ID: 1008009610

View in Genome Browser
Species Human (GRCh38)
Location 6:46452095-46452117
Sequence ATTTGGTTCTGGGGATTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008009610_1008009616 13 Left 1008009610 6:46452095-46452117 CCATTGAATCCCCAGAACCAAAT 0: 1
1: 0
2: 4
3: 31
4: 209
Right 1008009616 6:46452131-46452153 TCAATAAATATCTGTATATCAGG No data
1008009610_1008009617 16 Left 1008009610 6:46452095-46452117 CCATTGAATCCCCAGAACCAAAT 0: 1
1: 0
2: 4
3: 31
4: 209
Right 1008009617 6:46452134-46452156 ATAAATATCTGTATATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008009610 Original CRISPR ATTTGGTTCTGGGGATTCAA TGG (reversed) Intronic
904691438 1:32296127-32296149 TTTTGGTGCTGGGGATACAGAGG - Intronic
906676531 1:47697603-47697625 CCTTGGTTCTGGGGATTTAAGGG - Intergenic
909015465 1:70375288-70375310 ATTTGGCTCAGGGAATGCAAAGG + Intronic
909070420 1:70986633-70986655 AATTGATTCTGGGGATTTCAGGG + Intronic
909353146 1:74677154-74677176 ATTTGGTACTGGGAATACAAAGG - Intergenic
909815573 1:79988676-79988698 AATTGGTACTGGGGATAAAAAGG - Intergenic
910038510 1:82818619-82818641 TATCGGTGCTGGGGATTCAATGG + Intergenic
910371870 1:86524428-86524450 TTTTGATTATGGGGAATCAATGG - Intergenic
912040028 1:105378257-105378279 AATTGCTTCTGGGGACTTAATGG + Intergenic
912264503 1:108143059-108143081 CACTGGATCTGGGGATTCAAAGG - Intronic
914743593 1:150485191-150485213 AGTTGGTTCTGAAGTTTCAATGG - Intergenic
914975527 1:152357341-152357363 ATATAGTTCTGGGCACTCAAGGG - Exonic
915533041 1:156514858-156514880 TTTTGGTTTTGGGGATTGACTGG + Intergenic
915675854 1:157529793-157529815 AATAGATTCTGGGGATTCAGTGG + Intronic
915873442 1:159586975-159586997 ACTAGGTGCTGGGGATTCAGTGG - Intergenic
916541833 1:165764305-165764327 ATTAGGTACTGTGGATACAATGG + Intronic
916696266 1:167239924-167239946 ATTTAGTTTTGGGGATGGAAAGG + Intronic
917166115 1:172115155-172115177 ATTTGGTGCTGGAGATAGAAAGG + Intronic
917630394 1:176885725-176885747 ATTTGCTACTGGGGATGCAGTGG + Intronic
918550393 1:185734943-185734965 ATTTAGTTCAGGTGATTGAAGGG + Exonic
921261780 1:213390858-213390880 ATTATGTTCTGGGGAGGCAAAGG + Intergenic
923415758 1:233758101-233758123 ATTTTGATCTGGGGCTTCAAAGG - Intergenic
923797274 1:237169986-237170008 TATAGGTGCTGGGGATTCAATGG + Intronic
924519029 1:244789696-244789718 ATGTGCCTTTGGGGATTCAAAGG + Intergenic
1068877139 10:62009054-62009076 ATTTGGTAATGGGTTTTCAAAGG + Intronic
1069111401 10:64451924-64451946 ATTTGCTTCTTAGAATTCAATGG + Intergenic
1070011873 10:72483293-72483315 ATCTGGTTCTGGCTATTCAATGG - Intronic
1073300345 10:102467541-102467563 ATTTTCTTCAGGGGGTTCAAGGG + Intronic
1073836239 10:107446104-107446126 ATTTGTTTCTGGGGAAACAATGG - Intergenic
1074497754 10:113994777-113994799 ACTTGATGCTGGGGATACAAAGG - Intergenic
1076096002 10:127735883-127735905 GTTTGGGTTTGGGGATTAAAGGG - Intergenic
1078956512 11:16202245-16202267 ATTTGCTTCTGAAGATTCTAAGG + Intronic
1079521960 11:21338874-21338896 AAATGTTTCTGGGGATTCACAGG - Intronic
