - Intronic
1092159108 12:6305953-6305975 CTGTTCACTACAGGGCATGTTGG + Intergenic
1095863232 12:46942220-46942242 CTGCTTCATTCCTGGCATGTGGG + Intergenic
1095929272 12:47609398-47609420 TTTCTCCCAACTTGTCATGTTGG + Intergenic
1098577775 12:72063241-72063263 GTTCTCCCTCCTAGGCATGTGGG - Intronic
1099775002 12:87114458-87114480 CTGGTCTCTACTTAACATGTAGG + Intergenic
1102988620 12:117298705-117298727 GTCCTCCCTCCTTGGCTTGTAGG - Intronic
1105219219 13:18309981-18310003 TTGCTGCCTACTTTGCATTTTGG - Intergenic
1105581298 13:21699147-21699169 CTGCACCCTCCTCTGCATGTGGG - Intronic
1107264380 13:38535486-38535508 CTGCTCCGCACTTGGCAGGGTGG + Intergenic
1108286654 13:48915584-48915606 CTGCTCCCTACGTGGCATGCTGG + Intergenic
1108988007 13:56618730-56618752 TTGCTCCCTACATAGGATGTAGG - Intergenic
1111415061 13:87929497-87929519 CTGCTCCTGCCTTGACATGTGGG + Intergenic
1112943679 13:104897669-104897691 CAGATCCCTCCTTGACATGTGGG - Intergenic
1114837510 14:26220883-26220905 CTTGTCTCTACTTGGCATCTCGG - Intergenic
1120339432 14:83200559-83200581 CTGCACCCAACTTGGCATTCAGG + Intergenic
1121242019 14:92438014-92438036 CTGCTGAATTCTTGGCATGTGGG - Intronic
1122506152 14:102233174-102233196 CTTCTCCCTCCCTGGGATGTGGG + Intronic
1125522181 15:40354455-40354477 CTGCTCCCTTCTTTTCATTTGGG - Intronic
1129298100 15:74610798-74610820 CTGCTCCCTACCAGGCCTGGGGG - Intronic
1133931014 16:10232123-10232145 CTTTTGCCTTCTTGGCATGTGGG - Intergenic
1137624457 16:49899011-49899033 CTGCTCCCTTCATGGCCTCTAGG + Intergenic
1138317777 16:56085086-56085108 CTCCAATCTACTTGGCATGTTGG - Intergenic
1140772196 16:78215332-78215354 CAGGTCCCTACCTGGCACGTAGG - Intronic
1143057585 17:4173811-4173833 CTGCTCCCCACTGGGGAGGTTGG - Intronic
1143635101 17:8159881-8159903 CTGCTCCCCAGTTTTCATGTGGG - Exonic
1144949165 17:18984831-18984853 CTGCTCCCTATTTGTCATTTGGG + Intronic
1146502003 17:33372547-33372569 CTTCTCCCTACTTGGCTGCTGGG + Intronic
1150723026 17:67629423-67629445 CCCGTCCCTACTGGGCATGTTGG - Intronic
1152724978 17:81940722-81940744 CTGCTCGCTACTTGACACTTTGG + Exonic
1153699416 18:7677796-7677818 CTGCTCTTTACATGGCGTGTGGG - Intronic
1155201550 18:23522308-23522330 CTGCTGCCCACTTGGCATGAAGG + Intronic
1164867546 19:31617376-31617398 CTGCTCTCTGCTGGGCATGGGGG - Intergenic
1202702009 1_KI270712v1_random:171737-171759 CTGTTCCCTCCTTGGCAGGTTGG - Intergenic
926691188 2:15735026-15735048 CTGCTCACTACTTGGAGTGGTGG - Intronic
928782188 2:34837042-34837064 ATGCTCCCTACTTGGGTGGTGGG + Intergenic
929772188 2:44901647-44901669 CTGCTCCCTACCTTGCATCCTGG + Intergenic
930023280 2:47014290-47014312 CTGGTCCCTTCCTGGCAGGTTGG - Intronic
934172921 2:89555187-89555209 CTGTTCCCTCCTTGGCAGGTTGG - Intergenic
934184834 2:89662532-89662554 TTGCTGCCTACTTTGCATTTTGG + Intergenic
934283235 2:91629544-91629566 CTGTTCCCTCCTTGGCAGGTTGG - Intergenic
