ID: 1008004353

View in Genome Browser
Species Human (GRCh38)
Location 6:46394317-46394339
Sequence TTGTGCAAATGCCAAATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008004353 Original CRISPR TTGTGCAAATGCCAAATCAT AGG (reversed) Intronic
900747969 1:4374100-4374122 GTGTGCAAAAGCCAAACCAGAGG + Intergenic
906000028 1:42416825-42416847 TTGTGCAATTGACAAATGTTTGG + Exonic
907410625 1:54281000-54281022 TTGTCCAAATGACAAACCTTAGG - Intronic
909378850 1:74973860-74973882 TTGTATAAATGCCAAGCCATTGG + Intergenic
913261870 1:117005781-117005803 ATCTGCAAATGCCAAATCCATGG - Intronic
913979034 1:143491544-143491566 TTGTGCAAATGCCTAAGGGTAGG + Intergenic
914073439 1:144317194-144317216 TTGTGCAAATGCCTAAGGGTAGG + Intergenic
914105716 1:144649166-144649188 TTGTGCAAATGCCTAAGGGTAGG - Intergenic
916800704 1:168213618-168213640 TTCTGGAAAGGCAAAATCATTGG + Intergenic
916876104 1:168971253-168971275 GCCTGCAAATGCCAAATAATAGG + Intergenic
917552670 1:176051120-176051142 ATATGCAAATGTCAAATGATAGG + Intronic
919831662 1:201545222-201545244 TTTTGAAATTGCCAGATCATAGG - Intergenic
921047364 1:211487025-211487047 ATGTCCAAATGCCATATCTTAGG - Intronic
1064893425 10:20206719-20206741 CTGTCCAAATGCAAATTCATAGG - Intronic
1068378815 10:56220468-56220490 TTGTAAAAATGCCTAAACATTGG - Intergenic
1068825464 10:61433674-61433696 TTTTCCTAATGCCAAGTCATAGG + Intronic
1073502458 10:103952914-103952936 TTGTTCAAAGGCAAATTCATAGG - Intergenic
1073847996 10:107581378-107581400 TTCTGCAAATGCCAACACCTAGG + Intergenic
1074394176 10:113083830-113083852 TTTTGGAAATGCCACATCTTTGG - Intronic
1075214523 10:120520471-120520493 TTGCTCAAATGCCAATCCATAGG - Intronic
1075308468 10:121390218-121390240 TGGTGCAAATGCAAACTCCTAGG - Intergenic
1075945033 10:126425410-126425432 TTATGCAAATGCCAAAATGTGGG - Exonic
1077558654 11:3241505-3241527 TGGGGCAAATGCCAAACAATTGG + Intergenic
1079097344 11:17519371-17519393 TTGAGCAAATGCAAAATTCTTGG + Intronic
1080541588 11:33271268-33271290 TTGTGCAAATGCCTAAAAAATGG + Intronic
1083593010 11:63906277-63906299 TTGTGCTGATGCCCAATCAGAGG - Intronic
1085813710 11:79712387-79712409 TTGTGCATATACCCAATAATGGG + Intergenic
1087215572 11:95489598-95489620 TTTTGTAAAGGCCAAATCATAGG - Intergenic
1088704601 11:112450461-112450483 GTGTGCCAGTGCCAAACCATGGG - Intergenic
1090502201 11:127272383-127272405 TTTTGCATATGCCAACACATGGG + Intergenic
1096575798 12:52552183-52552205 TGGAGCAAATGCCCAATCAGAGG + Intronic
1096729362 12:53595380-53595402 TTGTGCTTATGCCAGATAATAGG + Intronic
1098334959 12:69394178-69394200 TTGTGCAAATGCAAATTCCTGGG - Intergenic
1099371669 12:81839247-81839269 TTATGCACATGCAAACTCATGGG + Intergenic
1100227723 12:92575496-92575518 TTGTGCAAATCACACATCAGAGG - Intergenic
1100733434 12:97499416-97499438 TCGTTCAAATCCCAAAACATGGG - Intergenic
1102281963 12:111625556-111625578 TTGTTCAAATGTGAAGTCATTGG + Intergenic
1105220298 13:18319854-18319876 TTGTGCAAATGCCTAAGGGTAGG - Intergenic
1107239443 13:38214413-38214435 TTTTGAAAATACCAAATCTTGGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112076609 13:95920825-95920847 TTGTGTATATGCCAAGTAATGGG - Intronic
