ID: 1008024792

View in Genome Browser
Species Human (GRCh38)
Location 6:46623068-46623090
Sequence CAAGATCACCATTTCCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008024792 Original CRISPR CAAGATCACCATTTCCTTCT TGG (reversed) Intronic
900599221 1:3496022-3496044 CACGATCACCACTTCCTCCCCGG - Intronic
900912061 1:5604852-5604874 CAAGAACACTTTTTGCTTCTGGG + Intergenic
901140274 1:7024715-7024737 AAAGATCACATTTTCATTCTTGG - Intronic
902103219 1:14011108-14011130 CAAGATCTACATTTCTTCCTTGG + Intergenic
906250017 1:44303891-44303913 CAAGATGATCATATTCTTCTTGG - Intronic
907619134 1:55958500-55958522 CAAGTTCACCATTTACTAGTTGG - Intergenic
908840939 1:68279481-68279503 CAACAGCATCATCTCCTTCTGGG - Intergenic
911391910 1:97255911-97255933 CAAGTTCATCATTTCATTTTCGG + Intronic
911500608 1:98680324-98680346 CAAAACCACCTTTTCCTCCTAGG + Intronic
911710679 1:101068480-101068502 AAAGATAATCATTTCATTCTTGG - Intergenic
912252739 1:108027935-108027957 CTAGTATACCATTTCCTTCTTGG + Intergenic
912356363 1:109057340-109057362 CAAGAACACCATTTCCGGCCGGG + Intergenic
912451991 1:109773037-109773059 CAAGCTCACCAGCTCCTTCTGGG - Intronic
915212789 1:154323043-154323065 CAAGCTCCCCATTTACATCTTGG + Exonic
916294486 1:163202540-163202562 CCAGAACATCATTTCCTTCAAGG - Intronic
916754506 1:167756115-167756137 CAAGATTACCAAATCCCTCTCGG - Intronic
917186279 1:172360148-172360170 CAATATTACCATATCCCTCTGGG + Intronic
917541339 1:175917548-175917570 CAAGATCACCATTAGGTTCATGG - Intergenic
917681861 1:177375611-177375633 CAAAACCACTTTTTCCTTCTAGG + Intergenic
917869224 1:179227552-179227574 GAGGATCACCATTGCCTACTAGG + Intronic
918405526 1:184208307-184208329 CAAGTCCACCATTTTCCTCTGGG + Intergenic
918459528 1:184761846-184761868 GAAGATCACCATATTTTTCTTGG + Intergenic
919194318 1:194264017-194264039 CAAAACCACTTTTTCCTTCTGGG - Intergenic
919308858 1:195879139-195879161 CAAGTTCCCCATCTCCATCTGGG + Intergenic
919653962 1:200179958-200179980 CAGGATCCCCAGTGCCTTCTGGG - Intergenic
920664893 1:207956091-207956113 CAAGAGCACTGTTTCCTTCTAGG + Intergenic
920690343 1:208141898-208141920 CAAGATTTTTATTTCCTTCTGGG + Intronic
920790624 1:209086734-209086756 TAAGATCACAAGTTCATTCTTGG - Intergenic
923398470 1:233590959-233590981 CAAGATCACATTTTACTTCTTGG + Intergenic
924793806 1:247277619-247277641 CAAAAAAACCATTTTCTTCTTGG - Intergenic
1064133461 10:12730386-12730408 GAAGATCAGGATTTCATTCTTGG + Intronic
1064897315 10:20252720-20252742 CAAGATCATCCTTTCCTTCAGGG + Intronic
1065481591 10:26199686-26199708 CTAGATCAGCACTTCCTTCTGGG - Intronic
1066070416 10:31803344-31803366 CAAGGCCACCTTTTCCTCCTCGG - Intergenic
1066630091 10:37450694-37450716 CAAGTTCACCATGTCCTTCAAGG - Intergenic
1069211082 10:65760715-65760737 CAAAACCACCTTTTCCTCCTGGG + Intergenic
