ID: 1008026325

View in Genome Browser
Species Human (GRCh38)
Location 6:46640218-46640240
Sequence CTGTAGATTTTGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008026325_1008026330 24 Left 1008026325 6:46640218-46640240 CCCTTCTCCCTCAAAATCTACAG 0: 1
1: 1
2: 2
3: 18
4: 280
Right 1008026330 6:46640265-46640287 TACATATCCCAGCATTTCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008026325 Original CRISPR CTGTAGATTTTGAGGGAGAA GGG (reversed) Intronic
901940060 1:12655238-12655260 CTGTAGTTTTTGGAGGATAAGGG + Intronic
903685921 1:25131947-25131969 CTGTAGAGTTTTGGGGAGATGGG - Intergenic
904056189 1:27671932-27671954 TTGGAGATTTTTAGGGAGATGGG - Intronic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904935416 1:34126555-34126577 GTGTAGATTTTGAAGCAAAATGG - Intronic
907940258 1:59080707-59080729 CTGCAAATTTAGAGGGGGAAAGG - Intergenic
908107098 1:60856236-60856258 CTGTTGTTTCTGAAGGAGAAGGG + Intergenic
908171634 1:61510981-61511003 CTCTTGATTTTGAGGTATAATGG + Intergenic
908674280 1:66584944-66584966 CTTTTTGTTTTGAGGGAGAAGGG - Intronic
909777085 1:79494714-79494736 CTGTAGGATTTGAGTAAGAAGGG + Intergenic
910487057 1:87726480-87726502 CTGGAGTTTATGAGGGATAATGG + Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
913245828 1:116869250-116869272 CTATGGATTTGGAGGGGGAAAGG + Intergenic
913921217 1:124834795-124834817 TTGGAGATTTTGATGGAAAAGGG + Intergenic
913927054 1:124906991-124907013 TTGAAGATTTCGATGGAGAAGGG + Intergenic
914463146 1:147903211-147903233 TTGTAGAATTTGAGTGAAAAGGG - Intergenic
916827092 1:168452902-168452924 CTGTGTATGTTGAGGAAGAAGGG - Intergenic
917215847 1:172677235-172677257 CTGTAAATTTAAAGGGGGAAAGG - Intergenic
917254427 1:173099136-173099158 CTGTAGATTTTTAAGAAGATGGG - Intergenic
918297321 1:183169262-183169284 GTTTGGAGTTTGAGGGAGAAGGG + Intergenic
918825049 1:189313595-189313617 CTGTAAATTTCGAAGGGGAAGGG - Intergenic
920331250 1:205210416-205210438 CTTTAGATTGGAAGGGAGAAGGG - Intronic
923221952 1:231903409-231903431 CTGTAGATTTACATGGAGTAAGG + Intronic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
924268091 1:242302983-242303005 CTGGATATTTTGATGGAGTAGGG + Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1064128443 10:12685717-12685739 CTGGAGAGATTGAGAGAGAAAGG + Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1065974134 10:30827865-30827887 TTGGGGATTTTGACGGAGAAAGG + Intronic
1066226482 10:33388224-33388246 CGGCAGATTTTGAGCGATAAAGG + Intergenic
1066486969 10:35855677-35855699 CTGTATATTTAAAGGGGGAAAGG - Intergenic
1066526662 10:36287334-36287356 CTTTAAATGTTGGGGGAGAATGG - Intergenic
1066716814 10:38295758-38295780 CTGGATATTTTGATGGAGTAGGG - Intergenic
1067920199 10:50447926-50447948 CTGTGGAATTTGGGGGTGAAGGG - Intronic
1068253798 10:54480521-54480543 CTATATATTTTGAAGTAGAATGG - Intronic
1068801713 10:61148242-61148264 CCGTATAGTTTGAGGTAGAAGGG - Intergenic
