ID: 1008001580

View in Genome Browser
Species Human (GRCh38)
Location 6:46365739-46365761
Sequence GATGATTTACAATAAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 396}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008001580 Original CRISPR GATGATTTACAATAAAAGAG GGG (reversed) Intronic
901711717 1:11120704-11120726 GATGATTTGAAATATAAGGGAGG - Intronic
902230885 1:15026860-15026882 GATGATTTACAGTACACGGGAGG + Intronic
902304979 1:15529874-15529896 GATGATTTAAAGTATATGAGAGG - Intronic
902762850 1:18595273-18595295 GATGATTTAAAGTACATGAGAGG + Intergenic
902907015 1:19565783-19565805 GATGTTTCACATTTAAAGAGGGG + Intergenic
904643160 1:31945474-31945496 GATGATTTAAAGTATACGAGAGG - Intergenic
904981648 1:34508079-34508101 GATGATTTAACATATATGAGAGG - Intergenic
905616328 1:39402783-39402805 AATGCTGTACAATGAAAGAGGGG - Intronic
905741845 1:40377957-40377979 GATGATTTAAAGTATAAGGGAGG - Intronic
906011421 1:42530723-42530745 GATGATTTAAAATATATGAGAGG + Intronic
906158967 1:43633353-43633375 GATGATTTAAAGTATAAGAGAGG + Intergenic
907791594 1:57670953-57670975 GATGATTTAAAATATATGGGAGG - Intronic
907879245 1:58529821-58529843 GATGATTTAAAGTATATGAGAGG + Intronic
908183480 1:61629064-61629086 GAGAATTTATTATAAAAGAGAGG - Intergenic
908916983 1:69139662-69139684 GATGATAAACCATAAAAGACAGG + Intergenic
909076960 1:71060738-71060760 GATGATTTAAAGTATATGAGAGG + Intergenic
909881726 1:80888378-80888400 GATGATTTAAAGTATATGAGAGG + Intergenic
909920493 1:81375417-81375439 GATCATTTACAATAATATACAGG + Intronic
909979264 1:82078876-82078898 AATAATTTAAAATAAAAGAAAGG + Intergenic
910452137 1:87358081-87358103 GATCATCTAAAATGAAAGAGTGG - Intergenic
910683943 1:89896781-89896803 TATGATTCACAAGAAAAGAGAGG - Intronic
911433087 1:97817499-97817521 GATGACTTACAAAAAAACATAGG + Intronic
911590634 1:99744339-99744361 GATAATTTAGAATAAAAGTTTGG + Intronic
911830163 1:102540213-102540235 GACTATTTCCAAAAAAAGAGAGG - Intergenic
912128253 1:106568212-106568234 GATGCTTGATAATAAAAAAGGGG + Intergenic
912582344 1:110732012-110732034 GATGATTTAAAGTAAATGGGTGG + Intergenic
912915251 1:113808259-113808281 GATGATTTAAAATATAGGGGAGG - Intronic
912921080 1:113867974-113867996 GATGATTTAAAATATACAAGAGG - Intronic
915256969 1:154640795-154640817 ACTGATCTAGAATAAAAGAGAGG + Intergenic
915853867 1:159359590-159359612 GATGATTTAAAGTAAATGGGAGG + Intergenic
916690556 1:167186040-167186062 GCAGATATAAAATAAAAGAGTGG - Intergenic
916930545 1:169574085-169574107 GATGATTTAAAGTATATGAGAGG + Intronic
917726853 1:177836353-177836375 AATCATTTAAAATAATAGAGTGG + Intergenic
917866496 1:179200673-179200695 GAAGATTTCCAATACAATAGTGG - Intronic
918443319 1:184591038-184591060 GATGATTTAGAGTATATGAGAGG + Intronic
918770457 1:188551230-188551252 GAAGATCTACAATCAAAAAGTGG - Intergenic
918783952 1:188740094-188740116 AATGATTTAAAATTTAAGAGAGG + Intergenic
919065609 1:192689549-192689571 GGAGATATAGAATAAAAGAGTGG - Intergenic
919118343 1:193309263-193309285 GATGATTTAAAATGTATGAGAGG + Intergenic
919172881 1:193978390-193978412 GAGAATATACAATAAAAGACTGG - Intergenic
919390713 1:196981772-196981794 GATGATTTAAATTATATGAGAGG - Intronic
921350693 1:214231365-214231387 TATGATGTGCAAAAAAAGAGAGG - Intergenic
921358653 1:214309747-214309769 AAAGATTTAGAAAAAAAGAGTGG - Intronic
921576558 1:216841891-216841913 GATGATTTACAAAAAAAAAGAGG + Intronic
921738679 1:218658152-218658174 GATGATCAACGATCAAAGAGAGG - Intergenic
922778618 1:228231267-228231289 GATGATTTAAAATATAAGGAAGG - Intronic
923836980 1:237622749-237622771 GATGATTTAAAATATATGAGAGG + Intronic
1063303290 10:4873322-4873344 GGTAATTTACAAAAGAAGAGAGG - Intergenic
1063487494 10:6433728-6433750 GATGTTTTAGAAGCAAAGAGGGG + Intronic
1063616751 10:7606847-7606869 GATAATTTAAAATAAATTAGAGG - Intronic
1063906118 10:10782023-10782045 GATGATTTAAAGTATAAGGGAGG + Intergenic