1070471104 10:76780297-76780319 CAAGATGACCATTTTTTTCTAGG + Intergenic
1070633467 10:78105407-78105429 CAAGACCACTTTTTCCTCCTAGG - Intergenic
1071289565 10:84179099-84179121 CCAGATGGCTATTTCCTTCTGGG - Intronic
1071964441 10:90837871-90837893 CAAGATCACCAATGACTTCAAGG + Intronic
1077443401 11:2579061-2579083 CAGGACCACCCCTTCCTTCTGGG + Intronic
1077760501 11:5090791-5090813 AATGTTTACCATTTCCTTCTAGG + Intergenic
1078097384 11:8308852-8308874 CAAGAACACCTTATTCTTCTAGG - Intergenic
1078687180 11:13544461-13544483 CAGGAACACCAATTCTTTCTGGG - Intergenic
1078687268 11:13545228-13545250 CAGGAACACCAATTCTTTCTGGG + Intergenic
1079939651 11:26663460-26663482 TAAGATCATCATTTTCTTCAAGG + Intergenic
1080182986 11:29446280-29446302 CAAAATCACTTTTTCCTCCTAGG - Intergenic
1081440663 11:43077217-43077239 CAATATCACAATTTACTTATTGG - Intergenic
1081644543 11:44780571-44780593 CAACTTCATCATTTCCTTCATGG + Intronic
1083933805 11:65860103-65860125 GAGGATCACCATTTCCTCCAAGG + Intronic
1085673116 11:78487967-78487989 CAAGTTCCAGATTTCCTTCTGGG - Intronic
1086048099 11:82556771-82556793 CAAAATAAGCATTTCTTTCTTGG - Intergenic
1086747957 11:90453897-90453919 CAAGATTCTCATTTTCTTCTTGG - Intergenic
1086759002 11:90603629-90603651 CAAAACCACTTTTTCCTTCTGGG - Intergenic
1087126052 11:94626554-94626576 CAAAACCACTTTTTCCTTCTAGG + Intergenic
1087179826 11:95130940-95130962 CAAGATCAGTATTTCATACTTGG - Exonic
1088728731 11:112661963-112661985 CAAGATCAGAATTTCCTGTTCGG - Intergenic
1089065904 11:115661929-115661951 CACTATCACCACTACCTTCTTGG + Intergenic
1090195440 11:124812452-124812474 CAAGACCATCACTTCTTTCTCGG - Intergenic
1091065662 11:132509498-132509520 CAAAATCACTTTTTCCTCCTGGG - Intronic
1091274097 11:134338443-134338465 CAAGGTCACCACCTCTTTCTGGG - Intronic
1093143509 12:15537551-15537573 CAAAATCACCAGTGACTTCTGGG - Intronic
1095252578 12:39996558-39996580 CAAAACCACTTTTTCCTTCTAGG - Intronic
1095512417 12:42966928-42966950 CCAGTTCTCCATTTCATTCTGGG + Intergenic
1098506753 12:71261423-71261445 CTAGATCACCATTTGGTTCTGGG - Intronic
1098734871 12:74087840-74087862 CTAGTTCACCATTTTCTTCTAGG + Intergenic
1099087136 12:78259347-78259369 TAACCTCACCATTTCTTTCTTGG + Intergenic
1099230071 12:80013648-80013670 CAAGAGCATCATTTTATTCTTGG + Intergenic
1099452345 12:82822709-82822731 CAAAATCTCCATTTGCTACTGGG - Intronic
1102493741 12:113305139-113305161 CACTATCACCAGTTCCCTCTAGG - Intronic
1102538295 12:113598905-113598927 CAACGCCAACATTTCCTTCTAGG - Intergenic
1104120258 12:125791780-125791802 CCAGATCACCAGTGCCATCTGGG - Intergenic
1106608799 13:31257929-31257951 CAAGAACATCATCTCCTTGTGGG - Intronic
1107114425 13:36731484-36731506 TAAGTTCTCCATTTCCTTCATGG + Intergenic
1107225323 13:38042435-38042457 CTTGATCACCATTTTTTTCTAGG + Intergenic
1107904295 13:45047934-45047956 AAATATTACCATTTCCTCCTTGG + Intergenic
