ID: 1007998510

View in Genome Browser
Species Human (GRCh38)
Location 6:46334502-46334524
Sequence TTACCTCAGCCTCCCTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 319}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007998510_1007998511 -7 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998511 6:46334518-46334540 GAGGTAAATGAAGATGACTCAGG 0: 1
1: 0
2: 0
3: 23
4: 218
1007998510_1007998514 9 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998514 6:46334534-46334556 ACTCAGGTCACTGGACAATAGGG No data
1007998510_1007998519 21 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998519 6:46334546-46334568 GGACAATAGGGATGGTGGGGTGG 0: 1
1: 0
2: 3
3: 22
4: 354
1007998510_1007998518 18 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998518 6:46334543-46334565 ACTGGACAATAGGGATGGTGGGG No data
1007998510_1007998517 17 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998517 6:46334542-46334564 CACTGGACAATAGGGATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1007998510_1007998515 13 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998515 6:46334538-46334560 AGGTCACTGGACAATAGGGATGG 0: 1
1: 0
2: 0
3: 31
4: 634
1007998510_1007998512 0 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998512 6:46334525-46334547 ATGAAGATGACTCAGGTCACTGG No data
1007998510_1007998523 28 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998523 6:46334553-46334575 AGGGATGGTGGGGTGGGGGCAGG 0: 1
1: 3
2: 39
3: 387
4: 2390
1007998510_1007998516 16 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998516 6:46334541-46334563 TCACTGGACAATAGGGATGGTGG No data
1007998510_1007998521 23 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998521 6:46334548-46334570 ACAATAGGGATGGTGGGGTGGGG 0: 1
1: 0
2: 3
3: 33
4: 388
1007998510_1007998522 24 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998522 6:46334549-46334571 CAATAGGGATGGTGGGGTGGGGG 0: 1
1: 0
2: 4
3: 51
4: 472
1007998510_1007998513 8 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998513 6:46334533-46334555 GACTCAGGTCACTGGACAATAGG No data
1007998510_1007998520 22 Left 1007998510 6:46334502-46334524 CCTGAGAAGGGAGGCTGAGGTAA 0: 1
1: 0
2: 3
3: 23
4: 319
Right 1007998520 6:46334547-46334569 GACAATAGGGATGGTGGGGTGGG 0: 1
1: 0
2: 0
3: 28
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007998510 Original CRISPR TTACCTCAGCCTCCCTTCTC AGG (reversed) Intronic
900432048 1:2607069-2607091 TGACCACTGCGTCCCTTCTCAGG - Exonic
900481061 1:2899552-2899574 TTCCCTCCCGCTCCCTTCTCAGG + Intergenic
901171317 1:7259820-7259842 TTCCCTCAGCCTTTGTTCTCTGG + Intronic
901798697 1:11694735-11694757 CTACTCCAGCCTTCCTTCTCAGG + Intronic
901906439 1:12416068-12416090 CTACCTCAGCCTCCCGTAGCTGG - Intronic
903157091 1:21453242-21453264 TTCCCTCTCCCTCCCTGCTCTGG + Intronic
903430907 1:23298917-23298939 CTACCTCAGCCTCCCAGGTCTGG + Intergenic
904358013 1:29954014-29954036 GTTCATCAGCCTCCCTTCCCAGG + Intergenic
904607275 1:31704615-31704637 CTCCCTCAGTCTCACTTCTCTGG - Intergenic
904841101 1:33372447-33372469 TTCCCCCTCCCTCCCTTCTCAGG - Exonic
906264142 1:44416205-44416227 TTACCTCAGTCTCCTTCCTGGGG - Intronic
907418092 1:54328330-54328352 TCACCTCAGCCTCCTGCCTCAGG - Intronic
908857706 1:68448569-68448591 TTATGTCAGTCTCTCTTCTCTGG - Intronic