1065021019 10:21501499-21501521 CATGATTTAAAATAAAGAAGAGG + Intergenic
1065243537 10:23733504-23733526 GATGATTTAAAATAAACAGGAGG - Intronic
1065498233 10:26351665-26351687 GATTATTTAAAATATAAGAGAGG - Intergenic
1066591286 10:36997331-36997353 GCTTATTTACAATAAAAGTAAGG - Intergenic
1070855845 10:79607533-79607555 GATGATTTAGTATAATTGAGAGG + Intergenic
1071030673 10:81176727-81176749 GGTGATTTAAAATATAAGGGTGG + Intergenic
1073672005 10:105601738-105601760 GATGATTTAAAGTATACGAGAGG - Intergenic
1074556108 10:114491948-114491970 GATGATTTAGAAGAAAAGAGAGG + Intronic
1074915250 10:117949270-117949292 GATGATTTAAAGTATAGGAGAGG - Intergenic
1075008165 10:118845293-118845315 GATGATTAACAAGAAAGGACCGG + Intergenic
1075180480 10:120206597-120206619 GATGATTTAAAGTAAATGGGAGG + Intergenic
1075621897 10:123934234-123934256 GGTGACTTACAATAACAGAAAGG + Intronic
1076255370 10:129019493-129019515 GATGATTGACAATAGAAAAGAGG + Intergenic
1078293938 11:10046073-10046095 GATGATTTACAATATACAGGAGG + Intronic
1078763060 11:14267273-14267295 CATCATTTTCAATAAAAGATAGG + Exonic
1079369806 11:19841604-19841626 GATGATTAAGAACAAAACAGAGG + Intronic
1080980998 11:37405424-37405446 GATGATTTAAAGTATAGGAGAGG - Intergenic
1081263513 11:40989967-40989989 GATGATTTAAAGTATAAGGGAGG + Intronic
1082173214 11:49031222-49031244 GATGAATGACTATGAAAGAGTGG - Intronic
1082729738 11:56780965-56780987 GATGATTTATAAAGAAAAAGAGG + Intergenic
1085203426 11:74715675-74715697 TATGATATATAATAAAATAGAGG + Intronic
1086253297 11:84843645-84843667 GATGATTTAAAGTATATGAGAGG - Intronic
1086744981 11:90413843-90413865 AGTGATTTACCATAAAAGATGGG + Intergenic
1086859138 11:91904086-91904108 GATCATTTAAAATGATAGAGAGG + Intergenic
1087215889 11:95493785-95493807 GATGATTTAAACTATATGAGAGG - Intergenic
1087296479 11:96381408-96381430 CATGATTTATAATAAAATAGTGG - Intronic
1088100528 11:106149637-106149659 GAAGATTTAAATTAAGAGAGGGG + Intergenic
1088299464 11:108340812-108340834 GATGATTTACAGTACATGGGAGG - Intronic
1088963939 11:114699112-114699134 GATGCTGTACAATAAAAAAGTGG + Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092737539 12:11596993-11597015 GATGATTTAAAGTAAACAAGAGG - Intergenic
1093349541 12:18080961-18080983 GATGTTGTACAATAAATGAAAGG + Exonic
1093376243 12:18431284-18431306 AATGATTAACAATAAAACAAAGG + Intronic
1093656479 12:21700342-21700364 GATGATTTAAAATATACAAGAGG - Intronic
1096048061 12:48581720-48581742 TATAATTTACAATAAAAGTTGGG - Intergenic
1096562493 12:52446832-52446854 GATGGTTAGCAATTAAAGAGAGG + Exonic
1100124800 12:91410956-91410978 GATGATTTAAAGTATATGAGAGG + Intergenic
1100215311 12:92441899-92441921 CAAGATTTACAATAAAGCAGTGG + Intergenic
1101031698 12:100667129-100667151 GATGAAAAACCATAAAAGAGGGG - Intergenic
1101255924 12:102976457-102976479 GATGATTTAAAGTAGAAGGGGGG + Intergenic
1102488476 12:113274090-113274112 GATAATTTAAAATATATGAGAGG - Intronic
1104871697 12:132003342-132003364 GATTATTTAAAATATATGAGAGG + Intronic
1105618640 13:22045607-22045629 GGTGATTTAGAATGAACGAGGGG + Intergenic
1107022929 13:35770104-35770126 GATGATTAAAAATAAAAGACTGG + Intronic
1107132697 13:36912999-36913021 GATGATTTAAAGTATAAGGGAGG - Intronic
1107527102 13:41243722-41243744 GAAGAAATACAATAAAAGTGTGG - Intronic
1107931437 13:45310963-45310985 GAACACTTACAATAAAAGACAGG - Intergenic
1108068389 13:46602652-46602674 GATGATTTAAAATAAAATGGAGG + Intronic
1108270745 13:48756969-48756991 GATAATTTACAACGAAAAAGAGG - Intergenic
1109548844 13:63865379-63865401 GATTAAATACAACAAAAGAGGGG + Intergenic
1109643682 13:65224647-65224669 GCTGATTTAGCATATAAGAGTGG - Intergenic
1110672850 13:78202662-78202684 CATGCTTTGCAATAAAAGAGTGG + Intergenic
1111410699 13:87873044-87873066 GATGGCTTACAGTAAATGAGTGG + Intergenic
1111545168 13:89724056-89724078 GATGATTTAAAGTACATGAGAGG + Intergenic
1112504018 13:99964149-99964171 TATGATTTACATTAAAAGAGGGG - Exonic