1108896372 13:55334229-55334251 CAAAACCATTATTTCCTTCTAGG - Intergenic
1108931202 13:55823039-55823061 CGGTATCACCATTTACTTCTAGG + Intergenic
1109197980 13:59400145-59400167 CAAGATTACCATTGCCATATTGG + Intergenic
1109574826 13:64241491-64241513 CAAAATTACCATTTCCTCATTGG - Intergenic
1109923907 13:69108092-69108114 CAAAATTCCCATTCCCTTCTGGG - Intergenic
1110128186 13:71974665-71974687 CAGAATCTCCATTTCTTTCTTGG + Intergenic
1110357884 13:74589432-74589454 TTAGATCACCATTGCCTTCAAGG + Intergenic
1112968795 13:105233505-105233527 TAAGATCACCAATATCTTCTTGG - Intergenic
1113263293 13:108590482-108590504 CAGGTTCAACATATCCTTCTGGG - Intergenic
1114135426 14:19843403-19843425 CAAAAACACCATTTCCTCCGAGG - Intergenic
1114452958 14:22838402-22838424 CAGAACCACCATTTGCTTCTGGG + Intronic
1114835364 14:26197352-26197374 CAAGGTCCCCATTGCGTTCTGGG - Intergenic
1115677137 14:35689593-35689615 GAAGATCATCATCTCCTTCAAGG + Intronic
1116234968 14:42268444-42268466 CAAGAATGCCATTTTCTTCTGGG + Intergenic
1116286942 14:42985992-42986014 CAAAATCATGATTTCCTCCTAGG + Intergenic
1116336529 14:43664945-43664967 AAAAAGCAGCATTTCCTTCTTGG + Intergenic
1116528292 14:45934666-45934688 CAAAACCACCTTTTCCTCCTAGG - Intergenic
1118337753 14:64868445-64868467 CAAGCTCACCATGTCATCCTGGG - Intronic
1119941019 14:78641642-78641664 CAAGATCAGCATTACCATGTTGG - Intronic
1119950865 14:78743752-78743774 AAAGATGAACATTTCCTACTCGG - Intronic
1120407031 14:84103166-84103188 CAAAATCATTCTTTCCTTCTAGG - Intergenic
1120477119 14:85002317-85002339 CAAGTTCACCATTTCAATCCTGG - Intergenic
1120635089 14:86941022-86941044 CAAGATTATCATTTCCTTGATGG + Intergenic
1121091995 14:91189351-91189373 CCAGCTCACCATTTCCACCTGGG - Intronic
1123147406 14:106146351-106146373 CAAGTTCACCATTTCCCTGAAGG - Intergenic
1124022483 15:25937384-25937406 CAAGATCTCTCTTCCCTTCTGGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125137080 15:36356096-36356118 CATGATAACCATTTCCTTTGAGG + Intergenic
1125409247 15:39387975-39387997 CAAGATCTGTATTTCCTTCTAGG - Intergenic
1125732461 15:41900840-41900862 GGAGGTCACCATCTCCTTCTTGG + Exonic
1126698401 15:51345025-51345047 CCAGATCCCCATTTCCTTATTGG - Intronic
1128495757 15:68197611-68197633 CCAGCTCTCCATTTCCGTCTAGG + Exonic
1130985814 15:88843699-88843721 CAAGATCCCCTCTTCCCTCTAGG - Intronic
1131624829 15:94106492-94106514 CAGGATTTCCATTTCTTTCTTGG + Intergenic
1131921179 15:97330374-97330396 AAAGATCAGCATCGCCTTCTAGG - Intergenic
1133474277 16:6105074-6105096 CAAAGTCACCATCTCCTTCTTGG - Intronic
1135038657 16:19100025-19100047 GAAAATAACCATTTTCTTCTAGG - Intergenic
1135057593 16:19243456-19243478 CAAGGTCACCCTTGCCTTCTTGG + Intronic
1136691334 16:32033093-32033115 CAAGTTCACCATTTCCCTGAAGG + Intergenic
1136791922 16:32976658-32976680 CAAGTTCACCATTTCCCTGAAGG + Intergenic