1080107662 11:28527485-28527507 ATTAGATGCTGGTGATTCAATGG + Intergenic
1080429557 11:32185692-32185714 ATTTGGTGCTGGGAATACAAAGG - Intergenic
1084033561 11:66494736-66494758 AGATGGTTGTGAGGATTCAAAGG + Intronic
1085989643 11:81826687-81826709 ATGTGGTTCTGGGGACCCATAGG + Intergenic
1086181921 11:83962500-83962522 ATTTGGTTAGTGGAATTCAATGG - Intronic
1087027362 11:93662488-93662510 ATTTCGTCCTGAGGATTAAATGG - Intronic
1087506408 11:99029381-99029403 ATATGCTTTTGGGGATTCAAAGG + Intronic
1087567760 11:99884078-99884100 ATTTGCTTCTCAGGATTCAGGGG - Intronic
1088564105 11:111149460-111149482 ATTTGGTTGTTTGGATTCAATGG + Intergenic
1088696455 11:112370308-112370330 ATTAGGGTCTGGGAATTCAATGG + Intergenic
1088775312 11:113076726-113076748 ATTTGTTTCTAGGGTTTCAAAGG + Intronic
1096949482 12:55451489-55451511 ATTTGCTTCTGGAGCTTGAAAGG + Intergenic
1097238308 12:57555021-57555043 GTTTGGTGTTGGGGATTTAAAGG + Intronic
1097941032 12:65305659-65305681 ATGAGGTTGTGGGGATTAAAAGG + Intronic
1097942274 12:65323814-65323836 ATTTGGTTCTGATGATAGAAGGG + Intronic
1098154244 12:67580839-67580861 AATAGGTTCTGGGGATTCAAAGG - Intergenic
1098722549 12:73920180-73920202 ATATGCTTCTTGTGATTCAAAGG + Intergenic
1098807183 12:75034831-75034853 ATATGATTCAGGAGATTCAATGG + Intergenic
1099016613 12:77350859-77350881 TTTTGGTTGTGGGGAGGCAAAGG + Intergenic
1102937151 12:116907087-116907109 ATCTGGTTCTTGGCATTCCAAGG + Intergenic
1104169334 12:126264954-126264976 GTTAGGTTCTGAGGATGCAAGGG - Intergenic
1104524600 12:129507685-129507707 AGTGGATTCTGGGGACTCAAGGG + Intronic
1104770315 12:131357627-131357649 ATTTGGTCCTGGGGCTTTCAGGG - Intergenic
1106927893 13:34632232-34632254 ATTTGGTTCTGAGTATTCATTGG + Intergenic
1107338850 13:39384701-39384723 ATTTGCTTCTGGGGAGTATATGG + Intronic
1108156432 13:47590017-47590039 TTGTAGCTCTGGGGATTCAAGGG + Intergenic
1114405080 14:22449036-22449058 ATCTGGTTCTGGGGATTCTCAGG + Intergenic
1115805307 14:37044123-37044145 TTTTGGTGCTGGGGATGTAATGG - Intronic
1117364705 14:55014477-55014499 GTTTGGTGCTAGGGATACAATGG - Intronic
1119106418 14:71929187-71929209 AGTGGATTCTGTGGATTCAATGG - Intergenic
1119126505 14:72132215-72132237 ATTTGGTTCTAGTGTTCCAAAGG + Intronic
1120357352 14:83451710-83451732 ATTTGGTTCTGTCTTTTCAAGGG + Intergenic
1121125945 14:91406860-91406882 AGTTGGCTCTGGGGATTTGAAGG - Intronic
1122065591 14:99171689-99171711 ACTTGTATTTGGGGATTCAAAGG - Exonic
1122333541 14:100947648-100947670 ATTGGGTTTTTGGGATTCATAGG + Intergenic
1130372203 15:83294562-83294584 ATTTGCATCTGAGGATACAATGG + Intergenic
1131383973 15:91987365-91987387 ATTATGCTCTGGGGATACAACGG + Intronic
1131552988 15:93373781-93373803 ATTAGACTCTGGGGACTCAAAGG - Intergenic
1131992765 15:98106573-98106595 TTTTGGTTCTGGAGATTGAATGG + Intergenic
1132098164 15:99003900-99003922 TTTTGGTTCTGGAGATTGAATGG - Intronic
1133610989 16:7433112-7433134 ACTTGGTTGGGGGAATTCAATGG - Intronic
1134379680 16:13712319-13712341 ATTTCCTTCTGGGGATAGAATGG - Intergenic