1115422972 14:33219260-33219282 TTTAGCAAATGTCAAATCAGTGG - Intronic
1116569139 14:46492680-46492702 GTGTGCATATGCAGAATCATGGG - Intergenic
1118507391 14:66428342-66428364 TTCTGTAAATGCCAGAGCATTGG - Intergenic
1118761476 14:68882732-68882754 TTGTCCAAATGTCAAATGACTGG - Intronic
1122672773 14:103385110-103385132 GTGTGTAAATGCCAACTCAGCGG + Intergenic
1202869898 14_GL000225v1_random:152496-152518 TTGTGCAAATGCCTAAGGGTAGG - Intergenic
1126098335 15:45104763-45104785 TTGTGCAATGGGCAAATCATAGG - Intronic
1126188966 15:45859630-45859652 TTTTTCAAATGACAAATGATAGG - Intergenic
1132203744 15:99972564-99972586 TTGTGAAAATGGGAATTCATGGG + Exonic
1134509042 16:14831561-14831583 CTGTGACAATGCCAATTCATGGG - Intronic
1134559000 16:15191419-15191441 TTCTGCAGATGCCAAATCAAGGG + Intergenic
1134696743 16:16230395-16230417 CTGTGACAATGCCAATTCATGGG - Intergenic
1134919535 16:18103032-18103054 TTCTCCAGATGCCAAATCAAGGG + Intergenic
1134975092 16:18564310-18564332 CTGTGACAATGCCAATTCATGGG + Intergenic
1137462226 16:48675478-48675500 TTCTGCAACTGACAAATCAAGGG + Intergenic
1140934180 16:79655512-79655534 TTGTGCAACTGCCAAATTGAGGG + Intergenic
1141861614 16:86720675-86720697 TTGTGTCAATGCCACATCCTTGG - Intergenic
1141901221 16:86992223-86992245 TTGTTCAAATGCCCAATGAATGG + Intergenic
1142133077 16:88439670-88439692 TTGTGCAAATCTCCAAACATTGG - Exonic
1143695542 17:8613169-8613191 TTGTGAAAATGCCATTGCATCGG - Intronic
1145778487 17:27545913-27545935 TTGTGCAAATGGCATATGTTAGG + Intronic
1146384005 17:32353359-32353381 ATGAGCAAATACCAAATCATTGG + Intronic
1146563674 17:33893477-33893499 TTATGCAAATTCCAATTTATAGG + Intronic
1150915549 17:69433076-69433098 TTGGGCAACTGTCACATCATTGG - Intronic
1151908531 17:77065830-77065852 CTGTGCAAAAGCCAAACCTTAGG - Intergenic
1153423996 18:4943076-4943098 TAGTAAAAATGCCAACTCATGGG + Intergenic
1154477670 18:14780073-14780095 ATGTGAAAATGCAAAATCAGAGG + Intronic
1156702201 18:39839475-39839497 TAGTGAATATGCCAAAACATTGG - Intergenic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1158925552 18:62254877-62254899 GTTTGCAAATGCAAAATGATGGG - Intronic
1164442546 19:28290316-28290338 TTCTGTAAATGACTAATCATGGG + Intergenic
1164941302 19:32253686-32253708 GTGTGTTAATGCCAAACCATGGG + Intergenic
925037845 2:704976-704998 ATTTGCAATTGCAAAATCATGGG + Intergenic
925419393 2:3699504-3699526 TTGGGTATATGCCAAATAATGGG + Intronic
927314689 2:21668132-21668154 TTGTGAAAGTGACAAAACATAGG + Intergenic
927512114 2:23650261-23650283 TTCTACAAATGCCAGATCTTAGG + Intronic
928599842 2:32893683-32893705 GTTTGCAAATGGCATATCATGGG - Intergenic
930432618 2:51299549-51299571 CTGTTCCACTGCCAAATCATGGG - Intergenic
931518031 2:63063069-63063091 TTGTACAAACACCAAAGCATGGG - Intergenic
931571895 2:63678106-63678128 TAATGCAAATGCCAAATCTATGG + Intronic
934183753 2:89652625-89652647 TTGTGCAAATGCCTAAGGGTAGG + Intergenic
934294041 2:91726796-91726818 TTGTGCAAATGCCTAAGGGTAGG + Intergenic
934673934 2:96235983-96236005 TTGTGCATTTGCCAGATCAGTGG - Intergenic
