ID: 1008021001

View in Genome Browser
Species Human (GRCh38)
Location 6:46577013-46577035
Sequence TTAGAGCCAGCAATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008020998_1008021001 3 Left 1008020998 6:46576987-46577009 CCAAAGTCAATGCAAAAGAAAAA 0: 5
1: 47
2: 132
3: 300
4: 1470
Right 1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008021001 Original CRISPR TTAGAGCCAGCAATGGAGAA GGG Intronic
No off target data available for this crispr