910564862 1:88632067-88632089 TTTCCTCACCCTCACTTCCCTGG - Intergenic
913545160 1:119860655-119860677 TTCCCTCTCCCTCCCTGCTCTGG - Intergenic
913601895 1:120429185-120429207 TTCCCTCTCCCTCCCTGCTCTGG + Intergenic
913717398 1:121550689-121550711 TTTCCTGAGCCAACCTTCTCAGG - Intergenic
913992528 1:143627832-143627854 TTTCCTCTCCCTCCCTGCTCTGG - Intergenic
914085148 1:144447418-144447440 TTCCCTCTCCCTCCCTGCTCTGG - Intronic
914363076 1:146952824-146952846 TTCCCTCTCCCTCCCTGCTCTGG + Intronic
914488602 1:148134315-148134337 TTCCCTCTCCCTCCCTGCTCTGG - Intronic
914588966 1:149089396-149089418 TTCCCTCTCCCTCCCTGCTCTGG - Intronic
914921610 1:151851218-151851240 TGACCATACCCTCCCTTCTCCGG - Intronic
915044375 1:152999829-152999851 TTCCCACTGGCTCCCTTCTCTGG - Intergenic
915467098 1:156104210-156104232 ATAGCTCAGCCTCCCAGCTCGGG + Intronic
915472729 1:156135506-156135528 TTACCTCACCTTCACTTCTCAGG + Intronic
916720670 1:167482773-167482795 TCACCTCATCTTCCCTTCCCAGG - Intronic
917204958 1:172562444-172562466 TTGCCTCAGCCTCCCATAGCTGG + Intronic
918538007 1:185595830-185595852 TGACCTCAGCATCCCTTCTTTGG - Intergenic
919831136 1:201540674-201540696 TTCCCTCTGTCTCCCTTCTTAGG - Intergenic
921623161 1:217348860-217348882 TCAGCACTGCCTCCCTTCTCTGG + Intergenic
923283068 1:232463276-232463298 TTAACTCAGTATCCATTCTCAGG - Intronic
923574448 1:235145350-235145372 TCACTGCAGCCTCCATTCTCCGG + Intronic
924454762 1:244210563-244210585 TTCCCCCGGCCTGCCTTCTCGGG + Intergenic
1062901523 10:1150322-1150344 TGTCCTCAGGCTCCCTTCCCAGG + Intergenic
1063020567 10:2123008-2123030 CTACCTCAGTCCCCCATCTCAGG + Intergenic
1063482261 10:6386124-6386146 GTAGCTCAGCCTCCATTCCCAGG + Intergenic
1063662326 10:8043308-8043330 TTCCTCCAGCCTCCCTTCTCCGG - Intergenic
1064138907 10:12773772-12773794 TAATCCCAGCCTCCCTACTCAGG + Intronic
1064257178 10:13752392-13752414 TTTCCTCATCCTTCCCTCTCAGG - Intronic
1065473506 10:26108912-26108934 TTACCTAAACCTCCCTTGTAAGG - Intronic
1066256733 10:33686801-33686823 TCACTTCAGGCTCTCTTCTCAGG - Intergenic
1067424610 10:46196408-46196430 TTGCCCCAGCCTCCATGCTCTGG - Intergenic
1067961426 10:50855994-50856016 ATACTTCAGCCTTCCTACTCTGG - Intronic
1067968494 10:50942037-50942059 TTACCTCACCCTCCTTCTTCAGG + Intergenic
1069578225 10:69545459-69545481 TCCCCTCAGCCTCCCTCCCCAGG - Intergenic
1070668277 10:78360668-78360690 TTTCCTCTGCCTTGCTTCTCTGG + Intergenic
1073148235 10:101294312-101294334 TTGTCTCAGCCTCCCATCTAGGG + Intergenic
1073760295 10:106621812-106621834 TTAGCTCACCCTCCCTAATCTGG + Intronic
1074160731 10:110834426-110834448 TGTCCTCACCCTCCCTTCTGGGG - Intronic
1074876525 10:117617813-117617835 GTAGCTCAGCCTCCGATCTCAGG - Intergenic
1076131789 10:128018581-128018603 TTCTCTCAGCCCCCCTCCTCTGG - Intronic
1078067156 11:8086050-8086072 TTTCCTGAGCCTCCCTGTTCAGG + Intronic
1080719903 11:34838612-34838634 TGACCTCTACCTCCCATCTCAGG + Intergenic
1080827748 11:35862040-35862062 TTGCCTCAGCCTCCTTTCTGGGG - Intergenic
1080875234 11:36268889-36268911 TTTCCTTTGCCTCCCTTTTCTGG - Intergenic
1081779437 11:45699733-45699755 TTAACTCAGACTCTCTTCACTGG + Intergenic
1083322181 11:61854602-61854624 ATACCTCTCCCTCCCTTCCCTGG + Intronic
1088647553 11:111928685-111928707 TCACCGCAGCCTCGCCTCTCGGG - Intronic
1089372949 11:117974484-117974506 CTACCCCAGCCTCTCTTTTCAGG - Intergenic