935806314 2:106751615-106751637 TTGTGCAAACCCTAAATCACTGG - Intergenic
937279676 2:120708965-120708987 TTGTGCAAATCCCAAATCATAGG - Intergenic
938695019 2:133827167-133827189 TTGTGAAAAAGGTAAATCATAGG - Intergenic
940086867 2:149869525-149869547 TTGTGCCAATGTCAAATCTTTGG + Intergenic
941189833 2:162367711-162367733 TTGTGCAAAATCTAAATCTTGGG + Intronic
942348990 2:175032959-175032981 TTGTGTATATACCCAATCATGGG + Intergenic
943814947 2:192241465-192241487 TAGTCCAAATGCAAAATCAATGG - Intergenic
944922219 2:204427467-204427489 TTGGGTATATGCCCAATCATGGG - Intergenic
945906608 2:215600839-215600861 GTGTGCAGATGGCATATCATAGG + Intergenic
945983904 2:216339409-216339431 ATGTGCAAATGCCAAGGCAGTGG - Intronic
946547048 2:220755578-220755600 TTGTGCAATTACCCAATCATAGG - Intergenic
946799947 2:223403800-223403822 TTGTGCATGTGTAAAATCATTGG + Intergenic
947011152 2:225568454-225568476 TTGAGGAAATGACAAATTATAGG + Intronic
947033232 2:225821895-225821917 TTGTGCAAATGGAAAAACAAAGG - Intergenic
947925706 2:233920807-233920829 TTGTGCCAATGCCAATTCTCTGG - Intronic
1169710247 20:8553095-8553117 TGTTGCAAATGCCAAAGCATGGG + Intronic
1170993332 20:21326004-21326026 TTGTTCAAGTGAGAAATCATGGG - Intronic
1172362163 20:34320663-34320685 TTGTGAAAAAGCAAAATCTTGGG - Intergenic
1173324668 20:42021667-42021689 GTTTGTAAATGGCAAATCATGGG + Intergenic
1174107671 20:48174447-48174469 TTGTTCAAAAGGAAAATCATCGG - Intergenic
1175300499 20:57939517-57939539 TTGTGCAGATCCCAAATCCTAGG + Intergenic
1176818338 21:13629634-13629656 TTTAGCAACTGCCACATCATTGG - Intronic
1177796705 21:25786522-25786544 TTGTTTAATTTCCAAATCATTGG - Intergenic
1177858334 21:26424471-26424493 TTATGCAGATGCCACATCCTCGG - Intergenic
1178380941 21:32107577-32107599 GAGTGCAACTGCCAAGTCATAGG + Intergenic
1179345742 21:40555387-40555409 CTGTGGAAATGACATATCATTGG - Intronic
1182446211 22:30391104-30391126 CTGTGCAAATGCCAAAAAAAAGG + Intronic
1184975928 22:48062005-48062027 CTGTGCAAATGCCCAAAGATGGG + Intergenic
949720406 3:6982982-6983004 TAGAGTAAATGCCAAATAATGGG + Intronic
950562631 3:13743733-13743755 TTGTGTATATGCCTAGTCATGGG + Intergenic
950836114 3:15920583-15920605 TGGTGGAAATGCAAATTCATGGG + Intergenic
951908068 3:27722670-27722692 TTTTTCAATTGCCAAAGCATCGG + Intronic
954532683 3:51334365-51334387 CTGTGCAAATGCCAAATGAGGGG + Intronic
954541784 3:51397911-51397933 TTGTGGAAATTACAAATCAAAGG - Intronic
954952276 3:54485995-54486017 TCGTGCAATTCCCAAATCTTAGG - Intronic
955103724 3:55876313-55876335 TTGGGCAAATCCCAATTCATAGG - Intronic
955238540 3:57160809-57160831 TTGTTAAAATGCCAATTCCTGGG + Intronic
957289325 3:78258106-78258128 TTGAGCAAAGACCAAATCAAGGG + Intergenic
965452638 3:168857496-168857518 TTGTTCAAATGGCAAAGAATTGG - Intergenic
967377627 3:188822971-188822993 TTGTGCAAAAGCCTTGTCATGGG + Intronic
967917665 3:194590731-194590753 TTGTAAAAATGCCAAACCTTAGG - Intronic
969838868 4:9865896-9865918 TTGCCAAAATGGCAAATCATGGG - Intronic
970920063 4:21383702-21383724 TTATGCAAATGCCTATTCATTGG + Intronic
972110793 4:35556599-35556621 TTGTGAAAATGCCAACTCCTTGG - Intergenic
