ID: 1007997681

View in Genome Browser
Species Human (GRCh38)
Location 6:46325916-46325938
Sequence CAGAGTTTCTTCTTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2767
Summary {0: 1, 1: 0, 2: 28, 3: 587, 4: 2151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007997672_1007997681 23 Left 1007997672 6:46325870-46325892 CCGAGTGCTTATGTTTGCAAAAA 0: 1
1: 2
2: 1
3: 24
4: 264
Right 1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG 0: 1
1: 0
2: 28
3: 587
4: 2151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007997681 Original CRISPR CAGAGTTTCTTCTTTGAGGT GGG Intronic
Too many off-targets to display for this crispr