1090668534 11:128930680-128930702 TAACCCCAGCCTCCCTACCCTGG - Intergenic
1095274842 12:40268805-40268827 TTTCCTGAGCCACCCTTCTGTGG - Intronic
1098110393 12:67115380-67115402 CTACCTCAGCCTCCCCTAGCTGG - Intergenic
1098943689 12:76566070-76566092 CTACCTCAGCCTCCCGGGTCAGG - Intergenic
1100543294 12:95578388-95578410 TTCCCTCTGCCTCCTTTCTTTGG + Intergenic
1101949586 12:109164305-109164327 TTACTGCAACCTCCATTCTCTGG + Intronic
1102244216 12:111344749-111344771 TTGCCCCTGCCTCCCTGCTCAGG - Intronic
1102538269 12:113598590-113598612 CTGCCTCAGCCTCCCTACTAGGG - Intergenic
1102753140 12:115313695-115313717 TTATTTCAGCCTCCCTTATGAGG - Intergenic
1104047764 12:125174998-125175020 TTCACACAGCCTCCCTTCACGGG + Intergenic
1106065470 13:26344040-26344062 CAACCTCACCCTCCCTCCTCTGG + Intronic
1107675661 13:42794091-42794113 TAACCTGAGCCTGTCTTCTCAGG + Intergenic
1108757456 13:53521254-53521276 GTGCCTCAGCCTGCCTTCCCTGG - Intergenic
1109265422 13:60193335-60193357 TCACTGCAACCTCCCTTCTCTGG + Intergenic
1109594604 13:64533660-64533682 TTACCTCAGGCCCCCATCCCAGG - Intergenic
1110332014 13:74283970-74283992 CTACCTCAGCCTCCCGTAGCTGG + Intergenic
1111445260 13:88339303-88339325 TTACCTCAGCCTCTCCTGCCTGG - Intergenic
1112747081 13:102538528-102538550 TTACCCCACACTCCCTTCTGCGG - Intergenic
1112859430 13:103812043-103812065 TTGCCTCAGCCTCCCATAGCTGG - Intergenic
1113760932 13:112846082-112846104 TTTCCACAGCTTCCCTTTTCTGG + Intronic
1117457299 14:55911213-55911235 TTTCCTCAGTCTCCTTTCTCAGG + Intergenic
1117953890 14:61108057-61108079 TTCCCTGAGCCTCCCCACTCTGG + Intergenic
1118004204 14:61551084-61551106 TTACATCAACCTCTCCTCTCAGG - Intronic
1118470702 14:66072749-66072771 CTGCCTCAGCCTCCCTTACCTGG - Intergenic
1118793357 14:69116312-69116334 TTTCCTCTGCCTCATTTCTCAGG - Intronic
1119406300 14:74401687-74401709 TTCTCTCAGCCTTCCTTCCCCGG - Intergenic
1119625541 14:76171500-76171522 TAACCTCCGCCTCCCCTCCCGGG - Intronic
1120347262 14:83306974-83306996 ACACCTCAGCCTCCTTCCTCTGG + Intergenic
1120347275 14:83307059-83307081 ACACCTCAGCCTCCCTCCTCTGG + Intergenic
1120347282 14:83307103-83307125 ACACCTCAGCCTCCTTCCTCTGG + Intergenic
1120347297 14:83307191-83307213 ACACCTCAGCCTCCTTCCTCTGG + Intergenic
1121812998 14:96907896-96907918 TTTCTTCTGCCTCCCTTTTCTGG + Intronic
1121824188 14:96997266-96997288 TTACTACAGCATCCCTTCCCTGG - Intergenic
1122051992 14:99066881-99066903 TTACCTCAGCCTCCACTCTGGGG + Intergenic
1122384025 14:101331762-101331784 TGACCTCTGCCTCCATCCTCAGG + Intergenic
1122617384 14:103029246-103029268 TTTCTTTAGCCTCACTTCTCTGG - Intronic
1122687775 14:103518216-103518238 TGCCCTCAGCCTCCCCTTTCTGG + Intergenic
1122871586 14:104641238-104641260 TCTCCCCAGCCTGCCTTCTCAGG - Intergenic
1123110429 14:105864553-105864575 TTCCTTCTGCCTCCTTTCTCTGG - Intergenic
1123971356 15:25510989-25511011 ATACCCTAGCCTCCCTTCACAGG - Intergenic
1124583104 15:30979607-30979629 TTACTTCTGCTTCCCTTCTCAGG - Intronic
1125020130 15:34976214-34976236 ATACCTCATGCTCCCTTCACAGG - Intergenic
1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG + Intergenic
1128004574 15:64226441-64226463 CTGCCTCAGCCTCCCTAGTCTGG - Intronic
1128742122 15:70091075-70091097 GTACATAAGCTTCCCTTCTCTGG + Intronic
1130061323 15:80572235-80572257 TTACCTCTGCCTTCCTTCCACGG + Intronic
1132748056 16:1445157-1445179 GCCCCTCAGCCTCCCTCCTCTGG - Exonic