1136877895 16:33877250-33877272 CAAGTTCACCATTTCCCTGAAGG - Intergenic
1137991893 16:53165474-53165496 CACCACCACCATTACCTTCTGGG - Intronic
1141787150 16:86209205-86209227 AAAGATCACCAGTTTCTCCTGGG - Intergenic
1203094133 16_KI270728v1_random:1238122-1238144 CAAGTTCACCATTTCCCTGAAGG + Intergenic
1142578556 17:925833-925855 CAAGCCCACCATGTACTTCTTGG - Intronic
1144031228 17:11325145-11325167 CAAGTTTATCATTTCCATCTGGG - Intronic
1149012108 17:51867758-51867780 CCAGATTACCAATTCCCTCTAGG - Intronic
1151536897 17:74744336-74744358 CATGATCACCACGTCCCTCTGGG - Exonic
1155068039 18:22285526-22285548 CATGATCAGCCTTTCTTTCTAGG - Intergenic
1155245594 18:23905697-23905719 CAAAAACAACATTTGCTTCTAGG - Intronic
1155675604 18:28425584-28425606 CAGAATCACTTTTTCCTTCTGGG - Intergenic
1155810075 18:30221270-30221292 CAACATCATCATTTTCTCCTTGG - Intergenic
1159593375 18:70358947-70358969 CAAGATTTCCTTTTACTTCTGGG + Intergenic
1159804239 18:72936454-72936476 AAATATCACCATTTTCTTCATGG - Intergenic
1161540298 19:4846800-4846822 CAAGATCAGAGTGTCCTTCTGGG - Intronic
1162861841 19:13511671-13511693 CAAACTCACCATCTCTTTCTTGG + Intronic
1166117542 19:40664929-40664951 CTAGAACACCCTTTCCTTCATGG - Intergenic
1167087634 19:47321016-47321038 CAAGGTGAACACTTCCTTCTAGG + Exonic
925834964 2:7935714-7935736 CAAGCTCACCATGTGTTTCTGGG - Intergenic
927531117 2:23802849-23802871 CCAGATAACAATTTCTTTCTGGG + Intronic
928287257 2:30002896-30002918 CAACATCACTATTCCCTCCTAGG + Intergenic
928747741 2:34434788-34434810 CAAGATCTTCATATCCTTTTGGG + Intergenic
930444274 2:51450923-51450945 CAAAACCACTATTTCCTCCTAGG - Intergenic
932847539 2:75151314-75151336 CAAAAACACTTTTTCCTTCTGGG - Intronic
937868025 2:126768471-126768493 CATGGTCACCATGACCTTCTGGG + Intergenic
940036494 2:149317400-149317422 CAGGATTACCGTTTCCTTGTAGG + Intergenic
940698237 2:157007853-157007875 CAAGTTCAACATTTCCTTTTAGG - Intergenic
940770408 2:157833719-157833741 GAAGATTATCATTTCCCTCTTGG - Intronic
941829398 2:169937900-169937922 CACCAATACCATTTCCTTCTGGG - Intronic
942888534 2:180959099-180959121 CAAGATACCCATTTGCTCCTGGG - Intergenic
942981528 2:182089066-182089088 CAGGACCACCATTTATTTCTTGG + Intronic
943237995 2:185347540-185347562 CAAAACCACTTTTTCCTTCTAGG - Intergenic
943263211 2:185692946-185692968 TAAGATCTCCATTTCCTTGCTGG - Intergenic
944282258 2:197911558-197911580 GAAGATCACCCTTTGCTTCCAGG + Intronic
944811451 2:203330489-203330511 CAAGATCAGCCTCTCCTACTAGG - Intronic
944993604 2:205268173-205268195 GATGATCAGCAGTTCCTTCTTGG - Intronic
946743573 2:222823945-222823967 CCAGTTCACCCTTTTCTTCTTGG + Intergenic
946878511 2:224154817-224154839 CAAGGTCACCATTTCCTTGCTGG + Intergenic
1170340149 20:15316650-15316672 CAAGTTCTCTATGTCCTTCTTGG - Intronic