1135822576 16:25697155-25697177 ATTAGGTACTGGGGATAAAATGG + Intronic
1135868877 16:26130491-26130513 GTTTGGCGCTGGGGATACAAAGG + Intronic
1136143649 16:28302637-28302659 AGTTGGGTCTGGGGAGTAAAAGG - Intronic
1137670082 16:50273733-50273755 AGTTGGGACTGGGGATTCCAGGG + Intronic
1138373802 16:56548577-56548599 ATTTGCTTCTGTGGCTTCTAGGG + Intergenic
1139003571 16:62543610-62543632 ATTTGTTTTAGGGCATTCAAAGG - Intergenic
1140347248 16:74226017-74226039 AGTTGGTACTGGGGATTTAAGGG + Intergenic
1140556973 16:75932578-75932600 AGTTGCCTCTGGGGGTTCAATGG + Intergenic
1142304503 16:89277996-89278018 ATTTCCTTCTGGGGATTCCTGGG - Intronic
1147625492 17:41897280-41897302 TTTTCTTGCTGGGGATTCAAAGG + Intronic
1148668725 17:49394249-49394271 ACATGCTTCAGGGGATTCAAAGG - Intronic
1153144023 18:2008324-2008346 ATTTGGGTATGAGGATGCAAAGG - Intergenic
1158307499 18:56122607-56122629 CTTTCATTCTGAGGATTCAAGGG + Intergenic
1159200952 18:65183341-65183363 ATTTCCTTCTGGAGATTCTAGGG - Intergenic
1159742915 18:72195284-72195306 GTTTGGTTCTGTGTATTAAATGG + Intergenic
1160061782 18:75535410-75535432 ATTTGTTTCTGGGAATTCCATGG - Intergenic
1161369446 19:3902345-3902367 ATTTAGTTCTGGAGAATCACTGG - Intronic
1161741012 19:6021295-6021317 TTTAGGTGCTGGGGATGCAACGG + Intronic
1165620310 19:37240674-37240696 TTTATGTGCTGGGGATTCAATGG - Intronic
1165907607 19:39203448-39203470 CTTTGGTTCTGGGGACTCCAGGG + Intronic
925826171 2:7850311-7850333 ATTTGGTTCCTGGGCTTCAGTGG + Intergenic
926066571 2:9844723-9844745 ACTAGGTGCTGGGGATTCAATGG - Intronic
929068423 2:38004558-38004580 AATAGGTTCTGGAGATTTAAAGG - Intronic
929126106 2:38523960-38523982 ACGTGGTTCTGGGGAGTCACAGG + Intergenic
929503273 2:42508283-42508305 TTTTGGTGCTGGAGATTCTATGG - Intronic
929522508 2:42666765-42666787 GCTTGGTGCTGGGAATTCAATGG - Intronic
932104251 2:68928329-68928351 ATTTGACTCTGGGGATTCACTGG - Intergenic
933039159 2:77439805-77439827 GTTTTGTTCTGAGGATTAAATGG - Intronic
933860145 2:86458522-86458544 ACTTGGTCCTGGAGATTGAAAGG + Intronic
934549808 2:95251892-95251914 ATTTGGTTCTGGGTACCCACTGG - Intronic
935497419 2:103798001-103798023 ATTGGGTGCTGGGGACTTAAGGG - Intergenic
935977275 2:108591236-108591258 GTTAGGTTCTGGGGACACAAAGG + Intronic
936506626 2:113112825-113112847 ATTAGATTCTGAGGATACAACGG - Intronic
939264290 2:139851579-139851601 ATTTGGTTATGGGTATATAAGGG + Intergenic
939330632 2:140755187-140755209 ATCTGGTTCTTGGGATTTGAGGG - Intronic
939535199 2:143418976-143418998 TTTTGTTTCTTGGTATTCAAAGG - Intronic
942862283 2:180629423-180629445 GTTAGGTGCTGGGGATCCAATGG - Intergenic
943593805 2:189831064-189831086 ATTTGGTTATGTGGATAAAATGG + Intronic
946617810 2:221528486-221528508 ACTTGGCTGTGGTGATTCAAAGG - Intronic
947516437 2:230808914-230808936 CATAGGTGCTGGGGATTCAAAGG + Intronic
1171296074 20:24018332-24018354 ATTTGCTTCAGTGGATTCCACGG + Intergenic
1172605086 20:36208608-36208630 TTCTGGTTCTAGGGATTCAGTGG - Intronic
