ID: 1008006750

View in Genome Browser
Species Human (GRCh38)
Location 6:46418559-46418581
Sequence CACACCAGACACTCTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008006744_1008006750 -8 Left 1008006744 6:46418544-46418566 CCAGACCCACTGACCCACACCAG 0: 1
1: 0
2: 1
3: 29
4: 391
Right 1008006750 6:46418559-46418581 CACACCAGACACTCTACAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1008006743_1008006750 -7 Left 1008006743 6:46418543-46418565 CCCAGACCCACTGACCCACACCA 0: 1
1: 0
2: 0
3: 27
4: 271
Right 1008006750 6:46418559-46418581 CACACCAGACACTCTACAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1008006742_1008006750 -6 Left 1008006742 6:46418542-46418564 CCCCAGACCCACTGACCCACACC 0: 1
1: 0
2: 2
3: 49
4: 531
Right 1008006750 6:46418559-46418581 CACACCAGACACTCTACAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 84
1008006741_1008006750 7 Left 1008006741 6:46418529-46418551 CCAGTCTCAGTGTCCCCAGACCC 0: 1
1: 0
2: 2
3: 47
4: 480
Right 1008006750 6:46418559-46418581 CACACCAGACACTCTACAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008006750 Original CRISPR CACACCAGACACTCTACAGG TGG Intronic
900970498 1:5990015-5990037 GACACCTGAGACTCTGCAGGTGG + Intronic
910587336 1:88893852-88893874 CAGACAAGAGACTCTCCAGGTGG - Intergenic
912389266 1:109290726-109290748 CAACCCAGACCCTCTACAGTGGG + Intergenic
1063375538 10:5552174-5552196 CACTTCAGACACTTTACAGCTGG - Intergenic
1065271915 10:24041896-24041918 CACACCAGACAGCCTAGAAGGGG - Intronic
1067804340 10:49382719-49382741 CACACCAGCCATTCTCCAGAGGG + Intronic
1067992897 10:51235995-51236017 TACACCAGAAACTCTAAGGGCGG - Intronic
1068407253 10:56605619-56605641 CACAGCCCAGACTCTACAGGTGG + Intergenic
1069943695 10:71972102-71972124 CTCACCAGAAGCTCTAGAGGTGG + Intronic
1073836617 10:107451755-107451777 CACACCAGAATCTTTACAGAAGG + Intergenic
1076533781 10:131162679-131162701 CACTCCAGACACCCTCCACGAGG - Intronic
1077858094 11:6149457-6149479 CCCACCCAACACTCCACAGGTGG - Intergenic
1078060611 11:8040356-8040378 CCCAGCAGACACTCTGCAGCTGG - Intronic
1081596027 11:44460277-44460299 AAGGCCAGACACTCAACAGGTGG + Intergenic
1086419508 11:86624521-86624543 CACTCCAGAAACTCTGCATGAGG - Intronic
1097430930 12:59506049-59506071 CACCCCAAATACTCAACAGGAGG + Intergenic
1099300848 12:80892726-80892748 CACATCAGAAATTCTCCAGGTGG - Intronic
1102670926 12:114618195-114618217 GACAACAGACACTCTAGAAGTGG + Intergenic
1107137246 13:36957947-36957969 CACACCAGCCACTTTAAACGCGG - Intronic
1107428385 13:40316690-40316712 CACCCCAGACACTCTCTAGGGGG + Intergenic
1108317820 13:49255090-49255112 CCCTTCAGACACTCTACGGGAGG + Intronic
1119739159 14:77002911-77002933 CACACAAGACATTCTAGAAGGGG + Intergenic
1123414637 15:20086284-20086306 CACACCAGCCCCACAACAGGAGG - Intergenic
1123523979 15:21093395-21093417 CACACCAGCCCCACAACAGGAGG - Intergenic
1124987817 15:34639322-34639344 CACACCAGAGATGCTACTGGAGG + Intergenic
1125909365 15:43422092-43422114 CACTCCTGACACTCTACAATTGG + Exonic
1127632142 15:60837373-60837395 AACACCAGCTCCTCTACAGGTGG + Intronic
1131443286 15:92474922-92474944 CACAGCAGACACTCAACAAGTGG - Intronic
1132516136 16:366884-366906 TACACCAGACCCTCTACCAGAGG + Intergenic
1132988890 16:2783052-2783074 CTCACCAGACACTGTGCAGAGGG - Intergenic
1140047255 16:71449281-71449303 CACATCAGACAATCCACAGTGGG - Exonic
1143754501 17:9056612-9056634 CACCCCACACACTCTACCTGAGG - Intronic
1144889061 17:18483560-18483582 CACACCAGGAACGCTCCAGGCGG - Intronic
1145143148 17:20460736-20460758 CACACCAGGAACGCTCCAGGCGG + Intronic
1145942166 17:28748279-28748301 CACAGTAGACACTCTCCTGGGGG - Exonic
1145978522 17:28998012-28998034 CAGGCCAGACACTCAGCAGGTGG + Intronic
1149534763 17:57424562-57424584 CACACCACACAGACTCCAGGAGG - Intronic
1164097788 19:22027250-22027272 CACAACACACAGTCTACAGGTGG - Intergenic