1114476814 14:23001452-23001474 GATAAATAAAAATAAAAGAGAGG - Intronic
1115018888 14:28650594-28650616 GATGATTTAAAATATATGGGAGG + Intergenic
1115079722 14:29436232-29436254 GATGTTTTACAATAAAAACATGG + Intergenic
1115274557 14:31593154-31593176 GATGATTTAAAGTATACGAGAGG + Intronic
1115431729 14:33326922-33326944 GATGAGTTACAAGACAAGAGAGG + Intronic
1115713368 14:36074710-36074732 GCTGTTCTACAACAAAAGAGTGG - Intergenic
1115828543 14:37307680-37307702 GATGGTGTCCAAAAAAAGAGAGG + Intronic
1115931874 14:38506607-38506629 GATGATTTAAAATATATGGGGGG - Intergenic
1116750173 14:48873180-48873202 GATGATTTTCAATAAAAGGCAGG - Intergenic
1117569019 14:57027158-57027180 GATGATTTACGAATAAACAGAGG + Intergenic
1118158006 14:63259662-63259684 GATAATTTGCGATAAAACAGCGG - Intronic
1118172525 14:63402009-63402031 GATGATTTACAATGTAAGTCTGG + Intronic
1118453866 14:65928183-65928205 GGTGATTCACAATGAAGGAGCGG + Intergenic
1118554502 14:67000997-67001019 GATCATTTACAATATAAAAGAGG + Intronic
1120425664 14:84344463-84344485 GATGATTTAAAGTAAACGAAAGG - Intergenic
1120772874 14:88400353-88400375 GAATACTTACATTAAAAGAGGGG + Intronic
1121429538 14:93877274-93877296 GATAATTTACAAAGAAAAAGAGG + Intergenic
1121451961 14:94014233-94014255 GATGATTTAAAGTATATGAGGGG + Intergenic
1122661044 14:103295113-103295135 GATGAGTTATAATCAAAGATTGG - Intergenic
1123981427 15:25608307-25608329 GATGATTTAAAGTAAATGAGAGG + Intergenic
1125305126 15:38303232-38303254 GAAGATTTAGAAGAAAACAGAGG - Intronic
1125969299 15:43899097-43899119 GATGATTTCTATTAACAGAGAGG - Intronic
1127005855 15:54569359-54569381 GATGATTTAAAATATATGGGAGG - Intronic
1127209322 15:56756806-56756828 GATGATTTAAAGTATAAGAGAGG - Intronic
1128596398 15:68955525-68955547 GAAGATCTACACTAAAAGAATGG - Intronic
1128846683 15:70904384-70904406 AATGATTTACAATTAAATATAGG + Intronic
1130246668 15:82257324-82257346 GATGATCAAGAAGAAAAGAGAGG - Intronic
1130453993 15:84086016-84086038 GATGATCAAGAAGAAAAGAGAGG + Intergenic
1131543353 15:93293791-93293813 GAAGAATTCCAATCAAAGAGTGG + Intergenic
1131795915 15:96016577-96016599 GGTGATTTATAAAGAAAGAGAGG - Intergenic
1132012392 15:98287481-98287503 GATAATTTACAAAGAAAAAGAGG - Intergenic
1135596061 16:23744280-23744302 GAAGATGCACAAAAAAAGAGGGG + Intergenic
1135944462 16:26853636-26853658 TATATTTCACAATAAAAGAGAGG + Intergenic
1136282174 16:29220403-29220425 GCTGATTTATAAGGAAAGAGGGG - Intergenic
1137017192 16:35389439-35389461 GATGGATTAGAAAAAAAGAGAGG - Intergenic
1139133454 16:64173857-64173879 AATGATTTTCAACATAAGAGTGG - Intergenic
1140161078 16:72495197-72495219 GATGATTTAAAGTATATGAGAGG - Intergenic
1141601673 16:85130488-85130510 GATGCTTTCCAAAAATAGAGAGG - Intergenic
1142086545 16:88186322-88186344 GCTGATTTATAAGGAAAGAGGGG - Intergenic
1142777458 17:2152253-2152275 GTTTATTTAAAATGAAAGAGGGG - Intronic
1144065859 17:11623466-11623488 GGAGATTAAAAATAAAAGAGGGG - Intronic
1144753429 17:17665742-17665764 GATGATTTAAAGAAAAAAAGGGG + Intergenic
1146726047 17:35156798-35156820 GATGGTTTAAAAAAAAAGAGAGG - Intronic
1147150747 17:38512132-38512154 CAATATTTACAATAAAAGAATGG - Exonic
1147707347 17:42435674-42435696 GATGATTTAAAGTATATGAGAGG + Intergenic
1149165409 17:53745606-53745628 GCTGTTTGGCAATAAAAGAGGGG + Intergenic
1149271041 17:54977449-54977471 GATGATTTAAAATATAGGAGAGG + Intronic
1149398141 17:56265737-56265759 GATGATTTAAAGTAAATAAGAGG - Intronic
1149881694 17:60298446-60298468 GATGATTTAAAATATATGGGAGG - Intronic
1150156601 17:62858958-62858980 GATGATTTAAAGTACATGAGAGG + Intergenic
1152169792 17:78737242-78737264 GATGATTTAAAGTATATGAGTGG - Intronic
1154504219 18:15019915-15019937 GGTGATTTACAAAGAAAAAGAGG + Intergenic
1155458896 18:26054068-26054090 GATGATTTAAAGTATATGAGAGG - Intronic
1155690109 18:28610059-28610081 GAGGATTTAAAATATACGAGAGG + Intergenic