1173159894 20:40644567-40644589 ACCTGGTGCTGGGGATTCAGTGG + Intergenic
1173944111 20:46936563-46936585 ATTTGGGTTTGGGGATAAAAGGG + Intronic
1174557338 20:51405270-51405292 ATGTGGATCTGGGGTTTGAAAGG - Intronic
1175014281 20:55771973-55771995 ATTAGGTTCTAGGAATTCAATGG + Intergenic
1177244755 21:18509158-18509180 ATTAGATTTTGGGGATTCAATGG + Intergenic
1177447604 21:21217971-21217993 ATTTCATTCTGGAGATTCTATGG - Intronic
1177622444 21:23613624-23613646 ATTTGATTTTGGGTATCCAATGG + Intergenic
1179297721 21:40078546-40078568 ATTAGGCTTTCGGGATTCAATGG - Intronic
1180008637 21:45035069-45035091 ATGTGGTCCTGGGGTTTCCAGGG - Intergenic
1182369412 22:29800422-29800444 ATTAGGTTCTGGGGATATAGTGG - Intronic
1183266781 22:36832272-36832294 ATTTGGATCTGGGCCTTGAAAGG + Intergenic
949375582 3:3385756-3385778 AATTGTTTCTGGGGGTTGAAGGG + Intergenic
949651704 3:6167364-6167386 AGCTGGTTCTAGGAATTCAAAGG + Intergenic
951786850 3:26430468-26430490 GTTAGGTACTGGGGATCCAAAGG - Intergenic
951857016 3:27208645-27208667 ATTTGGTTCTGGTGACTAAATGG + Intronic
951908454 3:27725806-27725828 ATTTGGGTCTGGGGTTTCAAGGG - Intergenic
952117926 3:30205089-30205111 ATTTAGTACTGGGAATTTAAAGG - Intergenic
954768458 3:52943348-52943370 ATTACCTTCTGGGGCTTCAAGGG + Exonic
954997629 3:54896038-54896060 ATGTGTTTCTGTGGATTCATGGG + Intronic
955182397 3:56683880-56683902 ATTTGGTTCTGGGGAGTTTGAGG + Intergenic
957410249 3:79830786-79830808 ATTGGGGTCTGGGGTTTCTATGG + Intergenic
958948887 3:100395770-100395792 ATTAGGTTCTGGCAATACAATGG + Intronic
959153534 3:102637905-102637927 ATTTAGTGCTGGGGATTCAATGG + Intergenic
959278109 3:104303997-104304019 CTTTGGTTCTGGGGATTCCCAGG + Intergenic
963273584 3:143308716-143308738 ATTGAGTTCTGGGGGTTAAATGG + Intronic
963304007 3:143629852-143629874 ATTAGGCACTGGGGATTCAGTGG + Intronic
963361083 3:144272718-144272740 ATTTGGTTCTTAAGATTCAGAGG - Intergenic
964080742 3:152753295-152753317 AATTTTTTCTGGGAATTCAATGG + Intergenic
964337964 3:155677962-155677984 GTTTGGTTCTGGGCAGACAAAGG - Intronic
964702637 3:159586047-159586069 ATTTATTTCTGGAGTTTCAAGGG - Intronic
964730059 3:159855753-159855775 AATTGGTTCAGGGAATTCTATGG - Intronic
965537884 3:169842995-169843017 ATTCAGTCCTGGGGATACAATGG - Intronic
965633000 3:170752500-170752522 ATTTGGATTTGTGGGTTCAAGGG - Intronic
965816568 3:172642857-172642879 ACTGGGTTCTGGAGATGCAAAGG + Intronic
965888194 3:173475606-173475628 ATAAGGATCTGGGGATTCACTGG - Intronic
967201373 3:187075332-187075354 CCTAGGTGCTGGGGATTCAAAGG + Intronic
968191953 3:196674994-196675016 ATTTGTTTCTCAGGCTTCAAAGG + Intronic
969726325 4:8920469-8920491 AGTTGGTTCTGGGGATTCTTAGG + Intergenic
971128777 4:23782718-23782740 TAGTGGTTCTGGGAATTCAAAGG + Intronic
976913448 4:90339008-90339030 ATGTGTTTCTGTGGATTTAAAGG + Intronic
978247043 4:106585784-106585806 ATGTGGTTCTCAGGATACAATGG - Intergenic
978318473 4:107466287-107466309 TGCTGGTGCTGGGGATTCAAAGG - Intergenic
980914222 4:139019429-139019451 ATTTGGTTATGTGGAATCCAGGG - Intronic