935050199 2:99518720-99518742 CTGCTCACTTCTTGCCATGGAGG - Intergenic
936712985 2:115154512-115154534 CTTTTCTCTACTTGACATGTAGG - Intronic
936961303 2:118077742-118077764 CTGCTGCCAACGTGGAATGTAGG - Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
943480432 2:188411015-188411037 TTGCTCTCTACTTGGGAGGTCGG + Intronic
943789098 2:191911610-191911632 CTGTTCCCTATTTGGCAGTTAGG + Intergenic
1169844499 20:9974895-9974917 CTGCCCCACACTTGACATGTGGG - Intergenic
1178305729 21:31488744-31488766 CTGGCCCCATCTTGGCATGTGGG + Intronic
1180816815 22:18794838-18794860 TTGCTGCCTACTTTGCATTTTGG - Intergenic
1181203006 22:21229185-21229207 TTGCTGCCTACTTTGCATTTTGG - Intergenic
1182801213 22:33033394-33033416 TTGCTCCCTCCTTGTCATTTTGG + Intronic
1183190060 22:36316468-36316490 CTGCTGCCTCCTTGGCCTGTTGG - Intronic
1184252110 22:43266687-43266709 CTGCTCCCTATTAGCCATCTGGG - Intronic
1203223915 22_KI270731v1_random:66241-66263 TTGCTGCCTACTTTGCATTTTGG + Intergenic
1203266914 22_KI270734v1_random:20559-20581 TTGCTGCCTACTTTGCATTTTGG - Intergenic
950088332 3:10277376-10277398 CTTCTGCCTACATAGCATGTGGG + Intronic
953727309 3:45411314-45411336 CTGCTCTCTACTAGGGGTGTCGG - Intronic
955044572 3:55347734-55347756 CTGCCCAGTCCTTGGCATGTAGG + Intergenic
955851762 3:63227605-63227627 CTTCTCTATATTTGGCATGTAGG + Intergenic
959370092 3:105513165-105513187 CTGTGCCTTACTTAGCATGTTGG + Intronic
960245977 3:115400830-115400852 CTGCACCCCACTAGGAATGTTGG + Intergenic
961263640 3:125622615-125622637 CTGCTCCCTACTTGGCTGGACGG + Intergenic
962552560 3:136510200-136510222 CTGGTCCCGCTTTGGCATGTGGG - Intronic
967963263 3:194941862-194941884 CTGCTCCCTCCCTGGCCTGTGGG + Intergenic
968427279 4:532372-532394 CTGCTCCCATCGTGGCATCTGGG + Intronic
969826769 4:9764043-9764065 CTGTTCCCTCCTCGGCAGGTGGG - Intergenic
970587676 4:17530127-17530149 CTGCTCCCTTCTTGGCATGATGG - Intergenic
972744673 4:41921630-41921652 CTGCTCTCTACTTGGGAGGTCGG + Intergenic
973668442 4:53188556-53188578 CTGCTCCTTCCTTGCCATGTAGG - Intronic
973980644 4:56305715-56305737 GTGCTCCTGACTTGGCATGCTGG + Intronic
976917156 4:90390443-90390465 CTGGGGACTACTTGGCATGTGGG - Intronic
977008468 4:91603835-91603857 CTGCTTCCTGATTTGCATGTTGG + Intergenic
977748036 4:100575152-100575174 CTGTGACCTACTTAGCATGTTGG - Intronic
979174286 4:117643037-117643059 CAGGTCCCTCCTTGACATGTGGG + Intergenic
980121717 4:128734779-128734801 GTGTTCACTGCTTGGCATGTGGG - Intergenic
980148577 4:129020037-129020059 CTGGTCCCTACCCGCCATGTGGG + Intronic
982832981 4:160086617-160086639 CTTCTCCCTCCTAGGCATCTGGG + Intergenic
984591130 4:181618962-181618984 CTGCACCCTGCTTGGCATCCTGG + Intergenic
990631095 5:57670024-57670046 CAGCTCCCTCCTCGACATGTGGG + Intergenic
992482993 5:77169509-77169531 CTACTTCCTACTTGCCATTTAGG - Intergenic
994041945 5:95268690-95268712 CTGCTCTCTACTAGGGAGGTCGG + Intronic