1156611542 18:38730884-38730906 AATGATTAACAACAAATGAGAGG + Intergenic
1156651847 18:39234886-39234908 GATGACTTCCATTCAAAGAGAGG + Intergenic
1157093642 18:44665813-44665835 GATTAAATACAATGAAAGAGAGG - Intergenic
1157940642 18:51925406-51925428 AATGTTTTACTATAAAGGAGAGG - Intergenic
1158037734 18:53054107-53054129 GATGATTTAAAATATATGGGAGG - Intronic
1158290383 18:55933711-55933733 TATGATAGACAACAAAAGAGTGG + Intergenic
1158512437 18:58102723-58102745 GATGATTTAAAGTATATGAGAGG + Intronic
1158879527 18:61763659-61763681 GATGGTTGACATTAAATGAGAGG - Intergenic
1159270772 18:66147491-66147513 CCTGATTAACAAAAAAAGAGGGG + Intergenic
1159688415 18:71453930-71453952 GATGATTTAAAGTATATGAGAGG + Intergenic
1160326215 18:77951095-77951117 AATGATGTAAAATAAATGAGAGG + Intergenic
1161799375 19:6407724-6407746 GATGACTTACAGTATATGAGAGG - Intergenic
1163093040 19:15034660-15034682 GAGGATATACAGAAAAAGAGGGG - Intergenic
1164796248 19:31033960-31033982 GATGATTAAAAATAAAAGAATGG - Intergenic
1166610417 19:44188520-44188542 GATGATTTAAAGTATATGAGAGG + Intergenic
1167275514 19:48536334-48536356 GATGATTTAAAATACACGGGAGG - Intergenic
926450178 2:12994021-12994043 AATGTTTTACTAAAAAAGAGGGG - Intergenic
927097490 2:19758602-19758624 CATGATTAACAATAAAGAAGGGG + Intergenic
927352352 2:22131582-22131604 GATGATTTAAAGTATATGAGAGG + Intergenic
928044774 2:27918556-27918578 GATTATTTACAATAAACAAAAGG - Intronic
928604470 2:32932720-32932742 GATGATTTAAAGTATACGAGAGG - Intergenic
929206641 2:39303256-39303278 GATGATTTATAGAAATAGAGAGG + Intronic
930463755 2:51717900-51717922 GATGATTTAAACTACATGAGAGG + Intergenic
930824806 2:55685840-55685862 GATGATTTAAAGTATATGAGAGG - Intronic
931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG + Intergenic
932202746 2:69846419-69846441 GATGATTTAAAGTATATGAGAGG + Intronic
932545064 2:72700013-72700035 GATGATTTAAAATATAAAGGAGG - Intronic
932754960 2:74401190-74401212 GAGGATTTAAAATATAAGAAAGG + Intergenic
933904644 2:86879160-86879182 GATGAGTAACAAAAAAAGACTGG - Intergenic
934570742 2:95371787-95371809 AAAGATTTAAAATAAAAGAATGG - Intronic
934635231 2:95980780-95980802 GCTGATCTAAAATAACAGAGAGG + Exonic
934798399 2:97124443-97124465 GCTGATCTAAAATAACAGAGAGG - Exonic
934835030 2:97579038-97579060 GCTGATCTAAAATAACAGAGAGG + Exonic
935916506 2:107957871-107957893 GAGGAATTAGATTAAAAGAGAGG + Intergenic
936367591 2:111872999-111873021 GATGAGTAACAAAAAAAGACTGG + Intronic
936628800 2:114177829-114177851 GCTGATTTAGAATGAAGGAGGGG + Intergenic
936953279 2:117999709-117999731 GATGATTTAAAATATAGGGGAGG - Intronic
938006698 2:127793003-127793025 GATGAGTTAGCATAAAAGTGAGG + Intronic
938575895 2:132604286-132604308 AATGATTTAAAAAAAAAGAAAGG + Intronic
940113792 2:150184971-150184993 GTTGATTGACAATAATGGAGGGG - Intergenic
940305326 2:152219700-152219722 GATGATTTAAAGTATATGAGAGG - Intergenic
941839865 2:170069899-170069921 GATGATTTAAAATATATGGGAGG - Intronic
942661360 2:178268636-178268658 GATGAATTTCAACATAAGAGAGG - Intronic
943149026 2:184086350-184086372 GATGATTTAACATAAATGGGAGG + Intergenic
943693432 2:190894251-190894273 GATGATTTAAAATATATGGGAGG - Intronic
943801981 2:192071673-192071695 GATGATTTAAAGTAGATGAGAGG - Intronic
944073295 2:195697196-195697218 AATGATTTAAAATATAAGAGAGG + Intronic
944130552 2:196343238-196343260 GATGATTTAAAGTATACGAGAGG - Intronic
945005782 2:205404327-205404349 GATGATTTAAAGTATATGAGAGG + Intronic
946600458 2:221354939-221354961 GATAATTTACAAAGAAAAAGAGG + Intergenic
946968737 2:225068192-225068214 GATGATTTAAAATATAAGGGAGG + Intergenic
947084521 2:226436275-226436297 GATGATTTATAAAGAAAAAGAGG + Intergenic
1169008928 20:2233620-2233642 GATGATTTAAAATGCAGGAGAGG + Intergenic
1169391472 20:5194658-5194680 GATGATTTATGAGAATAGAGGGG + Exonic
1169585094 20:7072885-7072907 GATGATTTAAATTATATGAGAGG - Intergenic