1164905788 19:31966870-31966892 CAAACCTCACACCCTACAGGCGG + Intergenic
927083307 2:19651303-19651325 CACATCAGAGGCTCTAAAGGTGG + Intergenic
935815869 2:106845248-106845270 CACTCCAGACCCTCCACAGCTGG - Intronic
936277969 2:111117200-111117222 CACCCCAGGCACTCCAGAGGTGG + Intronic
939993254 2:148896252-148896274 CACACAAGCCACTCTCTAGGAGG - Intronic
941083564 2:161090654-161090676 CACACCAAACACGCTACCCGCGG + Intergenic
946704882 2:222448508-222448530 CACAGTAGAAACTCTGCAGGTGG - Intronic
1171405643 20:24910702-24910724 CATACCAGCCCCTCTGCAGGTGG - Intergenic
1175569530 20:60008500-60008522 CACCCCAGACCCACTACAGCAGG - Intronic
1180992794 22:19947742-19947764 CAAACCTGACACTCCACAAGAGG + Intronic
1182243684 22:28937585-28937607 CTGATCAGACACTCTAGAGGTGG - Intronic
1184875739 22:47274339-47274361 CACATGAGACACTCTGCAGCGGG - Intergenic
949341728 3:3037996-3038018 CACACTGGCCTCTCTACAGGCGG - Intronic
951630485 3:24714797-24714819 CTCTCCAGAGACTCTAGAGGAGG + Intergenic
956244737 3:67170011-67170033 CAAATCAGACACTCTAGGGGTGG + Intergenic
956680580 3:71775761-71775783 GACTCCAGACTCTCTAAAGGGGG + Intronic
966173539 3:177111085-177111107 CACGCCAGGCACACAACAGGAGG + Intronic
966322752 3:178719212-178719234 CATACCAAACCCTGTACAGGAGG + Intronic
968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG + Intronic
969048927 4:4358832-4358854 CAGAGCAGACACACTCCAGGAGG - Intronic
969080252 4:4612351-4612373 CACACCATACCCTTTCCAGGAGG - Intergenic
969573776 4:8024883-8024905 CACACCAGACACCAGAGAGGTGG + Intronic
974901956 4:68010917-68010939 CACTACAGAAACTATACAGGAGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
978023000 4:103837110-103837132 CCCACAACACACTCTACATGCGG - Intergenic
986933851 5:12858791-12858813 CATAGCAGAGACTCTACATGAGG - Intergenic
993581000 5:89661010-89661032 CACACTAGACACTTTCCAGGTGG - Intergenic
994207697 5:97053936-97053958 CAAACTAGAAAATCTACAGGAGG - Intergenic
996230383 5:121056865-121056887 CACACCAGACACACTCCAGTAGG + Intergenic
1000448196 5:161350864-161350886 TACACCAGTGACTCTCCAGGGGG + Intronic
1004487543 6:16081588-16081610 AACACCTGATACTCTACAGCAGG + Intergenic
1005370193 6:25124150-25124172 CATATCAGACTCTCTAGAGGTGG + Intergenic
1008006750 6:46418559-46418581 CACACCAGACACTCTACAGGTGG + Intronic
1008657685 6:53632548-53632570 CACACCAAACACCCTACACATGG - Intergenic
1010667101 6:78643739-78643761 CACACCAGACTCTCTTCACCTGG + Intergenic
1014312987 6:119829070-119829092 CTCAGCAGAAACCCTACAGGAGG - Intergenic
1018397053 6:163386229-163386251 GACACCAAACACTCTCCAGATGG - Intergenic
1018483356 6:164214304-164214326 TGCAGCAGACACTCCACAGGAGG - Intergenic
1018948579 6:168364153-168364175 CACACAACACACACAACAGGGGG + Intergenic
1019070063 6:169338185-169338207 CACACCAGACAGTCCTCCGGAGG + Intergenic
1026430115 7:70337532-70337554 TGCAGAAGACACTCTACAGGGGG - Intronic
1034349523 7:150407150-150407172 CACACAAGACACTAGACAGATGG - Intronic
1034512925 7:151551082-151551104 CACACCAGGCACTGTTCTGGGGG - Intergenic
1034741567 7:153478709-153478731 CACAGCAGCCCCACTACAGGGGG - Intergenic
1035249244 7:157586369-157586391 CGCACCAGTCACTGTCCAGGGGG + Intronic
1045367360 8:101488984-101489006 CTCACCAGAAACTCTATATGTGG - Intergenic
1047421029 8:124708425-124708447 CACACCAGGTACTCTAAAAGGGG - Intronic
1056560116 9:87722804-87722826 AACACCAGCCCCTCTGCAGGAGG + Intergenic
1058415845 9:104787915-104787937 CTCACCAGAAACACCACAGGAGG + Exonic
1061588944 9:131585718-131585740 CACATCAGACATTCTCCTGGAGG + Intronic
1185643089 X:1599123-1599145 CACACCACACACCATACAAGCGG - Intronic
1192879930 X:75273168-75273190 CACACCATGCACTCTGCAGTAGG - Intergenic
1197762856 X:130039840-130039862 AACACCAGACACTTTACAGAAGG - Intronic
1199689486 X:150297571-150297593 CACTGCAGAAACTCTACAAGTGG + Intergenic