1171180111 20:23085556-23085578 CCAGACCACCAGTTCCTCCTTGG - Exonic
1172103115 20:32497606-32497628 CAAGATCACGAATCCCTTCTGGG + Intronic
1172262199 20:33577307-33577329 CAAGATCACCCTTCTCTTCTTGG - Intronic
1172430471 20:34886973-34886995 TAAGAGCACCATTTCCTTTGTGG - Intronic
1175099827 20:56570884-56570906 CTAGAACACCATCTGCTTCTGGG + Intergenic
1175272925 20:57747300-57747322 CAAGTTCATGATTTCCTTTTTGG - Intergenic
1175373169 20:58506328-58506350 CAAGGCCACCTTCTCCTTCTGGG - Intronic
1177130400 21:17248252-17248274 CAAAACCACCTTTTCCTCCTAGG - Intergenic
1178424382 21:32467634-32467656 AGAGCTCACCAATTCCTTCTGGG + Intronic
1179065090 21:38017604-38017626 CAAAATCACTTTTTCCTTCTAGG - Intronic
1181048734 22:20228777-20228799 CAACAGCACCATTTGCTGCTTGG + Intergenic
1181425495 22:22835031-22835053 CAGGATCCCCAATTGCTTCTCGG + Intronic
1181674491 22:24442778-24442800 CAAAAACACCCCTTCCTTCTGGG - Intergenic
1182709215 22:32310203-32310225 CAAGGCCACCAGTTCCTTTTTGG + Intergenic
1182913491 22:34006868-34006890 CAAAATCACTTTTTCCTTCTAGG + Intergenic
1182934521 22:34208588-34208610 CAAGCTCTCCATTCCTTTCTAGG - Intergenic
1184396812 22:44247138-44247160 CAAGGCCACCAGTTCCTTTTTGG + Exonic
951614825 3:24530786-24530808 CAAGACCACCATGTTCTGCTTGG + Intergenic
951621474 3:24606463-24606485 CAAGATCACCATAAGCTTCAGGG + Intergenic
951629886 3:24708095-24708117 CAATATCACCTCCTCCTTCTGGG - Intergenic
952110602 3:30119919-30119941 CAAGATCACCAGTGCCTACTAGG + Intergenic
955044500 3:55347223-55347245 CCAGATCCCTATTGCCTTCTTGG + Intergenic
956313357 3:67906793-67906815 AAAGATCAACATTTCATTCTAGG + Intergenic
957160338 3:76601662-76601684 CAAGGTAACCATTTTCTCCTAGG + Intronic
957528308 3:81406375-81406397 CAAGCACACCATTTCCTTTTTGG - Intergenic
957551663 3:81713181-81713203 CAAAATCACTAGTTCCTTCCTGG - Intronic
957624917 3:82644266-82644288 CCAGATCACCTTTACCATCTGGG + Intergenic
957988212 3:87597457-87597479 CAAAATCACTTTTTCCTCCTGGG + Intergenic
959290013 3:104461581-104461603 CAAGATCACACATTCTTTCTAGG - Intergenic
959342582 3:105149414-105149436 CAAAATCACTTTTTCCTCCTGGG + Intergenic
959621153 3:108399774-108399796 AAAGATAACCATTTTATTCTAGG - Intronic
960616602 3:119601132-119601154 CCAGAACACCCTTCCCTTCTTGG + Intronic
961982136 3:131091270-131091292 CAAACTCCCCATTGCCTTCTGGG - Intronic
962642771 3:137405559-137405581 TGAGTTCACCATCTCCTTCTTGG + Intergenic
962720192 3:138166634-138166656 CAAGATCATAACTGCCTTCTAGG - Intronic
964182831 3:153908399-153908421 CAAAGTCACCATGTCCTTCTCGG - Intergenic
965127502 3:164649505-164649527 CCAGGAAACCATTTCCTTCTAGG - Intergenic
969163239 4:5279939-5279961 CAAAACCACATTTTCCTTCTAGG + Intronic
969957014 4:10901155-10901177 CAAGTTCTCTATTTACTTCTGGG + Intergenic
970339185 4:15086443-15086465 CAAAATCACTTTTTCCTCCTGGG + Intergenic