1169699871 20:8434000-8434022 GATGATTTTCAATCACAGTGAGG + Intronic
1172986027 20:38990670-38990692 GATGATTTAAAATATATGGGAGG + Intronic
1173337943 20:42128167-42128189 TATGATTTAAAATCAAAGAGAGG - Intronic
1173592900 20:44239277-44239299 GATAATTTACAAAGAAAAAGAGG - Intergenic
1174483391 20:50846261-50846283 GCTTAGCTACAATAAAAGAGAGG - Intronic
1177112296 21:17043062-17043084 GATGATTTAAAATAGAAGTAGGG - Intergenic
1177722641 21:24927920-24927942 GAAGATTTAGAATGAAAGAATGG + Intergenic
1178735557 21:35146558-35146580 GTTGCTTTACAAAAAAAAAGGGG - Intronic
1180669324 22:17541082-17541104 GAGGATTTAGAATAAAGGAATGG - Intronic
1182320502 22:29475869-29475891 TCTGATTTATAATAAAAGGGCGG - Intergenic
949654589 3:6202716-6202738 GATGATTTAAAGTATATGAGAGG - Intergenic
949764720 3:7513580-7513602 TATGTTTCAAAATAAAAGAGTGG + Intronic
951683435 3:25319054-25319076 GATGATTTTCAATAATATATTGG + Intronic
952178024 3:30888013-30888035 GATGATTTACAATATACAGGAGG - Intronic
952330773 3:32362703-32362725 GAAGATTTACAATAACAAATGGG - Intronic
952366844 3:32682525-32682547 GATCATTTACATTAGAAGAAGGG - Intergenic
952570083 3:34703084-34703106 GATGATTTATAAAGAAAAAGAGG + Intergenic
952799992 3:37281436-37281458 GATCATTCCCAAGAAAAGAGGGG - Intronic
953249866 3:41235344-41235366 GAAGATATACAAAAATAGAGGGG + Intronic
955312914 3:57907816-57907838 TATAATCTACAATAAAAGACTGG - Intronic
955468953 3:59266134-59266156 GATGATTTAAAGTACATGAGAGG + Intergenic
956515463 3:70041743-70041765 GATGATTTAAAGTATAAAAGAGG + Intergenic
956590498 3:70909155-70909177 GTTGATTTACAAAAAGAGTGTGG - Intergenic
957025749 3:75179666-75179688 AATAATTTAAAATAAAAGAATGG + Intergenic
957444914 3:80303542-80303564 AATGATTTAAAAAAAAAGAAAGG - Intergenic
957866311 3:86028550-86028572 GAAGATTTTCTCTAAAAGAGAGG - Intronic
957929400 3:86859416-86859438 GATGATTTAAAGTATATGAGAGG - Intergenic
957954947 3:87174227-87174249 GATTATTTATAATGCAAGAGTGG + Intergenic
957968744 3:87355879-87355901 GATAATTTATAAAGAAAGAGAGG + Intergenic
958514864 3:95101132-95101154 GGTAATTTACAATGAAAAAGAGG - Intergenic
960033345 3:113077714-113077736 GATGATTTAAAGTATATGAGAGG - Intergenic
960195999 3:114769206-114769228 CATGATTAACAATAAAACACAGG - Intronic
960589150 3:119348625-119348647 GATGATTTAAAGTATACGAGAGG - Intronic
960643299 3:119849935-119849957 GATGATTTAAAGTATATGAGAGG - Intronic
961143706 3:124576630-124576652 GAGGATTTCCAATAATAGAAAGG - Intronic
961501818 3:127341607-127341629 GATGATTTAAAGTATAAGAGAGG - Intergenic
962173414 3:133126811-133126833 GATGATTTAAAATATATGGGAGG - Intronic
963038529 3:141051980-141052002 GAGTACTTACCATAAAAGAGAGG - Exonic
963617641 3:147562163-147562185 GGTGATATTCAATAAAAGGGTGG + Intergenic
963792630 3:149600061-149600083 GATGATTTAAAGTATAAGAGAGG + Intronic
964166508 3:153713082-153713104 GATGATTTAAAGTATATGAGAGG + Intergenic
964885328 3:161475763-161475785 TAAGATTTTCAATAAGAGAGAGG + Intergenic
965408417 3:168299676-168299698 GATCATTTAAAAGAAAAGAGGGG + Intergenic
965641455 3:170833086-170833108 GATGGTTTAAAAAAAAAGGGGGG - Intronic
966084057 3:176045125-176045147 GATTATTTAAGATAACAGAGAGG + Intergenic
966346021 3:178981174-178981196 AATGATAAACAATAACAGAGAGG - Intergenic
966857086 3:184202190-184202212 GATGATTTAAAGTATACGAGGGG + Intronic
966969079 3:185026267-185026289 GATGATTTAAAATACATGGGAGG + Intronic
967001092 3:185335666-185335688 GATGATTTAAAGTATATGAGAGG - Intronic
967244905 3:187476931-187476953 GATTTTTTAAAAGAAAAGAGGGG + Intergenic
968416790 4:444312-444334 GATAATTTACAATTAAGGAAAGG - Exonic
970426539 4:15950986-15951008 GATCATTTACATTGAAAGAAGGG - Intergenic
971134670 4:23855215-23855237 GGTGATTTACAAAGAAAAAGAGG - Intronic
971481673 4:27120501-27120523 GATGATTTATAAAGAAAAAGAGG + Intergenic
971880812 4:32368149-32368171 GATGATTTAAAGTATAAAAGAGG + Intergenic
972070069 4:35007844-35007866 GATGATTTAAAGTATATGAGAGG - Intergenic
