ID: 1008012894

View in Genome Browser
Species Human (GRCh38)
Location 6:46487872-46487894
Sequence TGCTACTAGAACCATTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008012894 Original CRISPR TGCTACTAGAACCATTGGTT TGG (reversed) Intronic
902895051 1:19473890-19473912 TGCTATTAACACCATTGGATTGG - Intronic
906171806 1:43732356-43732378 TGCTACTAGAACCATGGCAAGGG - Intronic
909961462 1:81849595-81849617 AATTACTAGAACCATTTGTTTGG - Intronic
914323650 1:146589717-146589739 TGCTACTTAAACTATTGGTCTGG + Intergenic
914434197 1:147645850-147645872 TGCTAATAGAATAATTGGTCAGG + Exonic
1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG + Intronic
1066305679 10:34138073-34138095 TGCAACAAGCACCATTTGTTTGG - Intronic
1072596765 10:96880001-96880023 TGTTACAAGAAGTATTGGTTTGG + Intronic
1075730053 10:124630679-124630701 TGCTTCTAGAACCTGTGGTCTGG - Intronic
1079334989 11:19563496-19563518 TGCTACTTGAGCCCTTGGATCGG + Intronic
1079677508 11:23248725-23248747 TTATACCAGTACCATTGGTTTGG + Intergenic
1079878059 11:25886153-25886175 TGCTAATAAAACCATGAGTTGGG - Intergenic
1082212626 11:49523820-49523842 TGCTAATAAAGCCATTGCTTAGG - Intergenic
1084173227 11:67410436-67410458 TGTGACTAGAACCATGGGTGCGG - Intronic
1086636967 11:89100691-89100713 TGCTAATAAAGCCATTGCTTAGG + Intergenic
1092725557 12:11482350-11482372 TGCTTCTAGACCCATTGGGTTGG - Intronic
1095462610 12:42458404-42458426 TGCCACTAGAACCTTTAGTTAGG + Exonic
1097518162 12:60633590-60633612 TGTTACTATTACCATTGTTTGGG + Intergenic
1108163497 13:47667387-47667409 TGTTATTAGAATGATTGGTTTGG - Intergenic
1108834784 13:54529887-54529909 TGCCATAAGAACCATGGGTTGGG + Intergenic
1111758434 13:92429572-92429594 TGCTTCTAGAAGCAATGATTTGG - Intronic
1114452088 14:22833920-22833942 TGCTATTAAAACCTTTGGCTGGG - Intronic
1114827329 14:26096965-26096987 TGCTATTAGAAACTTTGATTTGG + Intergenic
1116728222 14:48589430-48589452 TGGCACAAGAACCATTGGCTGGG - Intergenic
1121154919 14:91673974-91673996 TTTTTCTAGAACCATTGCTTAGG + Intronic
1126359242 15:47828886-47828908 TGTTACTGGAACCAAAGGTTTGG + Intergenic
1138116225 16:54362620-54362642 GGCTATTAGCAGCATTGGTTAGG - Intergenic
1140009913 16:71121132-71121154 TGCTACTTAAACTATTGGTCTGG - Intronic
1149495179 17:57112979-57113001 TGGGACTAGAATCATGGGTTTGG + Intronic
1153481969 18:5555929-5555951 TGCTACCAGAACCCTTGCTGAGG - Intronic
1155107383 18:22680930-22680952 TGTTACTAGAGCAATAGGTTGGG - Intergenic
1155236151 18:23821464-23821486 TGCTAAAAGAACCACTGATTTGG + Intronic
1167905419 19:52656565-52656587 TTCTACTAAAACCATGGGCTTGG + Intronic
937951480 2:127391160-127391182 TGATACGAGTACTATTGGTTGGG + Intergenic
938002419 2:127753648-127753670 TGCTACTAAAACCAATTCTTTGG - Intronic
940645428 2:156387765-156387787 TGATAATTGAACAATTGGTTTGG + Intergenic
943531581 2:189088334-189088356 TGCTCTTAGAAACAGTGGTTTGG - Intronic
1172435779 20:34928078-34928100 TCCTTCTAGAACTTTTGGTTTGG + Intergenic
1182948302 22:34346118-34346140 TTCTGTTAGAAGCATTGGTTCGG - Intergenic
1184745102 22:46451563-46451585 TGCTACTGGAGCCTTTGGCTTGG - Intronic
952080796 3:29755195-29755217 TCCTTCTAGAAACATTGGTCTGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