1133146092 16:3787773-3787795 CTGCCTCAGCCTCCCACCTCAGG + Intronic
1133442486 16:5832333-5832355 CTACCTCAGCCTTCCTTCTGTGG - Intergenic
1136502554 16:30679990-30680012 TTACCTCAGCCTCCGCTTCCCGG + Intergenic
1139322773 16:66128882-66128904 TGACCTCAGCCTGCCCTTTCTGG - Intergenic
1139705726 16:68739020-68739042 TTACTGCAGCCTCCATCCTCTGG + Intronic
1141042080 16:80681331-80681353 TAACCTCACCTTCCCTTATCTGG - Intronic
1142038021 16:87874358-87874380 TTGCCTCAGCCTCCCATTACAGG - Intergenic
1142556646 17:782674-782696 TCACCTCAGCCTCCTGTCCCCGG - Exonic
1143583386 17:7839106-7839128 TCACCTCAGACTCGCTCCTCAGG - Intergenic
1143629286 17:8128238-8128260 TCACTGCAGCCTCCCCTCTCAGG - Intergenic
1143779473 17:9221811-9221833 TGACCTCAGGCTCCCTTCCCGGG + Intronic
1144211058 17:13016142-13016164 TTAGACCAGTCTCCCTTCTCAGG - Intronic
1145125566 17:20297252-20297274 CTTCCTCAGTTTCCCTTCTCAGG + Intronic
1145296596 17:21598083-21598105 CTACCTCGGCTTCCTTTCTCCGG + Intergenic
1146681789 17:34813623-34813645 CTGCCTCAGCCTCTTTTCTCTGG - Intergenic
1146933299 17:36793305-36793327 TTACCTTACTCTCCCTTCGCGGG - Intergenic
1147177842 17:38667654-38667676 CTTCCCCAGCCACCCTTCTCTGG + Intergenic
1147892067 17:43724502-43724524 TTGCCTCAACTTCCCTTGTCAGG + Intergenic
1147914879 17:43880203-43880225 GGACCTCAGCCTCTCTTCTGTGG - Intronic
1148544103 17:48503774-48503796 TTATCTCAGCCTCTCTTCTCAGG - Intergenic
1148834098 17:50456335-50456357 TTACCTCAGCTTCTCTCTTCAGG - Intronic
1150162822 17:62913717-62913739 ATTCCTCAGCCCCCCTTCCCAGG + Intergenic
1150360635 17:64530581-64530603 TTACCTCAACCTCCGTTTCCCGG + Intronic
1151610014 17:75166793-75166815 CTGCCTCAGCCTCCCGTCTTAGG - Intronic
1151853781 17:76707982-76708004 TCTCCTCAGCCTCCCTGCCCTGG + Intronic
1152547332 17:81007924-81007946 TTACTGCAGCCTCCGTTTTCTGG - Intronic
1155163636 18:23215531-23215553 TGACATCAGCCTCGTTTCTCTGG + Intronic
1155249514 18:23941271-23941293 TTTCCCCAGCCTCCCGCCTCTGG + Intronic
1155335665 18:24763127-24763149 TTACCTGAGGCTCCCTTCCCAGG - Intergenic
1155683002 18:28512874-28512896 TTACCTCCTCTTCACTTCTCTGG + Intergenic
1157386047 18:47260809-47260831 TTACCTCAACCTCCCGGGTCAGG + Intergenic
1159773947 18:72582939-72582961 GTATCTCAGCCTGCCTTCCCAGG + Intronic
1160117208 18:76090465-76090487 TTGCCTCATCCCCACTTCTCAGG - Intergenic
1160563625 18:79773619-79773641 TTTCCTCAGCCTGCTTTCTCTGG - Intergenic
1160688401 19:448287-448309 TGACCTCAGACTCCCGGCTCTGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1160880180 19:1316091-1316113 AGACCTCAGCCTGCCTGCTCCGG - Intergenic
1160906604 19:1454489-1454511 CCACCTCAGCCTCCCATGTCAGG + Intronic
1161520868 19:4723004-4723026 TTCTCTCAGCCTCCCTTCTCAGG - Intronic
1161728466 19:5944548-5944570 TTACATCAGCCTCCCAGCACAGG + Intronic
1162814334 19:13184212-13184234 TTACCGCAACCTCCCTCTTCCGG + Intergenic
1163431135 19:17268503-17268525 TCACCGCAGCCTCCCCTCCCGGG + Intronic
1163697650 19:18772080-18772102 TGACCTCAGTCTCCCGTCTGTGG - Intronic
1164580689 19:29433169-29433191 TGACCTCAGCTCCCCTTGTCTGG - Intergenic
1167817668 19:51898351-51898373 TTGCCACAACCTCCCTGCTCAGG + Intronic
925641902 2:5993548-5993570 TTGCCTCAGCCTCCCGTTTCTGG + Intergenic
926213529 2:10889466-10889488 TCACCTCACCCTTACTTCTCTGG - Intergenic
926294940 2:11562373-11562395 TTTCCTCTGCCTGCATTCTCAGG - Intronic