974323836 4:60388303-60388325 TTTTGCAACTGCATAATCATGGG - Intergenic
975523758 4:75327435-75327457 TTGGGCAAATGCCATACCCTGGG - Intergenic
975588558 4:75977142-75977164 ATAAGCAAATGCAAAATCATGGG + Intronic
976516899 4:85978987-85979009 TTTTTCAAATGGCAAATTATAGG - Intronic
977465899 4:97382632-97382654 TGGAGCAAATGCCAAGTCATTGG - Intronic
977807249 4:101315722-101315744 TTGTGGAATTGCCAAACTATAGG - Intronic
978414604 4:108462303-108462325 TTGTGCTAAGCTCAAATCATGGG - Intergenic
978930067 4:114299173-114299195 TTTTTCAAAAGTCAAATCATGGG + Intergenic
979921937 4:126508326-126508348 CAGTGCAAAGGCCAAAGCATTGG - Intergenic
980573596 4:134656804-134656826 ATCTACAAATACCAAATCATGGG + Intergenic
980733820 4:136856263-136856285 TGGTGCCAAGGCTAAATCATGGG - Intergenic
984417993 4:179485219-179485241 TAGTGCAAATCCCAATTCAAGGG + Intergenic
984731485 4:183072262-183072284 TTGTGGAATTGCTAAATCAAAGG - Intergenic
984840992 4:184067291-184067313 TTGCCCAAATGCCACCTCATGGG - Intergenic
985337340 4:188910974-188910996 TTGTGATAATTACAAATCATGGG - Intergenic
987725624 5:21695513-21695535 TTGTGTATATGCCCAATAATGGG + Intergenic
988119037 5:26935975-26935997 TTATGGAAAGGCCAAATAATGGG + Intronic
988550702 5:32198335-32198357 TTCTGCAAAGGCCAGATCACTGG + Intergenic
991628572 5:68630952-68630974 TTGTGCAAAGGCCCTATAATGGG + Intergenic
993254093 5:85565311-85565333 TTTTACAAATGCATAATCATAGG - Intergenic
999253741 5:150197757-150197779 TTGAGCAACTGCTATATCATAGG + Intronic
1001142138 5:169153276-169153298 TTGTCCATTTGCCAAATAATTGG - Intronic
1001895664 5:175377832-175377854 TGGTGCACATGCCAAATCCCAGG - Intergenic
1002031157 5:176431570-176431592 AAGTGCAAATTCCAAATTATGGG - Intergenic
1002786780 6:407089-407111 TTGTGGAAAAACAAAATCATTGG + Intronic
1003632508 6:7800843-7800865 CAGTTCAAATGACAAATCATTGG - Intronic
1004704470 6:18111304-18111326 TTTTGGAAATTCCAAAACATGGG - Intergenic
1004726080 6:18312527-18312549 TTATGCAAATTCCTTATCATTGG + Intergenic
1007332463 6:41123889-41123911 TATTACAAATGTCAAATCATAGG - Intergenic
1007965756 6:46002413-46002435 TTGGGCCAATGCCACATCTTGGG + Intronic
1008004353 6:46394317-46394339 TTGTGCAAATGCCAAATCATAGG - Intronic
1011649521 6:89493030-89493052 TTGTAAAAATGTCAAATGATAGG + Intronic
1011925253 6:92635014-92635036 TTATGTGAATGCAAAATCATAGG - Intergenic
1014967679 6:127776056-127776078 TTGAACAAATGCCAAATAACGGG + Intronic
1015627470 6:135195493-135195515 TTGTAAAAATGTCAAATCATAGG - Intronic
1015805678 6:137106064-137106086 TTGTACCAATGCCACATCTTAGG + Intergenic
1016133230 6:140503666-140503688 TTGCATAAATCCCAAATCATGGG + Intergenic
1016780984 6:147958095-147958117 TTGTGCAAATGCTGCATCACTGG - Intergenic
1017157605 6:151336270-151336292 TTGGGTAGATGCCAAATAATGGG + Intronic
1018339291 6:162832905-162832927 TTATTCAAATTGCAAATCATTGG - Intronic
1018460209 6:163991130-163991152 TGGTGCAAATGCCACATTAGGGG - Intergenic
1020850684 7:13348619-13348641 TTATGCAAATAACAAATCTTTGG + Intergenic
1023159790 7:37285916-37285938 ATGTGCAAATGCTTAAACATGGG + Intronic
1027385367 7:77654626-77654648 TTGTGCTAACTCCCAATCATGGG - Intergenic
