ID: 1008013155

View in Genome Browser
Species Human (GRCh38)
Location 6:46490640-46490662
Sequence TGCTTGGGATTAGCGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008013155 Original CRISPR TGCTTGGGATTAGCGGCCTT GGG (reversed) Intronic
901204366 1:7485394-7485416 TCCCTGGGATCAGCTGCCTTTGG + Intronic
901778721 1:11578442-11578464 TACTTGTGATTAGAGGCCTTCGG + Intergenic
915068563 1:153246359-153246381 TGCTTGGCATTTGTGGCCTTAGG - Intergenic
915364999 1:155309973-155309995 TGGTTGGGGTGAGGGGCCTTGGG + Intronic
922625940 1:227043146-227043168 TGCTTGGGATTACGGGCATAAGG - Intronic
922714385 1:227859297-227859319 TGCATGGGATTGCTGGCCTTAGG - Intergenic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1065350941 10:24795174-24795196 TGATTGGGATTAGTGCCCTTAGG + Intergenic
1066406766 10:35126571-35126593 AGCTTGGGGTTGGCGGCGTTAGG + Intergenic
1071906466 10:90179830-90179852 TGCCTGGGATTATCCTCCTTCGG + Intergenic
1073251516 10:102122626-102122648 TGTTTGGAATGAGTGGCCTTAGG - Intergenic
1074066600 10:110020514-110020536 TGCTTGGGCCTCGGGGCCTTTGG - Intronic
1077164348 11:1128576-1128598 GGCTGGGGAAGAGCGGCCTTAGG - Intergenic
1079846702 11:25480698-25480720 TGCTTGGAATTCTCTGCCTTAGG + Intergenic
1084901906 11:72315977-72315999 TGCTTGGGTTTAGAAGCCTCTGG + Intronic
1086014360 11:82148873-82148895 TGCTGGGGATGAGCAGTCTTGGG - Intergenic
1100985205 12:100197100-100197122 TGATTGGGAATGGCTGCCTTGGG - Intergenic
1104578466 12:129990440-129990462 TGCTTGGTGTTAGTGTCCTTAGG - Intergenic
1105882390 13:24615986-24616008 GGCTGGGGATGAGAGGCCTTGGG + Intergenic
1106884452 13:34168990-34169012 TGAATGGGATTAGTGACCTTAGG - Intergenic
1110920055 13:81072953-81072975 TGCTTTGGAGTAGCACCCTTAGG - Intergenic
1114513877 14:23285453-23285475 TTCTGGGGATCAGTGGCCTTTGG - Intronic
1119944100 14:78673723-78673745 TGAGTGGGATTAGCGCCCTTAGG - Intronic
1121564060 14:94895466-94895488 TGCTTGGGATGACTGGCCCTGGG - Intergenic
1121935151 14:98011735-98011757 TCCTTGGCATGAGGGGCCTTAGG - Intergenic
1124250154 15:28101772-28101794 TGCTTGGAAATAGCCACCTTTGG - Intergenic
1127080583 15:55374784-55374806 TACTTGGGATTAGCTGCCTGTGG - Intronic
1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG + Intronic
1130002690 15:80060361-80060383 TGCTTGGGTTTAGCTTGCTTAGG + Intronic
1143085363 17:4412168-4412190 TGCTGGTGATTTGCGGTCTTGGG + Intergenic
1147041145 17:37720032-37720054 TGCTTGGGACGAGCCTCCTTGGG - Intronic
1150211967 17:63446540-63446562 TGCGTGGGATCTGCGGCCTGCGG + Intergenic
1152060780 17:78073260-78073282 CTCTTGGGATTAGCGGACTTTGG + Intronic
1152823549 17:82449603-82449625 TGCTGGGGGCTAGCGGCCTCAGG - Intronic
1154471994 18:14712557-14712579 TGCTTGGCACTGGCGGCTTTGGG + Intergenic
1157256842 18:46147081-46147103 AGCTTGGGCTTCTCGGCCTTTGG + Intergenic
1160183287 18:76654716-76654738 TGCTTGGGATTAGACGCATCTGG - Intergenic
1162499569 19:11044328-11044350 TGTTTGTGATTAGTGGCTTTTGG - Intronic
1166745556 19:45140359-45140381 TGCCTGGGGTTAGCGGCTTCTGG + Intronic
1168281744 19:55309614-55309636 TGAATGGGATTAGTGTCCTTAGG - Intronic