957384161 3:79473376-79473398 TGCTAATACAACCATAGGTAAGG - Intronic
959934650 3:112016498-112016520 TGCTATTAAAACCACTGGCTAGG + Intergenic
963972260 3:151443171-151443193 TGCTACCAGTTCCACTGGTTCGG - Exonic
966036321 3:175421262-175421284 TGCTACGAGAACCATTTGAAAGG - Intronic
967017810 3:185497630-185497652 TGCTACTATAACCCTTGGGCAGG - Intronic
970371113 4:15407548-15407570 TCATTCTAGAACCATTGCTTTGG + Intronic
971239156 4:24872220-24872242 TGCATGTAAAACCATTGGTTTGG + Intronic
972889856 4:43543562-43543584 TGTTAATAGAATCATTAGTTTGG - Intergenic
975615416 4:76241683-76241705 TGCTGCTAGAACAGTTGTTTAGG + Intronic
975642500 4:76514196-76514218 TGCTACTATGAACATTTGTTTGG - Intronic
975701329 4:77069705-77069727 TGAAACTGGAACAATTGGTTGGG - Intronic
981624509 4:146740361-146740383 TGCTAATAGATCCATTCCTTGGG - Intronic
982821839 4:159950562-159950584 TGCTTCTAGTCCCACTGGTTGGG + Intergenic
988946679 5:36210126-36210148 TGCTACTAGAACCATGTGAGTGG - Intronic
989521735 5:42410388-42410410 TGCTACCACTACCATTAGTTTGG + Intergenic
992368465 5:76117167-76117189 TTCTGCCAGATCCATTGGTTGGG - Intronic
994288905 5:98003973-98003995 TCCTACTAAAACCACTGGCTAGG - Intergenic
996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG + Intergenic
1003933829 6:10955231-10955253 TCCTACTTGAACCATTGGCTGGG - Intronic
1008012894 6:46487872-46487894 TGCTACTAGAACCATTGGTTTGG - Intronic
1010770242 6:79819657-79819679 TTCTCCTAGAAGCAATGGTTCGG + Intergenic
1011874297 6:91938153-91938175 TGCTACTAACACCAATAGTTTGG - Intergenic
1012972980 6:105751375-105751397 TGCTACAACAAACATTGCTTTGG - Intergenic
1014117335 6:117680300-117680322 TGGTACAAGAACCAGGGGTTGGG + Intronic
1015161256 6:130154312-130154334 TGCAACTAGAGCCATTTGATAGG - Intronic
1015263206 6:131262171-131262193 TGCTATTGGAACCAGTTGTTGGG + Intronic
1019014928 6:168873291-168873313 TGCTACAAGAACCAAAGGATGGG - Intergenic
1020277176 7:6631811-6631833 TGCTATTAAAACCATAGGTGAGG - Intergenic
1022481866 7:30749559-30749581 TGCTGTTAGGACCCTTGGTTAGG + Intronic
1030609147 7:111669768-111669790 TGCGACCAGAACCATGGGTTGGG - Intergenic
1032353824 7:131190735-131190757 TGCTATAAGACCCACTGGTTGGG + Intronic
1033177840 7:139141967-139141989 TGCTACTACAACCATGTGTGTGG + Intronic
1043409496 8:79977964-79977986 TGCAACTAGAACTATTTGCTTGG + Intronic
1049781307 8:144430203-144430225 AGCTCCTAAAACCATGGGTTAGG - Intronic
1053720768 9:40944601-40944623 TGCTAGTAAACCTATTGGTTGGG + Intergenic
1054345222 9:63907555-63907577 TGCTAGTAAACCTATTGGTTGGG - Intergenic
1057703259 9:97378873-97378895 TGAAACTAGAACCCTTGGTGTGG - Intergenic
1185874356 X:3690158-3690180 TGCTGCTATAACCAGTGGGTGGG + Intronic
1186940566 X:14502563-14502585 TTCTACTAGGAGCAATGGTTCGG - Intergenic
1194971808 X:100352155-100352177 TGCTATTGGAAGCATGGGTTGGG + Intronic
1195419946 X:104663689-104663711 TGGTACTAGAAGAATTGGTTAGG + Intronic
1197674439 X:129314283-129314305 TGCTATTAGAACCAGGGCTTGGG - Intergenic
1201643759 Y:16205055-16205077 TGCTAGTGGATCCATTTGTTGGG - Intergenic
1201659056 Y:16380266-16380288 TGCTAGTGGATCCATTTGTTGGG + Intergenic