926312529 2:11685074-11685096 TTACGTCATCCTCCCGTCTCGGG - Intronic
927515059 2:23667484-23667506 TCAGATCAGCCTCCCTCCTCTGG + Intronic
927779147 2:25925503-25925525 TTCCCTTATCCTCTCTTCTCAGG - Intergenic
928137227 2:28696668-28696690 CTGCCTCAGCCTCCCATCGCTGG - Intergenic
928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG + Intergenic
929514264 2:42592147-42592169 CTGCCTCAGCCTCCCTTAGCTGG - Intronic
929585140 2:43108946-43108968 CTACCTCAGCCTCCCATAGCTGG - Intergenic
933492546 2:83006371-83006393 TTTCCTCTGCCTCTCTTTTCTGG + Intergenic
933867415 2:86534309-86534331 CTACCTCAGCCTCCCGTACCTGG + Intronic
934515679 2:94985039-94985061 TTGCCTCTCCTTCCCTTCTCTGG - Intergenic
936789355 2:116132907-116132929 CTACCTCAGCCTCCCATAGCTGG + Intergenic
937231648 2:120401429-120401451 CTCCCTCAGCCTCCCCTCCCAGG - Intergenic
937816442 2:126256060-126256082 TTGCCTCAGCCTCCCTTACAGGG - Intergenic
938406683 2:131036729-131036751 TTCCCACTGCTTCCCTTCTCAGG - Intronic
941834446 2:170000839-170000861 TTTTCTCAGCCTTCCTTCTAAGG - Intronic
942720028 2:178941099-178941121 TCTCCTTAGCCTCTCTTCTCTGG + Intronic
943597705 2:189878103-189878125 TTGCCTCAGCCTCCCGTAACTGG + Intergenic
944561769 2:200946831-200946853 TTACATCAGCATTTCTTCTCTGG + Intronic
944762598 2:202832332-202832354 CTGCCTCAGCCTCCCATATCTGG - Intronic
944822591 2:203445651-203445673 CCACCTCAGCCTCCTTGCTCAGG - Exonic
945222996 2:207503632-207503654 GTATCTCAGCATCTCTTCTCTGG + Intergenic
945773657 2:214078009-214078031 TTACTTTAGCCTCTCTTTTCTGG + Intronic
945977928 2:216285055-216285077 ATACCTCACCCTGCCTTCTGGGG - Intronic
946248859 2:218401197-218401219 TTACCTGAGCACCCCTGCTCAGG - Intronic
946855699 2:223947819-223947841 GTACCTCCCCCTCCCTTCACAGG + Intergenic
947480636 2:230496743-230496765 TTCCCTCAGTCTCCCAGCTCTGG + Intronic
947572028 2:231243586-231243608 ATAACTCATCCTCCCTCCTCTGG - Intronic
947651529 2:231790446-231790468 ATACCTCAGGCTACTTTCTCAGG - Intronic
948199018 2:236116226-236116248 CTATCTCAGCCTCCCTTTTGTGG + Intronic
948578277 2:238967887-238967909 CTCCCTCAGCCTCCTGTCTCTGG + Intergenic
949043999 2:241862326-241862348 TTTTCTCAGCCTTCCTTCCCAGG + Intergenic
1168968497 20:1914652-1914674 TGAGTACAGCCTCCCTTCTCGGG + Intronic
1169555566 20:6745773-6745795 TTGCCTCACCATCCCTTCTATGG - Intergenic
1171206284 20:23283700-23283722 TTACCTCAGACTCTCATCCCAGG + Intergenic
1171272755 20:23829113-23829135 TTCCCTCTCTCTCCCTTCTCTGG - Intergenic
1174739913 20:53002514-53002536 AAACCACAGCCTCCATTCTCTGG + Intronic
1175353265 20:58341529-58341551 GTACCTCAAGCTCCCTTCTTGGG - Intronic
1176387074 21:6143503-6143525 CTTCCTCAGCCTCCCTGCACTGG + Intergenic
1176664329 21:9670599-9670621 TTCCCTCTTCCTTCCTTCTCTGG + Intergenic
1177342734 21:19825947-19825969 TTTCCTCAGGCTCTCCTCTCTGG + Intergenic
1179377163 21:40860741-40860763 TTACCTCATCTTCCCTTTTCTGG - Intergenic
1179736399 21:43394749-43394771 CTTCCTCAGCCTCCCTGCACTGG - Intergenic
1181105110 22:20569633-20569655 ATACCTCAGATTCCCTCCTCAGG - Intronic
1181613555 22:24036163-24036185 GTACCTGAGCCTCCTTTGTCTGG - Exonic
1182045458 22:27270719-27270741 TCTCCTCACCCTCCTTTCTCTGG - Intergenic
1182077982 22:27507892-27507914 TTTCCTCACTCTGCCTTCTCTGG + Intergenic
1182862339 22:33570906-33570928 TTTCCTCAGCCTGCCTTCGAGGG - Intronic
1183006670 22:34908730-34908752 TGACAACAGCCTCCCTTCCCAGG + Intergenic
