ID: 1008015173

View in Genome Browser
Species Human (GRCh38)
Location 6:46510525-46510547
Sequence ATGTGATAGATGCATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008015173_1008015174 -5 Left 1008015173 6:46510525-46510547 CCTTCTTCATGCATCTATCACAT No data
Right 1008015174 6:46510543-46510565 CACATTTGCCTAGACCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008015173 Original CRISPR ATGTGATAGATGCATGAAGA AGG (reversed) Intergenic
No off target data available for this crispr