1069819545 10:71218810-71218832 CTCTAGAGTTTGCTGGAGAAGGG + Intronic
1070088260 10:73257625-73257647 GTGTAGATTTGGAGGAAGTAAGG - Intronic
1071287161 10:84159457-84159479 GTGCAGATTTTGACAGAGAAAGG - Intergenic
1072191620 10:93080800-93080822 CTGTCAGTTTTGAGGGAGCAGGG + Intergenic
1072392376 10:95000299-95000321 ATGAAGATTTAGAGGGAGATGGG + Intergenic
1073676047 10:105648182-105648204 CTGCATTTTTTGAGGAAGAAAGG - Intergenic
1077947282 11:6914197-6914219 CTGTAATCTTTGAGTGAGAAAGG - Intergenic
1079549800 11:21680855-21680877 ATGTAGATTTTTAGAGAGATTGG + Intergenic
1080284534 11:30594087-30594109 TTGTAGAATTTAAGAGAGAAGGG + Intergenic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1086869741 11:92022743-92022765 CTTTGAATTCTGAGGGAGAAGGG - Intergenic
1089969246 11:122679168-122679190 CTGGACATGTTGAGGGTGAAGGG + Intronic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1092289404 12:7150301-7150323 CTGTAGGTTCTGAGGAGGAATGG - Intronic
1093672252 12:21891016-21891038 TTGAAGTTTTTGAGAGAGAAGGG - Intronic
1094313869 12:29115905-29115927 CTGTAGTCTTTCAGGGTGAAAGG - Intergenic
1097180443 12:57168782-57168804 CTCTAGTTTTGGAGGGAGAGAGG - Intronic
1097495081 12:60321871-60321893 ATATAAATTTTGAGGGGGAAAGG - Intergenic
1097751232 12:63355315-63355337 CTGTAGATTTAGAGTGAGATTGG - Intergenic
1100724494 12:97394703-97394725 CTGGAGGTTTTGAGGCTGAAGGG - Intergenic
1101497971 12:105273741-105273763 CTGTATATTTTAAGAGGGAATGG - Intronic
1101846753 12:108369055-108369077 CTGGAGACTTGGAGGGAGAGGGG - Intergenic
1102802322 12:115747030-115747052 GTGTATATTTGGAGGGAGATAGG + Intergenic
1103215239 12:119196681-119196703 CTGTAGGGTGGGAGGGAGAAGGG + Intronic
1103429149 12:120867033-120867055 TTGTAGAGTTTGAGAGATAATGG - Intronic
1106537087 13:30655495-30655517 CTTAAGATTGTGAGGGATAAAGG - Intronic
1106711930 13:32346243-32346265 CTGTATCTTTTGAGTAAGAAAGG - Intronic
1107421923 13:40255207-40255229 CTGTTGCTCTTTAGGGAGAAAGG + Intergenic
1107617741 13:42188795-42188817 CTTTTGATTTAGAGGGACAATGG - Intronic
1107919991 13:45196461-45196483 GAATAGATTTTGAGGGAGAAGGG + Intronic
1108035624 13:46287547-46287569 ATGTAGAGCATGAGGGAGAAAGG + Intergenic
1108940149 13:55942967-55942989 CTGTAATTTTTAAGGGAGCATGG - Intergenic
1111287389 13:86112680-86112702 GTGGAGATATTGAGGGAGAGAGG - Intergenic
1111797045 13:92935064-92935086 ATGAGGATTTGGAGGGAGAAGGG + Intergenic
1111807954 13:93061614-93061636 CTGATGATTTTGAGGGAGAAGGG + Intergenic
1114402069 14:22419235-22419257 ATGGAGATTATGGGGGAGAATGG + Intergenic
1114996249 14:28355717-28355739 ATGTGGATTTTAAGGGTGAAGGG - Intergenic
1116357291 14:43945475-43945497 CTGTAGATTTTAAGAGACAGTGG + Intergenic
1117513227 14:56473497-56473519 CTATAGAGTGTGAGGGAGAGAGG - Intergenic
1118381613 14:65222267-65222289 CAGGATAGTTTGAGGGAGAAAGG + Intergenic
1120732870 14:88022685-88022707 CTGTAGATTTTTCTGGATAAAGG + Intergenic
1122004893 14:98694657-98694679 CTGAAGACTTTGAGGAAGAGAGG - Intergenic