1183035998 22:35141434-35141456 TTCCCCCAGCCTCCCTCCTCTGG + Intergenic
1183064593 22:35354288-35354310 CTCCCTCAGGATCCCTTCTCAGG + Intergenic
1183102109 22:35590661-35590683 GAACCTCAGCCACCCTTCTTAGG + Intergenic
1183302789 22:37066477-37066499 CTGCCTCCGCCTCCCTTCTGTGG + Intronic
1183621342 22:38974674-38974696 TTTACTCTGCCTCCCTCCTCTGG + Intronic
1184044340 22:41963335-41963357 CTGCCTCAGCCTCCCGTGTCTGG + Intergenic
1184641688 22:45876381-45876403 TCACCGCAGGATCCCTTCTCTGG + Intergenic
1184783213 22:46659322-46659344 CTCCCTCAGCCTCCCCACTCAGG + Intronic
1184819126 22:46895484-46895506 TTGCCTCAGCCTCCCTGGGCTGG + Intronic
1185321547 22:50202319-50202341 GTCCCTCAGCATCCCTTCCCCGG + Intronic
1185361519 22:50410597-50410619 GTGCCTCAGCCTCCCGTCTGGGG + Intronic
949144637 3:682954-682976 TAACATCTGCCTCCCTTTTCTGG - Intergenic
949204831 3:1425357-1425379 TTACCTCACCCTCACTGCTCCGG - Intergenic
949600214 3:5590212-5590234 TCACCTCAGCCTGGCTTCACAGG - Intergenic
950427787 3:12933993-12934015 TTATCCCAGCCTCCCCTCTAGGG + Intronic
950767387 3:15283320-15283342 TTACTGCAGCCTCCCTTTCCTGG - Intronic
954095647 3:48325715-48325737 TAATCCCAGCCTCCCATCTCAGG - Intronic
954545070 3:51426883-51426905 TTACATCAGCCACCCTTTTCTGG + Intronic
956898859 3:73692917-73692939 ATACCCCAGCCTCCCATCTTTGG - Intergenic
957496000 3:80992185-80992207 TTACCTCAACCTCCCTCTCCTGG + Intergenic
959911221 3:111765753-111765775 ACCTCTCAGCCTCCCTTCTCAGG - Intronic
962932750 3:140052849-140052871 CTTCCTGAGCCTTCCTTCTCTGG + Intronic
967035641 3:185646698-185646720 TTCCCTCACCCTCTCTCCTCAGG - Intronic
967036904 3:185654900-185654922 TTAGCTCAGCCCACCTCCTCTGG + Intronic
967599730 3:191371211-191371233 TTCCCTCAGTTTCGCTTCTCTGG + Intronic
967627759 3:191705416-191705438 TTCCCTCAGTTTTCCTTCTCTGG - Intergenic
968137421 3:196229018-196229040 TTCCCACAGCCACCCTTTTCTGG - Intronic
968713120 4:2135211-2135233 TTTCCCCAGCCTCACTCCTCAGG - Intronic
969306405 4:6328547-6328569 TTACCTCTGTGTCTCTTCTCTGG - Intronic
969837065 4:9850668-9850690 TCACCGCAGCCTCCCTTCACTGG + Intronic
969918290 4:10511517-10511539 TTACCTCCACCTCCTTCCTCAGG + Intronic
969942986 4:10753497-10753519 TTAGCTCATCTTCCCCTCTCCGG + Intergenic
970168510 4:13264925-13264947 CTTCCTCAGCCACCCTTCCCAGG + Intergenic
970246211 4:14066520-14066542 ACACCTCAGCAGCCCTTCTCTGG - Intergenic
971006842 4:22383888-22383910 TTTCTTCAGCCTCCTTTCACTGG - Intronic
976199823 4:82566984-82567006 TTACCACAGCCACCCTGCTGGGG - Intergenic
976293567 4:83447270-83447292 TTACTGCAGCCTCAATTCTCTGG - Intronic
977814617 4:101400343-101400365 TCTCCTCAGCCTCCCTTCAGGGG - Intergenic
978958700 4:114648057-114648079 TTAATTCAGCCTGCCTTCTGAGG + Intronic
979339259 4:119501421-119501443 CTGCCTCAGCCTCCCTAGTCAGG + Intronic
980900893 4:138904240-138904262 TAATCCCAGCCTCCCTACTCAGG + Intergenic
981424331 4:144585996-144586018 CAACCTCTGCCTCCCCTCTCAGG + Intergenic
982165322 4:152608739-152608761 TTATCTCAGCTTCCCCTATCAGG + Intergenic
982388601 4:154839262-154839284 TTCCCTCAGCCCCCCATCACTGG - Intergenic
982915378 4:161202606-161202628 TAACCCCAGCCCCCATTCTCTGG - Intergenic
985409793 4:189671278-189671300 TTCCCTCTTCCTTCCTTCTCTGG + Intergenic
985874293 5:2583635-2583657 TCACCTGTGTCTCCCTTCTCTGG + Intergenic
986669569 5:10131005-10131027 TTCCCTCTGCCTCCCTTATAAGG - Intergenic