970573072 4:17401569-17401591 AAAAATTAGCATTTCCTTCTGGG - Intergenic
970801367 4:19976700-19976722 CAAAACCACCTTTTCCTCCTAGG + Intergenic
971510422 4:27417163-27417185 CAAAATCACATTTTCCTCCTAGG - Intergenic
972016938 4:34258907-34258929 CAAGAACACATATTCCTTCTTGG + Intergenic
972382905 4:38535955-38535977 CAAGATGACTATGTCCCTCTGGG + Intergenic
973078641 4:45962262-45962284 CCAGAAAACCATTTCCTCCTAGG + Intergenic
973154739 4:46936548-46936570 CCAGATCACTGTTTCTTTCTGGG + Intronic
973175348 4:47198585-47198607 CATGATCCTCATGTCCTTCTGGG - Intronic
974606370 4:64156963-64156985 CAAAATCATGTTTTCCTTCTAGG + Intergenic
974910051 4:68106943-68106965 CAAAATCACTATTACCATCTTGG + Intronic
974948829 4:68562841-68562863 CAAGATCACAATTTTTTTGTAGG - Intronic
975840844 4:78472196-78472218 CATGGTCAGCAGTTCCTTCTTGG - Intronic
977365455 4:96062578-96062600 CAAGATAACCATTTCTTCTTTGG + Intergenic
977448308 4:97160853-97160875 CAAGCTCACCTTTTACTACTAGG + Intergenic
977512009 4:97973624-97973646 CAAAATCACTTTTTCCTCCTAGG - Intronic
980101309 4:128543883-128543905 CAAATTCACCATTTCCATGTTGG + Intergenic
981643000 4:146967066-146967088 CAAAACCACTTTTTCCTTCTAGG - Intergenic
982123905 4:152168033-152168055 CAGGGTTACCATTTGCTTCTTGG + Intergenic
982482947 4:155934085-155934107 CAAAACCACTTTTTCCTTCTGGG - Intronic
982561976 4:156940197-156940219 CAAGATCAGCCTTTCCTTCCTGG + Intronic
983359283 4:166708180-166708202 CAAGTTCAATATTTCCTTATTGG + Intergenic
985081128 4:186265082-186265104 CAAAACCACCCTTTCCTTCAGGG + Intergenic
987230133 5:15885331-15885353 AAAGATGACTACTTCCTTCTTGG - Intronic
988204415 5:28115586-28115608 CAAAACCACTTTTTCCTTCTGGG + Intergenic
989234793 5:39134230-39134252 CAACATCATCATATACTTCTTGG + Exonic
990286804 5:54308905-54308927 CAATGTCACCCTTTCCTACTTGG + Intronic
991405699 5:66299449-66299471 TAAGATTTCCATTTCCTTGTTGG + Intergenic
991953986 5:71973857-71973879 CAAGTCCACCATTTCCATGTAGG + Intergenic
993248760 5:85487289-85487311 CAAGAATACCATCTTCTTCTGGG - Intergenic
993430986 5:87831726-87831748 CAAAACCACTTTTTCCTTCTAGG + Intergenic
994351683 5:98753224-98753246 CAAGATTAAGATTTCCTTCGGGG + Intergenic
995074510 5:107966392-107966414 CAAGAGCATCATTTCCTGCCAGG + Intronic
995342559 5:111075488-111075510 CAAGATCACAAGTTCCTCATGGG - Intronic
997446118 5:133941601-133941623 CAGGGTCACCTTTCCCTTCTGGG + Intergenic
1001342504 5:170861219-170861241 CAAGTTCAGCATTTCCATTTGGG - Intergenic
1001503726 5:172259664-172259686 AAAGATCACTTTTGCCTTCTAGG - Intronic
1002379298 5:178814161-178814183 CAAGATCAGCGTTTCTTTGTGGG + Intergenic
1003054710 6:2807659-2807681 AGAGATTTCCATTTCCTTCTAGG - Intergenic
1003814434 6:9822004-9822026 CAAAATTCCCATTTGCTTCTTGG - Intronic
1004952513 6:20689653-20689675 CAAAAACACCATTTACCTCTAGG - Intronic
1004991755 6:21146365-21146387 CAAAAACACCCTTTCCTCCTGGG - Intronic