1122359225 14:101149488-101149510 CTGTTGCTTTTGGGGGAGAGGGG + Intergenic
1123195640 14:106613607-106613629 CTTTTGCTTTTGAGGGAGTAAGG + Intergenic
1124438158 15:29667977-29667999 CTGTACAGTTTTAAGGAGAATGG - Intergenic
1125104951 15:35959881-35959903 GTGTATATTTTGAGAGAAAATGG + Intergenic
1125148702 15:36505589-36505611 CTGTAGAGAGTGAGAGAGAAAGG - Intergenic
1125364609 15:38900571-38900593 ATGTGGAATCTGAGGGAGAAAGG + Intergenic
1127209310 15:56756686-56756708 TTGCAGATATTGAGGGACAATGG - Intronic
1127720547 15:61694781-61694803 ATGTAGATTTTGAGGGGGATGGG - Intergenic
1129379932 15:75158470-75158492 CTGAAGAGTCTGAGGGAGACAGG - Intergenic
1131057441 15:89383974-89383996 CTGGAGTTTCTGAGGGGGAAAGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1133842824 16:9425435-9425457 CTATACATTTTAAGGGTGAATGG + Intergenic
1134326096 16:13209282-13209304 CATTTCATTTTGAGGGAGAAAGG + Intronic
1135718514 16:24794171-24794193 ATATATATTTTTAGGGAGAATGG - Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137242852 16:46672985-46673007 CTGTAGATATTGAGGCATATTGG + Intronic
1138451658 16:57096874-57096896 CAGTAGAGTTGTAGGGAGAATGG + Intronic
1138897142 16:61220513-61220535 CTGTACATGTTGGGGGAGGAGGG + Intergenic
1143792456 17:9308381-9308403 TTCTACGTTTTGAGGGAGAAAGG + Intronic
1143852237 17:9821728-9821750 CTGTAGATTCTGGGGAAGACAGG - Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1145121305 17:20262674-20262696 CTGAAGCTTTTGAGGGAGGTGGG + Intronic
1146019165 17:29261073-29261095 CTGTGTATTTTGTGGGAAAAGGG + Exonic
1146496292 17:33325429-33325451 ATGGAGATCTTGAGGCAGAAAGG + Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147151004 17:38513772-38513794 TAGTAGACTTTGAGTGAGAATGG + Intergenic
1149324880 17:55519803-55519825 CTCAGGATTTTGATGGAGAAAGG + Intergenic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1152859887 17:82690212-82690234 CTGCAGAATTGGAGGGAGCACGG + Intronic
1152859917 17:82690450-82690472 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859927 17:82690530-82690552 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859939 17:82690610-82690632 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152878858 17:82804065-82804087 CTGTAGAGTTTAGGGGAGAGTGG + Intronic
1152878870 17:82804106-82804128 CTGTAGAGTTTAGGGGAGAGTGG + Intronic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1155959037 18:31978299-31978321 CTGTAGTTTTTAGGGGATAAAGG + Intergenic
1156579105 18:38354828-38354850 GAGTAGTTGTTGAGGGAGAAGGG + Intergenic
1157210351 18:45736863-45736885 CTGTAGATGTTTAGGGGAAAAGG - Intronic
1158107004 18:53897086-53897108 TCATAGATTTTGAGGCAGAAAGG - Intergenic
1158245782 18:55430695-55430717 TTGTGGATGTTGAGGGAGACAGG + Intronic
1158633275 18:59134503-59134525 CTCTAGAGTTTGTGGGAAAAAGG + Intergenic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1164090272 19:21945266-21945288 CAGTACATCTTGAGAGAGAAGGG - Intronic