972453377 4:39227585-39227607 GATGATTTAAAGTATAAGGGAGG + Intronic
972815425 4:42639882-42639904 GATGATTTAAAATATACAAGAGG - Intronic
972981282 4:44705562-44705584 GATAATTTAAAATAGAAGGGTGG - Intronic
973030830 4:45336046-45336068 TATGATTCTCAATAAGAGAGTGG - Intergenic
974205349 4:58695444-58695466 GATAATTTACAAACAAAAAGAGG - Intergenic
974372192 4:61031933-61031955 GATGATTTAAAGTATATGAGAGG - Intergenic
975201323 4:71593243-71593265 GAAATTTTACAATCAAAGAGAGG - Intergenic
975509215 4:75173953-75173975 GATGATTTAAAGTATATGAGAGG - Intergenic
975939039 4:79618344-79618366 GATGATTTAAAGTAAACAAGAGG + Intergenic
976088235 4:81428623-81428645 GATGACTTAAAGTATAAGAGAGG + Intronic
976216107 4:82716984-82717006 GATGATTTAAAATATATGGGAGG + Intronic
977252366 4:94703581-94703603 GATAATTTTTAATAACAGAGGGG - Intergenic
977473002 4:97465681-97465703 GATGATTTAAAATATATGAGAGG - Intronic
977521188 4:98086368-98086390 GATGACTTTAAATAAAAAAGAGG + Intronic
977586068 4:98776632-98776654 GATGATTTAAAGTATATGAGAGG - Intergenic
977736227 4:100419644-100419666 GCTGATTTTCAGTAAAAGACAGG + Intronic
977990033 4:103430410-103430432 GATGGGTTAGAATAATAGAGAGG + Intergenic
978612968 4:110564971-110564993 AGTGATTTACAATAACAAAGGGG - Exonic
978873738 4:113612020-113612042 CATTATTTAAAATAAGAGAGTGG - Intronic
978959562 4:114659745-114659767 GATGAGTTACCAAAAAAGATGGG + Intronic
981425873 4:144602426-144602448 GATGATTTAAAGTATATGAGAGG + Intergenic
982244215 4:153333824-153333846 GATGATTTAAAATATATGGGGGG + Intronic
983250164 4:165335050-165335072 GATGATTTAAAGTATACGAGAGG + Intronic
983542606 4:168929122-168929144 GATGATATAAATTAAAAGTGAGG + Intronic
983586870 4:169364881-169364903 GAGGATTTAGAAAAAAAGTGAGG - Intergenic
984439478 4:179748303-179748325 GATCATTTATGATAAATGAGAGG - Intergenic
985296397 4:188441786-188441808 GATGATTTAAAATATACAAGGGG + Intergenic
985863604 5:2494165-2494187 GAAGATTTATGATAAAAGAATGG - Intergenic
986257930 5:6116506-6116528 GATGATTTAAAGTATATGAGAGG + Intergenic
986901122 5:12435048-12435070 GGTAATTTATAAAAAAAGAGAGG + Intergenic
989173449 5:38496347-38496369 GATGATTTAGTATATAAGAACGG - Intronic
989316977 5:40092738-40092760 GATTTTTTAAAAGAAAAGAGGGG + Intergenic
990231250 5:53715563-53715585 AATGAATTAAAATAAAAGTGAGG + Intergenic
990845571 5:60134659-60134681 GATGATTTAAAATATATGAGAGG - Intronic
991417749 5:66409304-66409326 GATAATTTACAAAGAAAAAGAGG + Intergenic
991580849 5:68153569-68153591 GATGATTTAAAGTATAAGGGAGG - Intergenic
993292093 5:86086825-86086847 GATGATATATAATAAAACAATGG - Intergenic
993378578 5:87179464-87179486 GATGATTTAAAAAAAAATTGAGG + Intergenic
993830752 5:92754862-92754884 GATGATTTATAATGAAAAATAGG + Intergenic
994892682 5:105658339-105658361 GATGGTTTAAAATATATGAGAGG - Intergenic
994969989 5:106724086-106724108 GTTGATTTGCAATAAAATATTGG + Intergenic
995021028 5:107367576-107367598 GATGATATAGATTAAGAGAGTGG + Intergenic
995168066 5:109070808-109070830 GATTATTTGCAATGAAATAGAGG + Intronic
995235067 5:109819368-109819390 GATGATTTAAAATACACAAGAGG - Intronic
996962150 5:129264043-129264065 GAAGATTTACAATAAGAAATGGG - Intergenic
996976792 5:129443875-129443897 GATGTTTTACAAGAATAAAGGGG - Intergenic
998527458 5:142855919-142855941 AATGAATAACAATAAATGAGTGG + Intronic
998671168 5:144355877-144355899 GCTGATTTACAAGAATAGATAGG - Intronic
999041624 5:148419855-148419877 GGTAATTTACTGTAAAAGAGGGG + Intronic
999286201 5:150395763-150395785 GTAGATTTATAATAAAAGTGGGG - Intronic
1000076510 5:157792642-157792664 ATTTATTTACAATCAAAGAGAGG + Intronic
1003004753 6:2370303-2370325 GAGGATTTACAATGAAGCAGTGG + Intergenic
1003418402 6:5934170-5934192 GAGGATATAGAATAAAACAGAGG - Intergenic
1003635828 6:7830616-7830638 GATAATTTACAAAGAAAAAGAGG + Intronic
1003889640 6:10552587-10552609 GATGATTTAAAGTACAAGAAAGG + Intronic