1005011573 6:21340809-21340831 TCAGATCAGCATTTCCTCCTAGG + Intergenic
1008024792 6:46623068-46623090 CAAGATCACCATTTCCTTCTTGG - Intronic
1009298090 6:61980105-61980127 GAAGATCATCATTTGCTACTTGG + Intronic
1009486986 6:64236556-64236578 CAAGTTCTCCATATCCTTGTTGG + Intronic
1009503125 6:64442571-64442593 CAAAATCACATTTTCCTTCTAGG - Intronic
1010862143 6:80926208-80926230 CAACATCACCATTTCCCACTAGG + Intergenic
1011136444 6:84105722-84105744 CAATATCATAACTTCCTTCTTGG + Intergenic
1014377950 6:120700333-120700355 AACCATCACCATTGCCTTCTCGG - Intergenic
1014820715 6:125986145-125986167 AAATTTCACCATTTCCTTGTAGG - Intergenic
1015016558 6:128419915-128419937 CAAGATCAACTCTTTCTTCTTGG + Intronic
1015762483 6:136679776-136679798 CAAAACCACAATTTTCTTCTGGG + Intronic
1016122722 6:140363976-140363998 CAAAATCACGTTTTCCTCCTAGG - Intergenic
1016202611 6:141430498-141430520 CGAAATCACTTTTTCCTTCTGGG + Intergenic
1016593211 6:145768834-145768856 GAAGATCACTATTTTTTTCTGGG - Intergenic
1017727718 6:157287238-157287260 CAAGACCACCACCTCCTCCTCGG + Intergenic
1017942573 6:159066095-159066117 TAGGATCACCATGTGCTTCTGGG - Intergenic
1018846007 6:167556521-167556543 CAAGACCACCATGTTCTGCTTGG + Intergenic
1021155539 7:17205259-17205281 CAAAATCAGTATTTCCTCCTGGG + Intergenic
1022678349 7:32521796-32521818 CAAAACCACTTTTTCCTTCTGGG - Intronic
1023506879 7:40909184-40909206 CAAAATCAACAGTTCCTTCTCGG + Intergenic
1024799340 7:53058162-53058184 CAAGATTGCCATTTTCTGCTGGG + Intergenic
1026689568 7:72540211-72540233 CAAGATCAGCATTTCATATTTGG + Intergenic
1028249733 7:88526486-88526508 CAAAATCACTTTTTCCTCCTGGG + Intergenic
1029925841 7:104315965-104315987 CAAGGTCATCATTTATTTCTGGG - Intergenic
1030070236 7:105692071-105692093 CAATATCTACATTTCCTTCAAGG - Intronic
1030118410 7:106081928-106081950 CAAGATCAACCTTTCCTCTTGGG + Intergenic
1030439917 7:109576122-109576144 CAAAATCAGAATTTCCTTCCAGG + Intergenic
1031696286 7:124859077-124859099 CCAGGACACCATTTCCATCTTGG - Exonic
1033525074 7:142203891-142203913 CATGAAGAGCATTTCCTTCTAGG - Intronic
1034328205 7:150257477-150257499 CTATATTAGCATTTCCTTCTTGG - Intronic
1034363179 7:150520342-150520364 CAAGATGACCATGTGCTTCATGG - Exonic
1034765011 7:153711987-153712009 CTATATTAGCATTTCCTTCTTGG + Intergenic
1034830329 7:154303174-154303196 TCAGATCACCCTGTCCTTCTGGG - Intronic
1036457747 8:8924525-8924547 CAGAATCACTTTTTCCTTCTGGG + Intergenic
1036550697 8:9812967-9812989 CAGGATCACCTTTGCCTACTTGG - Intergenic
1038457902 8:27689821-27689843 CATGAGCACAACTTCCTTCTAGG + Intergenic
1039073107 8:33663889-33663911 TAAGATCCCCATTTCCTTGCTGG - Intergenic
1039802863 8:40975100-40975122 CAAGAGCAGCCTTTCCTTGTAGG - Intergenic
1041582265 8:59474909-59474931 AAAAATAACCATTTCCTTATGGG + Intergenic