1028377481 7:90160841-90160863 TGGTGCAAATGCAAAAGCACAGG - Exonic
1029913802 7:104184888-104184910 TTGTGCAAATGAAACCTCATAGG - Intronic
1030853589 7:114522196-114522218 TTGTGCTAATGCAAAATGAAGGG + Intronic
1031176239 7:118354997-118355019 TTTTGTATATTCCAAATCATTGG + Intergenic
1034091701 7:148370171-148370193 TTGTGAAAGGGCCAAATCAGGGG - Intronic
1037512686 8:19599652-19599674 TTGGGCAAATGCAAAGTTATAGG + Intronic
1042114664 8:65417722-65417744 TTCTGGAAATGCCACATCTTGGG + Intergenic
1043488660 8:80725044-80725066 AAGTGCAAATGCTAAATCCTAGG + Intronic
1043744952 8:83862789-83862811 TTTTTCAAATGTCAAATGATAGG + Intergenic
1044422767 8:92017147-92017169 TTCTGCAAATGAAAAATCAAGGG - Intronic
1045571000 8:103369863-103369885 TTCTGCAAATGCCCAGTCCTGGG - Intergenic
1045730807 8:105238733-105238755 TTGTTAAAATGCAAAATCTTGGG - Intronic
1046214873 8:111131167-111131189 TTTGGCAATTGCCAAATAATTGG - Intergenic
1047559796 8:125974104-125974126 TGATGCAAATGACAAATCATAGG - Intergenic
1048174381 8:132138696-132138718 TTGTTCAAATCCCTAATCACAGG + Intronic
1050332454 9:4559281-4559303 TTGTGCAATTGCCATATAATGGG - Intronic
1051442398 9:17099794-17099816 ATTTGCAGATGGCAAATCATGGG - Intergenic
1052427734 9:28326734-28326756 TTTTTCTAATCCCAAATCATAGG + Intronic
1058050788 9:100404439-100404461 TTATGCAAATGCAAAATAATGGG - Intergenic
1060798637 9:126529383-126529405 TTTTGCAAAGGCCAAATCTGAGG - Intergenic
1062144232 9:134979914-134979936 GTTTGCAAATGACATATCATAGG + Intergenic
1203529021 Un_GL000213v1:119869-119891 TTTAGCAACTGCCACATCATTGG + Intergenic
1203734553 Un_GL000216v2:124049-124071 TTGTGCAAATGCCTAAGGGTAGG + Intergenic
1185818765 X:3181864-3181886 TTGTTCAAATTCCCAATCATTGG + Intergenic
1186656270 X:11615058-11615080 TTTTGCAAAGGCCAATTCTTGGG - Intronic
1187302616 X:18065608-18065630 TTGTGGAAATGACAATTCCTTGG - Intergenic
1191154484 X:57257181-57257203 TTGGGTATATGCCAAATAATGGG - Intergenic
1192767482 X:74156820-74156842 TTGTGTATATGCCCAATAATGGG - Intergenic
1193189001 X:78547173-78547195 TTCTGGAAATGCAAAATTATAGG - Intergenic
1194081180 X:89467171-89467193 TTGTGAAAATGTGAAAACATTGG + Intergenic
1194492656 X:94570569-94570591 TTTTGCTAAAGACAAATCATAGG + Intergenic
1196027388 X:111055306-111055328 ATGTGCAATGGCCAGATCATGGG - Intronic
1196550938 X:117024000-117024022 TTGAGCATATGCCCAATAATGGG + Intergenic
1197354914 X:125426759-125426781 TTGTTCAAATACAAACTCATTGG + Intergenic
1198131318 X:133698073-133698095 TTGTTCAAATGCCGAATCTATGG - Intronic
1198230781 X:134687121-134687143 AAGTGCAAATTCAAAATCATTGG + Intronic
1199230625 X:145433614-145433636 TTGTGAAAATCCCAAATTTTTGG - Intergenic
1199846713 X:151696909-151696931 TTGTGGAAACGCCACATCAAGGG - Intronic
1199990129 X:152982887-152982909 TTGTGCAAAGGCCAAAGCAGAGG - Intergenic
1200033295 X:153313023-153313045 TTGTGCAAAGGCCAAAGCAGAGG - Intergenic
1200433853 Y:3123368-3123390 TTGTGAAAATGTGAAAACATTGG + Intergenic
1200840156 Y:7773727-7773749 TTGTGCAAGGGGCAAATCAGTGG - Intergenic
1202626480 Y:56864547-56864569 TTGTGCAAATGCCTAAGGGTAGG - Intergenic