1164488776 19:28687060-28687082 TTATAGAATCTGAGGGAGAAAGG - Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166710530 19:44934293-44934315 GGGTTGATTTTGGGGGAGAAGGG - Intergenic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
925549569 2:5057275-5057297 CCTCAGATTTTGAGGGAGAAGGG + Intergenic
925640446 2:5981617-5981639 CTGTATATTTGGAGAGAGAGAGG + Intergenic
926081802 2:9993223-9993245 CTGAAGAATTGGAGGGTGAAGGG + Exonic
927011651 2:18910625-18910647 CTGCAGATTTGGTGGTAGAAGGG + Intergenic
927678210 2:25122452-25122474 GTGTAGATTTTGATGGTTAATGG - Intronic
927981049 2:27375461-27375483 GGGTAGATTAGGAGGGAGAATGG - Intronic
928187029 2:29119870-29119892 CTATAGATTATGAGGCAGAATGG - Intronic
928619910 2:33077980-33078002 TTGTAGATTTTGAGGTTGAGTGG + Intronic
928639254 2:33280753-33280775 CTTAAGCATTTGAGGGAGAAAGG - Intronic
930568430 2:53053008-53053030 CTGTAGACTTTGAGTGATAATGG - Intergenic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
932342563 2:70975552-70975574 CAGGTGATTTTGAGGGAGAAGGG - Intronic
935380453 2:102446459-102446481 CTTTAGAGACTGAGGGAGAAGGG - Intronic
935825400 2:106943091-106943113 GTCCAGATTTTGAAGGAGAAAGG - Intergenic
935935505 2:108178035-108178057 CAGCAGCATTTGAGGGAGAAAGG + Intergenic
939034939 2:137119715-137119737 CTGTAGATTTTTAAACAGAAAGG + Intronic
939282361 2:140080589-140080611 CTGTAGATGATGAGTGAGAATGG + Intergenic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
941484012 2:166056153-166056175 CTGTAGATTTTAAAGAAAAAGGG + Intronic
941588120 2:167384931-167384953 CTGATGATTTGGAGGGAGATGGG - Intergenic
941591204 2:167422621-167422643 CTGGAGATTGGGAGGGAGAGTGG + Intergenic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
942362492 2:175187140-175187162 ATGTAAATTTGGGGGGAGAATGG - Intergenic
942524506 2:176839030-176839052 CAGGAGATATTGAGAGAGAAAGG + Intergenic
943024140 2:182608203-182608225 TTTTAGATTTTCAGGGAAAAGGG - Intergenic
944032383 2:195251144-195251166 CTGTGGAATTAGAGAGAGAAAGG + Intergenic
944627208 2:201583336-201583358 CTGTAGATGTGATGGGAGAAGGG - Intronic
946003169 2:216499818-216499840 GTTTTGTTTTTGAGGGAGAAAGG + Intronic
946622999 2:221578681-221578703 CTTTAGATTATGATGGGGAAAGG - Intergenic
946944734 2:224808973-224808995 CTGAAGTATTTGAGGGAGCAAGG + Intronic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1170769028 20:19316313-19316335 CTGTAGAGCTGGAGTGAGAAGGG + Intronic
1170812056 20:19681691-19681713 TTGTATATTCTGAGGGGGAATGG + Intronic
1172579826 20:36038040-36038062 ATGTACATTTAGAGAGAGAATGG + Intergenic
1172824261 20:37767099-37767121 GTGTGAATTTTGAAGGAGAAAGG - Intronic
1173242129 20:41306453-41306475 CTGTAGGCTTTGGGGAAGAAAGG - Intronic
1173581292 20:44148664-44148686 CCTTAGATTGTGGGGGAGAAGGG - Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1176902058 21:14454280-14454302 CTGTATATTTTTAGGTACAAAGG + Intergenic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1181504859 22:23346496-23346518 ATGTAAATTTTCAGGCAGAATGG - Intergenic