1041969169 8:63717386-63717408 CAATAACTACATTTCCTTCTGGG + Intergenic
1043582953 8:81734652-81734674 AAAATTGACCATTTCCTTCTAGG + Intronic
1044147293 8:88732935-88732957 CAGCATCACCAGTTCCTTGTGGG - Intergenic
1045925077 8:107573197-107573219 TAATATCATCATCTCCTTCTTGG - Intergenic
1046052933 8:109044882-109044904 CAAAACCACTTTTTCCTTCTAGG + Intergenic
1046129234 8:109946525-109946547 CAAAACCACCTTTTCCTCCTGGG - Intergenic
1047628019 8:126677050-126677072 CAAAACCACTTTTTCCTTCTGGG - Intergenic
1048621551 8:136138698-136138720 CAAAATCAGCATTTCCATCTTGG - Intergenic
1049680821 8:143917262-143917284 GGAGATCACCATCTCCTCCTCGG - Exonic
1050085404 9:1959856-1959878 CAAAGTCTCCATCTCCTTCTGGG - Intergenic
1051431987 9:16988661-16988683 CATTCTCACCACTTCCTTCTTGG - Intergenic
1052007075 9:23361341-23361363 CAAAATCACTTTTTCCTCCTAGG + Intergenic
1052619846 9:30892279-30892301 CCAGATCACCAATTGATTCTTGG + Intergenic
1053127276 9:35592400-35592422 CTAGATCACCATCTCCTTTTTGG - Intergenic
1055511780 9:77002252-77002274 CAAGATCAATATTTTCTTCAGGG - Intergenic
1056040105 9:82656765-82656787 GCAGGTCACCATTGCCTTCTGGG + Intergenic
1056090493 9:83200668-83200690 CAAAATCACCTCTTCCTTCCTGG - Intergenic
1057664825 9:97037188-97037210 CAATGACACCAATTCCTTCTTGG + Intronic
1058869484 9:109190151-109190173 CAAGATCTCCAGTTCCCTGTTGG + Intronic
1061355412 9:130100948-130100970 CATGAGCACCACTTCCTTCAGGG - Intronic
1186539256 X:10383350-10383372 CAACAAGACCATTCCCTTCTGGG + Intergenic
1186965448 X:14781926-14781948 CATGACCAACATTTCTTTCTGGG - Intergenic
1188120671 X:26303295-26303317 TAAAATCACCACTTCCTTATGGG - Intergenic
1188625682 X:32281976-32281998 TAAAATCAGTATTTCCTTCTTGG - Intronic
1189497749 X:41524814-41524836 CAAGATAATCATATCCTCCTGGG - Intronic
1189806778 X:44743179-44743201 TAAGATCCCCATTTCCTTGCTGG - Intergenic
1189956321 X:46278291-46278313 CCAGAACACCATTACCTTCTCGG - Intergenic
1194216359 X:91134613-91134635 CAAAATCACTTTTTCCTCCTAGG - Intergenic
1194297347 X:92143367-92143389 CAAAACCACTTTTTCCTTCTGGG - Intronic
1194377333 X:93152059-93152081 CGAAATCACTTTTTCCTTCTGGG + Intergenic
1194455409 X:94096788-94096810 CAAGAGTACCATTTGCTTCAAGG - Intergenic
1195175386 X:102310433-102310455 CCAGATCCCCATTTCCTTCAAGG - Intronic
1195183478 X:102376660-102376682 CCAGATCCCCATTTCCTTCAAGG + Intronic
1196120076 X:112040516-112040538 GAATATGACCATTTCCTGCTTGG + Intronic
1196314191 X:114203302-114203324 CAAGGTCACAACTTCTTTCTGGG + Intergenic
1198048200 X:132923429-132923451 CAAGAGCAACACTTTCTTCTTGG + Intronic
1198536434 X:137591173-137591195 GAAATTCTCCATTTCCTTCTGGG - Intergenic
1199001775 X:142647375-142647397 CAAGGTCCCCATTTCCTTGCTGG - Intergenic
1199354679 X:146848298-146848320 CCACATCGCCATTTCTTTCTGGG - Intergenic
1199505409 X:148555600-148555622 CAATATCAGCATTTCTTTTTTGG + Intronic