981506175 4:145502319-145502341 ATTTGGGAATGGGGGTTCAATGG + Intronic
982289394 4:153764668-153764690 ATTTGGTTGTGGGGCTGCCATGG - Intergenic
983702441 4:170614603-170614625 CTATGGTTCTGGGTTTTCAAGGG + Intergenic
984077018 4:175195900-175195922 ATTTGGTTTTAGGGAGTCAGTGG - Intergenic
985150748 4:186944832-186944854 ATATGGTTCCTGGGGTTCAAGGG + Intergenic
987266970 5:16265977-16265999 ATTTGGGTCTGGGGCTTGAAAGG - Intergenic
987472740 5:18352579-18352601 ATTAGGTTCTGAGGGTCCAAAGG + Intergenic
988574175 5:32403344-32403366 ATTTGGTTCTGTTGATGGAATGG + Exonic
990250010 5:53903860-53903882 TTTGGGCTCTGGGGATACAAAGG + Intronic
990346331 5:54875382-54875404 ATTTAGTACTGAGGATTCAATGG + Intergenic
992140426 5:73791191-73791213 GCTTGGTGCTGGGGATACAAGGG + Intronic
992156365 5:73958833-73958855 ATTTGGTAATGGGAACTCAAGGG + Intergenic
993323763 5:86508280-86508302 TTTTGGTGCTGGGGATTCAATGG - Intergenic
993636809 5:90353946-90353968 ATCTGGATCTGGGGGCTCAATGG - Intergenic
993697365 5:91077641-91077663 ATTTGGTTCATGGCAGTCAAAGG - Intronic
994452264 5:99956991-99957013 AGTTGATTCTGGTGATTGAAGGG - Intergenic
995647129 5:114325814-114325836 ATCTGGTTCTGTGAACTCAAGGG + Intergenic
997265925 5:132495580-132495602 GTTTGGTTCTGGAGATACACTGG + Intergenic
998302369 5:141036336-141036358 ATTTGGATCTGGGGACTTAGAGG - Intergenic
998861249 5:146446555-146446577 TTTTGGATTTGGGGTTTCAAAGG - Intergenic
998900987 5:146854058-146854080 ACTCGGTGCTGGGGATGCAAAGG - Intronic
999677980 5:154025517-154025539 AAAGGGTTCTGGGAATTCAAGGG + Intronic
1000683268 5:164214075-164214097 ATTTGTTTGTCCGGATTCAATGG - Intergenic
1000691141 5:164322659-164322681 TCTAGGTTCTGGGGATACAAAGG + Intergenic
1000734591 5:164883071-164883093 AGTTGGTTCTGGGTATTTAGAGG - Intergenic
1001029179 5:168249403-168249425 GCTAAGTTCTGGGGATTCAATGG + Intronic
1001053731 5:168432682-168432704 GTCTGGGGCTGGGGATTCAATGG + Intronic
1003271476 6:4611491-4611513 ATTAGGTGCTGGGGATACACTGG - Intergenic
1004244578 6:13961358-13961380 AAGTGGTTGTGAGGATTCAATGG - Intronic
1005637876 6:27768467-27768489 ATTTGGCTATGGGGATTCCTAGG - Intergenic
1006133888 6:31884264-31884286 GGGTGGTTCTGGGGATTCAGTGG + Intronic
1006552411 6:34835569-34835591 ATTTACTTCTGGGTATTCATAGG + Intronic
1006596896 6:35200273-35200295 AGCTGGTTCTGGGGATCCGAGGG + Intergenic
1007202019 6:40117516-40117538 ACTTAGTTCTAGGGAGTCAAAGG - Intergenic
1008009610 6:46452095-46452117 ATTTGGTTCTGGGGATTCAATGG - Intronic
1008720198 6:54339741-54339763 ATTTGATACTGGGGATGAAAAGG - Intronic
1009438033 6:63640464-63640486 GTTTGGTTGTGAGGATTAAATGG + Intronic
1010781432 6:79949540-79949562 CTTTGGTTCTGGGCAGTCACTGG - Intergenic
1011754403 6:90484061-90484083 ATATCGGTCTGAGGATTCAAAGG - Intergenic
1012738756 6:102985674-102985696 ATTTCTTTCTGGGGTTTCCAAGG - Intergenic
1013153389 6:107468895-107468917 ATTGAGTTCTGGGGATGCAGTGG - Intergenic
1013767474 6:113591748-113591770 GTTAGGTTCTGGGGATACTAAGG + Intergenic