1181709847 22:24676741-24676763 ATGTAAATTTTCAGGCAGAATGG - Intergenic
1182642434 22:31779100-31779122 TTGTAGATTTGTAGGGTGAAGGG - Intronic
1182943259 22:34298422-34298444 CTGTAGGTTTTTAGGGTGTAAGG + Intergenic
1184665442 22:45986651-45986673 CTGAAGATTTTGAGAGAGGGGGG + Intergenic
1184811123 22:46832875-46832897 CTGTGGAATGTGAGGAAGAAGGG + Intronic
949723995 3:7023013-7023035 CAGTAAATCATGAGGGAGAATGG + Intronic
950321408 3:12058004-12058026 ATGTAGATTCTGATGGAGAAGGG - Intronic
954590041 3:51775444-51775466 CCATAGATTTTGAGAGTGAAAGG - Intergenic
955655475 3:61240564-61240586 CTGTAAATTTTGAGGTATTATGG + Intronic
955672889 3:61420425-61420447 CTGTAAACTTGGAGAGAGAAGGG - Intergenic
955821702 3:62902709-62902731 ATGAAGATTTTGCGTGAGAAAGG - Intergenic
955861157 3:63332166-63332188 CTGAAGTTTCTGAGGCAGAAAGG - Intronic
956295210 3:67704814-67704836 ATGTAAACTTTGTGGGAGAAGGG + Intergenic
956864142 3:73352815-73352837 CTGTAAAATTTAAGGGAGAGGGG - Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
960319372 3:116215705-116215727 GAGTTGATTTTGAGGGAGATAGG + Intronic
960410211 3:117314003-117314025 GTGGAGATATTGAGGCAGAATGG + Intergenic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
962282759 3:134064790-134064812 GTGTACATTTTGAAAGAGAAGGG + Intergenic
963693463 3:148535056-148535078 CTGTAGAGTTGGATGGAGGAGGG + Intergenic
964045601 3:152321715-152321737 CTTTAAAATTTGATGGAGAAAGG - Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
967041701 3:185699301-185699323 CAATATATTTTGAGGAAGAAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967953070 3:194855646-194855668 CTGTAGATTTTTAGAGAGTTAGG + Intergenic
971976095 4:33689378-33689400 CTGGATATTTTTAGGGACAATGG - Intergenic
972722328 4:41712720-41712742 CTATAGATATTCTGGGAGAAAGG - Intergenic
972906890 4:43761001-43761023 TTGTAGATTTTGAAGATGAATGG - Intergenic
973550845 4:52034621-52034643 CCATAGATATTGAGGGACAACGG + Intronic
974501906 4:62716000-62716022 TTGTTGATTTTGAGGAAGAAAGG + Intergenic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976711439 4:88075622-88075644 CTGTAGATTGGGAGGAAGATGGG - Exonic
978196682 4:105980264-105980286 CTATATAATATGAGGGAGAATGG - Intronic
980499482 4:133629836-133629858 ATGTAGAGTATGAGGGAGAAAGG + Intergenic
980720021 4:136683395-136683417 CTGTTGATTTTTAGGTAGAGAGG - Intergenic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
984691852 4:182735084-182735106 CTGTAGGTTGTTAGGGTGAATGG - Intronic
986038473 5:3963249-3963271 CTTTGGATTTTGAGGGAGAAGGG + Intergenic
987442231 5:17969695-17969717 CACTAGATGTTGAGGGAGACTGG - Intergenic
988961459 5:36375487-36375509 CTGTAAATTGAGAGGCAGAAAGG - Intergenic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
991293971 5:65061662-65061684 CTGTGGAGTGTGAGGGGGAAGGG - Intergenic
991388729 5:66119089-66119111 ATCTAGATTTTGAGGGTGATGGG - Intergenic
