ID: 1008015896

View in Genome Browser
Species Human (GRCh38)
Location 6:46519363-46519385
Sequence ATCTAAGGACATAAGAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008015891_1008015896 22 Left 1008015891 6:46519318-46519340 CCACAAGAAATATGTATTCTTTG No data
Right 1008015896 6:46519363-46519385 ATCTAAGGACATAAGAAGTGGGG No data
1008015890_1008015896 23 Left 1008015890 6:46519317-46519339 CCCACAAGAAATATGTATTCTTT No data
Right 1008015896 6:46519363-46519385 ATCTAAGGACATAAGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008015896 Original CRISPR ATCTAAGGACATAAGAAGTG GGG Intergenic
No off target data available for this crispr