1004109040 6:12696641-12696663 GATGATTCAAAATATAAGGGAGG - Intergenic
1004832594 6:19493699-19493721 GATGATTTAAAGTATACGAGAGG + Intergenic
1005078278 6:21930132-21930154 GATGATTAACAGAAAAACAGGGG + Intergenic
1008001580 6:46365739-46365761 GATGATTTACAATAAAAGAGGGG - Intronic
1008296199 6:49781601-49781623 GATGATTTACCCTAAGAGAAAGG - Intergenic
1008417787 6:51263510-51263532 ACTGATTTCCACTAAAAGAGTGG + Intergenic
1009521348 6:64686236-64686258 GATAAATTTCAATAAAATAGAGG + Intronic
1011227995 6:85128907-85128929 AATGAATTACCATAAAGGAGGGG + Intergenic
1011291391 6:85781054-85781076 GATGATTTACAGTATATGGGAGG + Intergenic
1011416374 6:87123936-87123958 GATAATTTAAAATAAAAATGCGG + Intergenic
1012114808 6:95282833-95282855 CATTGTTTCCAATAAAAGAGTGG + Intergenic
1012287766 6:97413908-97413930 GATTATTTAAATTAAATGAGAGG - Intergenic
1012520419 6:100114776-100114798 TATATTTTACCATAAAAGAGAGG - Intergenic
1013063640 6:106661562-106661584 TATGTTTTACTCTAAAAGAGTGG - Intronic
1013505868 6:110799483-110799505 GATGATTTAAAGTATACGAGAGG - Intronic
1013719202 6:113002411-113002433 GTTGATTTAAAAAAAAAAAGAGG + Intergenic
1013937543 6:115616337-115616359 GATGATGAACTGTAAAAGAGTGG + Intergenic
1013941813 6:115672986-115673008 GTTGATATAAAATAAAAGAGGGG + Intergenic
1014742484 6:125162256-125162278 AATAATTTAAAATAAAACAGTGG - Intronic
1016234512 6:141846940-141846962 GATGTTTTACAATTAATCAGTGG - Intergenic
1016575349 6:145564015-145564037 GATGATTTACAGTAGATGATAGG - Intronic
1016764269 6:147774482-147774504 GATGATTTAAAATATATGGGAGG - Intergenic
1018351168 6:162960728-162960750 GTAGAATTAAAATAAAAGAGAGG + Intronic
1020488768 7:8751953-8751975 GATGATTTACAATTATACTGAGG - Exonic
1020686700 7:11304960-11304982 GATATTTTACAATAAAAAAGAGG + Intergenic
1020986554 7:15142200-15142222 GATGATTTAAGATTAAAAAGTGG - Intergenic
1021351494 7:19599401-19599423 CTTGATATACAAAAAAAGAGTGG - Intergenic
1021680165 7:23121984-23122006 GATAATTTCCAATAAGAGATGGG - Intronic
1021819862 7:24486100-24486122 GATGATTTAAAATATATGGGGGG + Intergenic
1022076622 7:26977635-26977657 GCTGATTTACCATAAAACAAAGG + Intronic
1022122467 7:27322892-27322914 GATGATTTAAAGTATAAGAGAGG + Intergenic
1022592761 7:31681452-31681474 GATGGTTTTGAATAAAAGGGAGG - Intergenic
1022982184 7:35614339-35614361 CATGATTTACAATAAAGGTTTGG - Intergenic
1022999551 7:35794100-35794122 GATGATTTGAAGTATAAGAGAGG - Intergenic
1023926123 7:44671113-44671135 GATAATTTATAATGAAAAAGGGG + Intronic
1024891111 7:54204566-54204588 AATAATTTACAAAAAAAAAGAGG - Intergenic
1024943688 7:54787819-54787841 GGTGACTTGGAATAAAAGAGTGG - Intergenic
1026628294 7:72015946-72015968 GATGATTAAGAATGGAAGAGAGG + Intronic
1027410921 7:77916732-77916754 GAGGATTTAAAGTAAATGAGAGG - Intronic
1028885261 7:95925288-95925310 GATGATTTTCATCAAAAGGGAGG - Intronic
1028915570 7:96255265-96255287 CAGGATTTTCAATGAAAGAGCGG + Intronic
1029558048 7:101284116-101284138 TATGATTTAAAAAAAAAGAAAGG + Intergenic
1030198136 7:106873570-106873592 GATGATTTACAGTATATGGGAGG + Intronic
1030579751 7:111339386-111339408 GAAGAATTAAAAAAAAAGAGAGG + Intronic
1030757575 7:113307496-113307518 GAAGATAGACAAGAAAAGAGAGG - Intergenic
1031155922 7:118112094-118112116 GATGATTTAAAGTATATGAGAGG + Intergenic
1032459438 7:132099170-132099192 GATGCTTTAAAATAAAATTGTGG - Intergenic
1032814365 7:135456647-135456669 CATGATTTAAAATAAATGGGAGG - Intronic
1035463175 7:159058769-159058791 GATGAATTATAAGAAAAAAGTGG - Intronic
1036175523 8:6534315-6534337 GATGATTTAGAGTATACGAGAGG + Intronic
1037052054 8:14385929-14385951 GATGATTTAAAGTATAGGAGAGG - Intronic
1037331181 8:17745325-17745347 GATGATTTACAGTATATGGGAGG - Intronic
1038047559 8:23778879-23778901 GATGAATTACAGTATAGGAGAGG + Intergenic
1038753793 8:30321461-30321483 GATTAATTAAAATAAAACAGGGG + Intergenic
1039122137 8:34158985-34159007 GATGATTTAAAATATATGGGAGG - Intergenic