992220501 5:74567450-74567472 TTGTGGATTGTGAGGGAGAATGG - Intergenic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
992883206 5:81131002-81131024 CTATATATTTTGATGGAGATGGG - Intronic
999942923 5:156563911-156563933 CTGAAGAACTTGAGGGAGTAGGG - Intronic
1000287847 5:159843080-159843102 CTGAGGATATTGAGGGACAACGG + Intergenic
1000422329 5:161053051-161053073 ATGTTGATGTTGAGAGAGAATGG + Intergenic
1001284742 5:170414767-170414789 AAGTAGATTTTGATAGAGAAGGG - Intronic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002724668 5:181286572-181286594 CAGTAGGTTTAGAGGGAGAGTGG - Intergenic
1003075920 6:2983508-2983530 AAGTGGATTTTGAGAGAGAAGGG + Intergenic
1003348385 6:5292702-5292724 CTGGAGCTTTTAAGGGAGACTGG + Intronic
1006562809 6:34928161-34928183 CTGTAAATCTTGATGGAGATTGG + Intronic
1006645628 6:35512497-35512519 CTGGAGATCTGGGGGGAGAAAGG - Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008525061 6:52399348-52399370 CTGTCTGTTCTGAGGGAGAAAGG - Intronic
1008585582 6:52945449-52945471 CTGTAGATTTTGAAAGACCATGG - Intergenic
1010531261 6:76970177-76970199 TTGTATATTTTGAAGGGGAATGG - Intergenic
1011009035 6:82682821-82682843 CTCTGGATTTTGGGGCAGAAGGG + Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1013849573 6:114497606-114497628 CTCAATATTTGGAGGGAGAAGGG + Intergenic
1014290977 6:119558311-119558333 CCCTAGTTTTAGAGGGAGAAAGG + Intergenic
1014336093 6:120139470-120139492 CTGTTGACTTTGAAGTAGAAGGG + Intergenic
1014684314 6:124477339-124477361 CTGGACATTGGGAGGGAGAAGGG + Intronic
1016196502 6:141349650-141349672 CTATAGATTTTGTGGTAGCATGG - Intergenic
1016581598 6:145634366-145634388 AGGTAGATGTGGAGGGAGAAAGG - Intronic
1017331538 6:153204434-153204456 GTGTAGATGTGGAGTGAGAAAGG + Intergenic
1020499367 7:8896785-8896807 CTATAGATTATGTGGGAGACAGG + Intergenic
1020690951 7:11353877-11353899 CTGTAAGTTTTGAGGGAGCAAGG + Intergenic
1020827484 7:13048345-13048367 CTATAGTTTTGGAAGGAGAAAGG - Intergenic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1028573996 7:92325556-92325578 GTTTAGATGTTCAGGGAGAAAGG - Intronic
1028847436 7:95497688-95497710 CTGTAGATGTAGAGGGGGAGAGG - Intronic
1030481137 7:110105156-110105178 CTACAGATTTTCAGGTAGAATGG - Intergenic
1030644612 7:112046194-112046216 GTGTAGATTATAAGGTAGAATGG - Intronic
1031149494 7:118036744-118036766 TTGTAGAGCTTGAGGGATAAAGG + Intergenic
1031694985 7:124839839-124839861 CTGTGGACTTTGAGTGATAATGG - Intronic
1031791720 7:126114876-126114898 CTGTCAATGCTGAGGGAGAAAGG - Intergenic
1032317972 7:130857799-130857821 CTGTAAATGTGGAGGAAGAAGGG + Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1034024880 7:147690049-147690071 CTGTAGACAATGAGGAAGAAAGG - Intronic
1035317092 7:158003047-158003069 CTGTGGATTTTGGGGGACACAGG - Intronic
1035861728 8:3036291-3036313 CTGAAATTTTTGAGAGAGAAGGG - Intronic
1036742821 8:11380484-11380506 CTATGGATTTTGAGTGATAATGG - Intergenic