987109357 5:14670715-14670737 TCTCCTCAGCCTCCTTTCTAGGG + Intronic
988000324 5:25339752-25339774 TTACTTCAGCCTCTGTTTTCAGG + Intergenic
988578744 5:32450686-32450708 TTACCTCAGCCTCCTGTAGCTGG - Intergenic
989189444 5:38655713-38655735 TTAACTCAGTCTAGCTTCTCTGG - Intergenic
989961162 5:50417095-50417117 TTTCCTGAGCCAACCTTCTCGGG + Intronic
992181431 5:74201741-74201763 TGCCCTCAGCCTCTATTCTCTGG - Intergenic
992530868 5:77650692-77650714 TGACCTCAGCCTTCATTCCCTGG + Intergenic
992591058 5:78295748-78295770 TTCCCCCAGCCCGCCTTCTCAGG + Intergenic
992635328 5:78720808-78720830 TTAACGCAGCCTCCCCTCTGTGG - Intronic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
992712405 5:79472525-79472547 CTACCTCAGCCTCCCATTCCTGG - Intronic
993466728 5:88256689-88256711 TTTCTTCAGCCTCCATTCCCAGG + Intronic
996439694 5:123476033-123476055 GTAACTCAGACTCCCCTCTCTGG + Intergenic
997297826 5:132778670-132778692 TTAACTATGCCTCCCTTCCCTGG + Intronic
997665696 5:135628028-135628050 TTCCCTGAGCCACCCTCCTCAGG - Intergenic
998206330 5:140159254-140159276 TTATCTCAGGCAGCCTTCTCAGG - Intergenic
999183744 5:149690160-149690182 TTAGCTCAGGCTCCCATCCCAGG - Intergenic
1000105410 5:158054421-158054443 TTAGCACAGCCTGCCTGCTCTGG - Intergenic
1000116531 5:158159259-158159281 CTACCTCAGCCTGCCTTCTGAGG - Intergenic
1001125031 5:169011568-169011590 ATTCCTCAGCCTTCCTCCTCGGG - Intronic
1001722255 5:173866548-173866570 TGCCCTCAGCCTTCCTTGTCTGG - Intergenic
1002380841 5:178828334-178828356 TTGCCTCAGCCTCCCGTAGCTGG - Intergenic
1002397964 5:178972604-178972626 TTACCACACCCTCTCTTCTTTGG - Intergenic
1003497012 6:6673055-6673077 CTACTTCTGCCTCCTTTCTCAGG + Intergenic
1003762553 6:9196766-9196788 TTCCCTCAGCCTCCCTGTGCTGG - Intergenic
1005582449 6:27247873-27247895 GTCCCACAGCCTCCCTTCTTAGG + Exonic
1006402388 6:33825419-33825441 GTGCCTCAGTGTCCCTTCTCAGG + Intergenic
1007998510 6:46334502-46334524 TTACCTCAGCCTCCCTTCTCAGG - Intronic
1010773878 6:79863183-79863205 CTAACTCAACCTCCATTCTCTGG - Intergenic
1015464426 6:133533039-133533061 CTAGCTTAGTCTCCCTTCTCTGG + Intergenic
1018046633 6:159970963-159970985 CCACCTCAGCCTCCCTTAACTGG - Intronic
1019706669 7:2500179-2500201 TTAACTCAGGCCCCATTCTCCGG + Intergenic
1021736612 7:23645471-23645493 TTACATCATGCTCCCTTTTCAGG - Intergenic
1022003903 7:26249740-26249762 TTACCACAGACTCCACTCTCTGG - Intergenic
1023513622 7:40978800-40978822 TTACTCGTGCCTCCCTTCTCGGG - Intergenic
1023630777 7:42162091-42162113 TAGCCTCTGCGTCCCTTCTCAGG - Intronic
1024560921 7:50644640-50644662 TTACCTGAGGTTCCCTACTCAGG - Intronic
1026138212 7:67682018-67682040 CTGCCTCAGCCTCCCTACTAGGG - Intergenic
1028964016 7:96781328-96781350 TCACCACAGCCTCCTTTCTTGGG + Intergenic
1028997152 7:97113585-97113607 CTGCCTCAGCCTCCCGTCTCTGG + Intergenic
1030407379 7:109131090-109131112 ATACCTCAGCTTCCATTTTCTGG - Intergenic
1030655284 7:112160850-112160872 TTTGCTCAGCCTTCATTCTCAGG - Intronic
1033787044 7:144744649-144744671 TCACCTAATCCTCCCTTCACTGG + Intronic
1033930468 7:146513885-146513907 TTTCCTCAGCTTCCGTTTTCTGG + Intronic
1035654221 8:1293346-1293368 TTCCCTGTGCCTCCCTTTTCTGG + Intergenic
1035654247 8:1293445-1293467 TTCCCTGTGCCTCCCTTTTCTGG + Intergenic
1036076926 8:5512622-5512644 TTGCCTCAGGCTCCCTTTCCTGG + Intergenic
1036227815 8:6974670-6974692 TTGCCTCAGCTTCTCTTATCTGG - Intergenic