1039188027 8:34939217-34939239 GATGATTCATAAGAAATGAGTGG + Intergenic
1041166125 8:55094626-55094648 AAGCATTTAAAATAAAAGAGTGG - Intergenic
1041872593 8:62651983-62652005 GATAATTTATAATGAAAAAGAGG - Intronic
1042119416 8:65468760-65468782 GATGATTTAAAGTAAACGGGAGG - Intergenic
1042799639 8:72704859-72704881 GATGATTTAAAGTATAAGGGGGG - Intronic
1044246258 8:89950318-89950340 GATGATTTAAAGTATATGAGAGG - Intronic
1044965605 8:97570990-97571012 GGTGATTTATAAAGAAAGAGAGG - Intergenic
1046259886 8:111754185-111754207 GATACTTTACAATTAAAAAGAGG - Intergenic
1047823974 8:128553038-128553060 GGTGATTTATAATGAAAAAGAGG + Intergenic
1050034441 9:1420690-1420712 GATGATTTACAGAAGAAGCGAGG - Intergenic
1050350561 9:4737725-4737747 AATAAAATACAATAAAAGAGAGG + Intronic
1050945296 9:11510087-11510109 GGTGATTTACAAAGAAAAAGAGG - Intergenic
1050966311 9:11807791-11807813 TATGTTATACAATAAAAGAAAGG - Intergenic
1051271918 9:15364137-15364159 GATGATTTAAAGTATACGAGAGG - Intergenic
1051741285 9:20254786-20254808 GATGATTTATAAAGAAAAAGAGG + Intergenic
1052536778 9:29757835-29757857 GGTGATTTAAAGTAAAAGGGAGG - Intergenic
1052662615 9:31454873-31454895 GATGATTTAAAGTATAAGAGAGG - Intergenic
1053233222 9:36429438-36429460 GATGATTTAAAGTATATGAGAGG - Intronic
1054820767 9:69518235-69518257 GATGATTTACAGTATATGGGAGG + Intronic
1055119297 9:72640328-72640350 GATTCTTTACAATAAAGGATTGG - Intronic
1055692750 9:78851208-78851230 GATGATTTAAAATACATGGGAGG - Intergenic
1058074127 9:100633635-100633657 GATGCTTTAAAAAAAAAAAGTGG - Intergenic
1058599621 9:106655068-106655090 GATCATTTGCTATAAAGGAGGGG - Intergenic
1059582252 9:115564868-115564890 GATAATTTACAAAGAAAAAGAGG + Intergenic
1059681712 9:116592083-116592105 GATGATTTAAAATTTAAGGGAGG - Intronic
1059837812 9:118176934-118176956 GGTAATTTACAATGAAACAGAGG - Intergenic
1185556500 X:1025529-1025551 GATGTTTGGCAAGAAAAGAGAGG - Intergenic
1185834825 X:3335552-3335574 GATGATTTAGCACACAAGAGAGG + Intronic
1186980879 X:14956185-14956207 GGCAATTTACAAAAAAAGAGAGG + Intergenic
1187653102 X:21432940-21432962 GATGATTTACCACAATATAGGGG + Intronic
1188153443 X:26709115-26709137 GATGATTCAGAATAGAAAAGTGG + Intergenic
1188354397 X:29173567-29173589 GCTAACTTACAATAATAGAGTGG - Intronic
1189577142 X:42366049-42366071 GATGATTTAAAGTATATGAGAGG + Intergenic
1190934347 X:54982592-54982614 GATGATTTAAAGTAAATGAGAGG + Intronic
1191743385 X:64460158-64460180 CCAGATTTACAAAAAAAGAGCGG - Intergenic
1192426042 X:71077566-71077588 GATGATTTAAAATATATGAGAGG + Intergenic
1192778497 X:74269650-74269672 GATGATTTAAAGTATATGAGAGG - Intergenic
1192971151 X:76232218-76232240 GTAGATTTAAAATAAAAGAATGG + Intergenic
1193394942 X:80972279-80972301 GGTAATTTACAAGAAAAAAGGGG - Intergenic
1193429071 X:81377950-81377972 GATGAAGTACAACAAGAGAGGGG - Intergenic
1193720942 X:84986872-84986894 GATGATTTAAAGTATATGAGAGG - Intergenic
1193731097 X:85104736-85104758 GATGATTTAAAATATATGAGAGG - Intronic
1194383836 X:93228521-93228543 CATGACTTTCAATAAAATAGGGG + Intergenic
1194394842 X:93370220-93370242 GATGATTGACAAAGAAACAGTGG - Intergenic
1194497400 X:94634834-94634856 GATGATTTACAATATCTGGGAGG + Intergenic
1195091283 X:101461733-101461755 TATTATTTAAAAAAAAAGAGAGG - Intronic
1195168665 X:102245184-102245206 GAACATTTCCAATAAAAAAGGGG - Intergenic
1195190192 X:102441903-102441925 GAACATTTCCAATAAAAAAGGGG + Intronic
1195489606 X:105452102-105452124 TAATATTTACAATAAAAGAGAGG - Intronic
1195963456 X:110408963-110408985 GCAGATTTATTATAAAAGAGAGG + Intronic
1197012663 X:121586077-121586099 GATGATTTAAAGTATATGAGAGG + Intergenic
1197516075 X:127431212-127431234 GAAGAAATACAATAAAATAGTGG + Intergenic
1198055772 X:132993311-132993333 GAGGATTTCAAATCAAAGAGGGG - Intergenic
1199395446 X:147331845-147331867 GAAGAGCTACAATAAAACAGAGG + Intergenic
1201625024 Y:16005413-16005435 GGTAATTTACAAAAAAAGAGAGG - Intergenic