925144975 2:1575272-1575294 TGCCTTGGACTAGCGGCCTGTGG + Intergenic
926145806 2:10396633-10396655 TGCTGGGGTGCAGCGGCCTTGGG + Intronic
929584083 2:43102465-43102487 TGCTTGGGACTGGCAGTCTTAGG - Intergenic
929923199 2:46188386-46188408 TGCTTGGAACTATAGGCCTTGGG + Intergenic
932652315 2:73571514-73571536 TGAATGGGATTAGTGCCCTTTGG - Intronic
939078306 2:137629178-137629200 TTCTTGGGATTGGCTGCCTTTGG - Intronic
944686881 2:202125522-202125544 TGCTTGGGCTTAGCTGGCCTGGG + Intronic
948399127 2:237670324-237670346 TGCTGGGGAGCAGCGGCCCTAGG + Intronic
1169553154 20:6721970-6721992 TACTTGGCATGAGTGGCCTTGGG - Intergenic
1170835865 20:19884065-19884087 TGCTTGGGATTATAGGCATACGG + Intergenic
1170923566 20:20702094-20702116 TGTTTGGTATTAATGGCCTTTGG - Intronic
1172914218 20:38431801-38431823 TGCTTGGGTTTAGCATCTTTAGG - Intergenic
1175597464 20:60246787-60246809 TGCTTGGGAGGAGAGCCCTTTGG - Intergenic
1175845409 20:62055770-62055792 TGATTGTGATTAGCACCCTTGGG - Intronic
1177258956 21:18703269-18703291 TGGTTGGGAGTAGGGGCGTTGGG + Intergenic
1179180160 21:39037942-39037964 GGCCTGGGAATAGCGGCCTGGGG - Intergenic
950640653 3:14346164-14346186 TGCTTGGCATTTGGGGCCTCTGG + Intergenic
952699458 3:36310575-36310597 TGATTTGGATTAGCACCCTTAGG + Intergenic
954173608 3:48825271-48825293 TCCTTGGGATTAGAGGCATGAGG + Intronic
966075568 3:175933180-175933202 TGCTTGGGGTCAGCGGTCATAGG + Intergenic
966313824 3:178624094-178624116 TCCTTTGGATCAGGGGCCTTGGG - Intronic
973582061 4:52353865-52353887 TGAATGGGATTAGTGCCCTTAGG - Intergenic
984336712 4:178401574-178401596 TGCTTTGCAATAGCGGCCTTAGG + Intergenic
985964333 5:3328459-3328481 TGAATGGGATTAGTGCCCTTCGG + Intergenic
988560443 5:32276220-32276242 TGCTGGGGTTTACCAGCCTTGGG - Intronic
994982241 5:106890706-106890728 TGCTTGTTATTTGCGGTCTTTGG + Intergenic
999223836 5:150003396-150003418 TGCTTGGGCTTGGTGGCCTTGGG + Intronic
1005459597 6:26055824-26055846 ACCTTGGGCTTAGCGGCCTTGGG + Exonic
1008013155 6:46490640-46490662 TGCTTGGGATTAGCGGCCTTGGG - Intronic
1013284820 6:108672136-108672158 GGCTTGGGATGACCGGCATTGGG - Intronic
1019861244 7:3659913-3659935 TGCTTCTGATTAGAGCCCTTGGG + Intronic
1047271490 8:123364250-123364272 TACTAGTTATTAGCGGCCTTTGG - Intronic
1047889039 8:129287108-129287130 TCCTTGGGTTTATCTGCCTTTGG - Intergenic
1048804484 8:138227145-138227167 TCCTAGGGATTAGCTGCCCTTGG - Intronic
1058790889 9:108444504-108444526 TGCATGGGGTGAGCGGCCTCAGG + Intergenic
1060006138 9:120001511-120001533 CTCTTGGGATTAGCGGAGTTGGG - Intergenic
1062574044 9:137198361-137198383 TGCTGGGGAGAAGGGGCCTTCGG - Intronic
1188780705 X:34280425-34280447 TGCTTGGGAGAAGAGGCTTTTGG - Intergenic
1190141414 X:47848816-47848838 TGCTTGGGATTAGAAGTATTTGG - Intronic
1190745999 X:53321758-53321780 TGCTTGGGATTGGCAGACCTAGG - Intergenic
1190909203 X:54756741-54756763 TGCATGGAATTAGAGGCCTTGGG - Intronic
1191882947 X:65860503-65860525 GGCAGGGGATTAGAGGCCTTGGG - Intergenic
1194706145 X:97178108-97178130 TGCTGGGGATGGGGGGCCTTGGG + Intronic
1196251104 X:113460861-113460883 TGAATGGGATTAGTGCCCTTAGG - Intergenic