1014775946 6:125510167-125510189 CTTAGGTTTTGGGGATACAAAGG + Intergenic
1015505837 6:133986761-133986783 ATTTTGTTCTGGGCAATTAAAGG - Intronic
1017833826 6:158157947-158157969 ATTAGGTTCTGGGAATACACTGG - Intronic
1020222296 7:6248866-6248888 ATGGGGATCTGGTGATTCAAGGG + Intronic
1022277268 7:28867528-28867550 GTTAGGTGCTGGGGATTTAACGG + Intergenic
1022350887 7:29565436-29565458 ATTGGGCTCTGGGGAGTAAAAGG + Intronic
1023521076 7:41050486-41050508 ATTTGATTCTGCGAATTCTAAGG - Intergenic
1024214413 7:47235138-47235160 ATTTGGATATGGGGTTTCCAAGG - Intergenic
1026082444 7:67233963-67233985 ATTTGGAGATGGGGTTTCAAAGG + Intronic
1026694625 7:72580030-72580052 ATTTGGAGATGGGGTTTCAAAGG - Intronic
1026978262 7:74511992-74512014 GCTTGGGTATGGGGATTCAATGG - Intronic
1027635411 7:80666596-80666618 ATTTTGTTGTGGGGATATAAAGG - Intronic
1028263467 7:88693152-88693174 AATTTATTCTGGGGATTAAAGGG + Intergenic
1028660525 7:93267526-93267548 ATTTAGTTCTGGGGAGTCACTGG + Intronic
1032072873 7:128819976-128819998 ATTTGATTTTGAGGCTTCAAAGG + Intronic
1033017521 7:137687061-137687083 CTTTGGCTCAGGGGAATCAATGG - Intronic
1036476422 8:9097311-9097333 ATTTGGTACTGGGGACCCAGTGG + Intronic
1037743769 8:21627581-21627603 ATCTGGGTCTGGGCTTTCAAGGG + Intergenic
1039549322 8:38431390-38431412 AGTAGGTGCTGGGGATTTAAAGG - Intronic
1043306095 8:78798257-78798279 ATTTGATTGTGGGGTTTCAATGG + Intronic
1045636565 8:104198508-104198530 ATTTGGTTCTGGGTACCCATTGG - Intronic
1045883534 8:107069172-107069194 GTTAGGTGCTGGGGATACAAAGG + Intergenic
1046966753 8:120176244-120176266 ATTAGTTTCTGGGGATTAAGTGG + Intronic
1047979705 8:130167906-130167928 ATTTGCTTCTGGTTTTTCAAAGG + Intronic
1048724152 8:137362562-137362584 ATTTTTTTCTAGGGATTTAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051300148 9:15641500-15641522 ATTTGGTTCTATGGTTTCCATGG - Intronic
1051485245 9:17601474-17601496 GTTTGGTTCTCTGGATTCATAGG + Intronic
1185946786 X:4385653-4385675 ATTTGGTGCTAGGGATTTTAAGG + Intergenic
1186561061 X:10614048-10614070 GCTTGGGTCTGGGGATTCAAAGG + Intronic
1187677839 X:21735629-21735651 ATTTGGTTTTGAAGATTCAGAGG - Intronic
1188311418 X:28621228-28621250 ATTAGGTACTGGGGAAGCAATGG - Intronic
1191226185 X:58047016-58047038 AATTGGTTATGGGGTTTCTAGGG + Intergenic
1192799420 X:74451650-74451672 ATTGGGTCCTGAGGATCCAAAGG - Intronic
1192904351 X:75534504-75534526 ATTGGACTCTGGGGACTCAAGGG - Intergenic
1194637662 X:96365184-96365206 ATTAGGTTCTGGGGATGCCATGG - Intergenic
1194885844 X:99315097-99315119 ATTAGGCTCTGGGGTTGCAAAGG + Intergenic
1195336961 X:103864873-103864895 GTTTGGGTCTGGGGTTTCTATGG + Intergenic
1195427162 X:104747406-104747428 ATTTGCTTCTGGGAATACAATGG + Intronic
1195989279 X:110666613-110666635 ACTTGCTTCTGGGGTTCCAATGG - Intergenic
1196164981 X:112528889-112528911 ATTGGGTTGTGAGGATTAAAGGG + Intergenic
1197916171 X:131538213-131538235 ATTTGGCACTGAGGATACAATGG - Intergenic
1199143665 X:144339449-144339471 GTTGGGTTCTGGGGATTTTATGG + Intergenic