995661563 5:114489351-114489373 ATGCACCCTACAAGGCATGTCGG + Intronic
995853914 5:116573828-116573850 CTGCTCCCTGCTGGGCACGCGGG + Intronic
996612882 5:125404936-125404958 CAGCTTCCAACTTGGCCTGTTGG + Intergenic
999641844 5:153680288-153680310 CTGCCCCCTGCTTGCCATCTAGG + Intronic
1002535755 5:179874489-179874511 CTGCTCCCTCCAGGGCATGGGGG + Intronic
1002587130 5:180256369-180256391 CTCCTCCCTTCCTGGGATGTGGG + Intronic
1007429252 6:41767247-41767269 CTGCTCCCTGCCTGGCCTGAAGG - Intergenic
1007996419 6:46312849-46312871 CTGCTCCCTACTTGGCATGTTGG + Intronic
1013339475 6:109199356-109199378 CTGCACCCTACTTGGCCAGGTGG - Intergenic
1013605716 6:111745597-111745619 CTGCTCCCTCCTTCACATTTGGG - Intronic
1013617777 6:111860567-111860589 CTCTTCCCCACATGGCATGTTGG + Intronic
1015532062 6:134230610-134230632 CTGGTCTCTCCTTGCCATGTGGG + Intronic
1020908175 7:14092452-14092474 CTGCTCCTCACTTTGCATGTTGG + Intergenic
1023889602 7:44382760-44382782 CTGCTCTCCACTGGGCCTGTTGG - Exonic
1025965042 7:66261977-66261999 CTGTTCCCTAGGTGGCATATGGG + Intronic
1028666382 7:93348264-93348286 CTGCTGCCTATTAGGAATGTTGG + Intronic
1028987952 7:97022617-97022639 CTGCTTTCTCCTTGGCATCTGGG + Intronic
1029100518 7:98126145-98126167 CTGCTCCTTACTTCCCATGTAGG - Intronic
1029284645 7:99457291-99457313 CTGCAACCTGCTGGGCATGTGGG + Exonic
1031474220 7:122203684-122203706 CAACTCCCTTCTTAGCATGTTGG + Intergenic
1038686755 8:29725832-29725854 CTGATCCCCACTGGGCATGAAGG + Intergenic
1038930325 8:32186953-32186975 CTTCCCCCTACTGAGCATGTTGG + Intronic
1041534425 8:58909984-58910006 CTGCTCCCTGATGGGCATTTTGG - Intronic
1042512764 8:69628476-69628498 GTGCTCCCTACCTGGCAGATGGG + Intronic
1042989136 8:74619718-74619740 CTGGTCCCACCTTGACATGTGGG + Intronic
1047223082 8:122934570-122934592 CTTCTCCCTTCATGGCATTTGGG + Intronic
1047916563 8:129590376-129590398 CTGCTTCCACCTTGCCATGTGGG + Intergenic
1048342160 8:133548528-133548550 CAGCACACCACTTGGCATGTGGG + Intronic
1053114353 9:35489001-35489023 CTGCTACCCACTAGGGATGTTGG - Intergenic
1057451901 9:95170802-95170824 ATGCTCCCTACTGTGTATGTAGG + Intronic
1060047657 9:120353546-120353568 TTGCTCCCACCTTGGCGTGTGGG - Intergenic
1060846680 9:126842823-126842845 CTGCTCCCCACTTGGGACCTGGG + Intergenic
1061314401 9:129785684-129785706 CTGCACCCTCCTTGCCATGAAGG + Intergenic
1061670603 9:132186115-132186137 CTGCTCCCTCCTTCGAGTGTGGG - Intronic
1062221732 9:135419683-135419705 CGGCTCCCTACTGGGCATCAAGG + Intergenic
1062339352 9:136087123-136087145 CTGGGCCTTTCTTGGCATGTGGG - Intronic
1186764663 X:12758718-12758740 CTCCTCCATCCTTAGCATGTTGG + Intergenic
1192432197 X:71119897-71119919 ATGCTCCCTCCTTGGCCTGAAGG - Intronic
1196130060 X:112145875-112145897 CTGCTCTCTCCTTTGCTTGTTGG - Intergenic
1202179864 Y:22130509-22130531 CTGCCCCCTCCTAGGAATGTGGG + Intergenic
1202211497 Y:22455885-22455907 CTGCCCCCTCCTAGGAATGTGGG - Intergenic