1036230268 8:6993787-6993809 TTGCCTCAGCTTCTCTTATCTGG - Intergenic
1036232720 8:7012890-7012912 TTGCCTCAGCTTCTCTTATCTGG - Intronic
1037963435 8:23116431-23116453 GCCCCTCAGCCTCCCTGCTCTGG - Intronic
1039231146 8:35449726-35449748 TTCCTCCAGCCTCCCATCTCTGG + Intronic
1039815515 8:41091218-41091240 TTGCCTTATCCTCCCTTCACAGG - Intergenic
1041252838 8:55951166-55951188 TCACTGCAGCCTCCCTTCCCTGG - Intronic
1043015062 8:74928783-74928805 TAGCCTCAACCTCCCTGCTCAGG + Intergenic
1045393211 8:101735461-101735483 CTTCCCCAGCCTCCCCTCTCAGG + Intronic
1046190675 8:110790639-110790661 TTACCTCAGCCTCTCCTCATGGG + Intergenic
1047127954 8:121984048-121984070 TTACTTCAGCCTCTCCACTCAGG + Intergenic
1048662268 8:136618328-136618350 TTATCTCTGCCCTCCTTCTCCGG + Intergenic
1049176329 8:141194725-141194747 TTACCCGAACCACCCTTCTCAGG - Exonic
1049278389 8:141731498-141731520 AAACCTGAGCCTCCCTTTTCTGG - Intergenic
1049411216 8:142474820-142474842 TTATCCCAGGCTCCCTCCTCGGG + Intronic
1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG + Intronic
1053444117 9:38138360-38138382 TTCACTCAGCTTTCCTTCTCTGG + Intergenic
1055768353 9:79689899-79689921 TTACTTAAGCCTACCCTCTCTGG + Intronic
1056307552 9:85305106-85305128 TTGCCTCAGCATCCCTTGTGTGG - Intergenic
1056982548 9:91328433-91328455 TTACCATAGTTTCCCTTCTCTGG - Intronic
1057233016 9:93336304-93336326 GTAACTCAGTCTCCCTGCTCAGG + Intronic
1057252496 9:93515317-93515339 GTAACTCAGTCTCCCTGCTCAGG - Intronic
1057303539 9:93899874-93899896 CTGCCTGAGCCTCCTTTCTCAGG + Intergenic
1058567975 9:106307240-106307262 ATTCCTCTGCCTCCCTTATCAGG + Intergenic
1059104741 9:111501594-111501616 CTCCCTCAGCCTCCCTCCTATGG - Intergenic
1059248396 9:112867149-112867171 CTACCTCAGGATTCCTTCTCAGG + Intronic
1059380187 9:113917356-113917378 CTACCTCAGCCTCCCGTGTAGGG + Intronic
1060523480 9:124307707-124307729 TGCCCTCAGCCTCCCTTCCAGGG - Intronic
1061021309 9:128016776-128016798 ATGCCTCAGCCTCCCTAGTCTGG - Intergenic
1062689184 9:137832629-137832651 TTACTCCAGCCGTCCTTCTCTGG + Intronic
1203661772 Un_KI270753v1:51153-51175 TTCCCTCTTCCTTCCTTCTCTGG - Intergenic
1203672963 Un_KI270755v1:34202-34224 TTCCCTCTTCCTTCCTTCTCTGG - Intergenic
1186253344 X:7692927-7692949 TTCCCTCAGCCTTTCTGCTCTGG - Intergenic
1186580064 X:10808174-10808196 TCACCTCAGCCTCTCCTGTCTGG - Intronic
1188103114 X:26115290-26115312 TTACCCCATCCTCCATTCTTGGG + Intergenic
1189391882 X:40583329-40583351 TTTCCTCAGCCTCCCCAGTCTGG - Intronic
1189730820 X:44018877-44018899 TTACCTCTTCCTTACTTCTCAGG - Intergenic
1192874259 X:75211361-75211383 TGACCACGGCCTGCCTTCTCAGG - Intergenic
1194142540 X:90222854-90222876 TGACCGCAGCCCACCTTCTCAGG - Intergenic
1198459992 X:136853889-136853911 CTACCTCAGCCTCCCGTAGCTGG - Intronic
1198667054 X:139036316-139036338 CTACCTCATCCTCCTTTCTATGG + Intronic
1199034350 X:143032983-143033005 TGACCGCAGCCTGCCTTCTCAGG - Intronic
1199074067 X:143510290-143510312 TGACTGCAGCCTCCCTTCTCAGG + Intronic
1199093067 X:143713526-143713548 TGACTGCAGCCTCCCTTCTTAGG + Intronic
1199215271 X:145254611-145254633 TGACCGCAGCCTCCCTTCTCAGG - Intronic
1199460058 X:148074573-148074595 TTTCCTCTGCCTGCCTTCCCTGG - Intergenic
1199804436 X:151283857-151283879 GGCCCTCAGCCTCCTTTCTCAGG + Intergenic
1201685484 Y:16697282-16697304 CTGCCTCAGCCTTCTTTCTCAGG - Intergenic