1037736499 8:21571175-21571197 CTGTAGGTTTTGGAGGAGAGTGG - Intergenic
1042346593 8:67733785-67733807 CTGTAGAGTTTGTGGTAGGAAGG + Intronic
1043293161 8:78629335-78629357 CTGTGGATTTTTTGGGTGAATGG - Intergenic
1044770937 8:95633249-95633271 CTGTACATTGTGAAGGAGACAGG - Intergenic
1045892377 8:107172057-107172079 CGGTATATATTTAGGGAGAATGG + Intergenic
1045964773 8:108012439-108012461 CTTACTATTTTGAGGGAGAAGGG - Intronic
1046743334 8:117851330-117851352 TTTTAGATTTTGGGTGAGAATGG - Intronic
1047649834 8:126908706-126908728 CTATGGATGTTGTGGGAGAATGG + Intergenic
1048064277 8:130951593-130951615 CTTTACATTTTGAGTGGGAAAGG - Intronic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049489406 8:142886637-142886659 CTGTAGATTTTGGGGGTATATGG + Intronic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1050025938 9:1334691-1334713 CTGTATATTATGAGGAAGGAAGG - Intergenic
1050255872 9:3791298-3791320 CTGTAGATACTGAGAGAGAGAGG - Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1054803403 9:69375499-69375521 CTGGAGACTTTAAAGGAGAAAGG + Intronic
1055177262 9:73335508-73335530 CTGTTTATTTTGTGGGAGCAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057211085 9:93201487-93201509 CTGTAGAGCTTGTGGGAGCAGGG + Intronic
1057490880 9:95518410-95518432 GTCTAGAATATGAGGGAGAAAGG + Intergenic
1059880077 9:118678872-118678894 CTGTATTTTTTGGTGGAGAAGGG - Intergenic
1060020828 9:120129726-120129748 CTGCAGGTTTTGAGAGAGCAGGG - Intergenic
1060566812 9:124599947-124599969 CTGCAGATTTTGAGGCTGAAGGG + Intronic
1061436247 9:130564066-130564088 CTGTAGAATTTATGGGAGCAGGG - Intergenic
1203340125 Un_KI270320v1:4008-4030 CTGAAGACTTTGATGGAAAAGGG + Intergenic
1186709108 X:12174009-12174031 CTCTAAAGGTTGAGGGAGAAGGG - Intronic
1188990528 X:36813689-36813711 ATTTACATTTTGGGGGAGAAAGG - Intergenic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1189727857 X:43986515-43986537 CTTTAGAATTTAAGGGGGAAAGG + Intergenic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1190366045 X:49695760-49695782 GTGTGGCTTTTGAGGGAGAAGGG - Intronic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1192792893 X:74400467-74400489 CTGTGGACTTTGAGTGATAATGG + Intergenic
1193333941 X:80265271-80265293 CAGTAGAATTTGAGGCATAATGG - Intergenic
1194007256 X:88510399-88510421 CTGAAGATTTTAAGGGACAATGG - Intergenic
1195100182 X:101548375-101548397 CTGTATATTTGCAGGAAGAAAGG + Intergenic
1196917498 X:120552594-120552616 CTGTGGATTTTGGAGGGGAAGGG - Intronic
1197721642 X:129748970-129748992 TTGCAGATTTTAAAGGAGAAAGG + Intronic
1197986126 X:132268333-132268355 CTGAAGAATGTGAGGAAGAATGG - Intergenic
1198632998 X:138663019-138663041 CTCTAGACTTTGAGGGTGGAGGG - Intronic
1199084381 X:143611843-143611865 ATGAAGATAGTGAGGGAGAAAGG - Intergenic
1200337061 X:155361986-155362008 CTGGAGAGTTTTAGGGAGAGTGG + Intergenic
1200349409 X:155479241-155479263 CTGGAGAGTTTTAGGGAGAGTGG - Intergenic