ID: 1008027480

View in Genome Browser
Species Human (GRCh38)
Location 6:46653934-46653956
Sequence CTGACCTTCTTACAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008027475_1008027480 23 Left 1008027475 6:46653888-46653910 CCTACAATACCAGGGACTGTGGA 0: 1
1: 0
2: 0
3: 9
4: 267
Right 1008027480 6:46653934-46653956 CTGACCTTCTTACAGGCTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140
1008027476_1008027480 14 Left 1008027476 6:46653897-46653919 CCAGGGACTGTGGATATATATTT 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1008027480 6:46653934-46653956 CTGACCTTCTTACAGGCTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008027480 Original CRISPR CTGACCTTCTTACAGGCTGC TGG Intronic
901865842 1:12106230-12106252 CTGCCCTTCTTCCAGGTTGGAGG + Intronic
903558613 1:24211250-24211272 CTGAACTTCTTCCAGGTTTCTGG + Intergenic
906292072 1:44625898-44625920 CTGCCCTTAATACAGGCTGATGG - Intronic
906680254 1:47721438-47721460 CTGCCCTGGGTACAGGCTGCAGG - Intergenic
910004294 1:82377168-82377190 ATGCCCTTCTATCAGGCTGCTGG + Intergenic
911091203 1:94018779-94018801 CGTACCCTATTACAGGCTGCAGG - Intronic
913531727 1:119738422-119738444 CTGACCTCCTCGCATGCTGCTGG - Intronic
914721559 1:150293627-150293649 CTGACCTTCTCAGAGGCCGAAGG + Intergenic
915744340 1:158144571-158144593 CTGAACATCTTACAGCCTGAAGG - Intergenic
920664920 1:207956244-207956266 CTGACCATCTTACAGGTTGCTGG - Intergenic
921079726 1:211729415-211729437 TTCAGTTTCTTACAGGCTGCTGG + Intergenic
921818659 1:219592157-219592179 CTGGACTTCTTACACCCTGCTGG + Intergenic
1063375982 10:5554385-5554407 CTGACCTTCATCCTGGCTGGGGG - Intergenic
1066997215 10:42575362-42575384 CTGTCCTTCTTCCAGGCTCCTGG - Intronic
1071561694 10:86650629-86650651 CTGAGTTTCTAACAAGCTGCAGG + Intergenic
1073513418 10:104056902-104056924 CTGCCCTTCTGACAGGCAGTGGG + Intronic
1074677977 10:115874120-115874142 ATGCCCTTCTGACAGCCTGCTGG + Intronic
1075256996 10:120933226-120933248 CTGTCCTTCTTTCTGGCTGAGGG + Intergenic
1076250297 10:128979518-128979540 CCAACCTTCTGCCAGGCTGCAGG + Intergenic
1076918520 10:133439280-133439302 CTGATCTTCTTAAAAGCAGCCGG - Intergenic
1078534009 11:12159022-12159044 CTGAGCCTGGTACAGGCTGCTGG + Intronic
1083227833 11:61295611-61295633 CAGACCTTCTGGCAGGCTGGGGG - Intergenic
1083407820 11:62470988-62471010 CTGACGTTCTTTCAGCTTGCAGG - Intronic
1083895938 11:65619750-65619772 CTGAGCTTCCTGCAGGCTGCTGG - Exonic
1084285664 11:68128873-68128895 TTGGCCTTATCACAGGCTGCTGG - Intergenic
1089273155 11:117315522-117315544 CTGACCACCTTACCGTCTGCGGG + Exonic
1089282292 11:117382815-117382837 TTGCCCTTCTCACAGGCAGCAGG - Exonic
1090480741 11:127065996-127066018 CTGAGCTTTTTACTTGCTGCAGG - Intergenic
1091315299 11:134610258-134610280 CTGCCCTCCCTACAGCCTGCAGG + Intergenic
1091322566 11:134662642-134662664 CTGGCCTCCATGCAGGCTGCAGG + Intergenic
1091842111 12:3628643-3628665 CAAACATTCTTACAGGATGCAGG - Intronic
1092821279 12:12355886-12355908 GTCACCTACTTACAGGCTGCAGG + Intergenic
1093058106 12:14574876-14574898 CTGTCCTTTATACATGCTGCTGG + Intergenic
1094722880 12:33083242-33083264 AGGACCCTCTTCCAGGCTGCAGG - Intergenic
1096967935 12:55643431-55643453 CTGAGCCTCTTACAGTCTGCTGG - Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1105057572 12:133116544-133116566 ATCATCTTCTTACAGACTGCTGG + Exonic
1107299801 13:38953754-38953776 CTGTACTTCTTACAAGCTGTGGG - Intergenic
1108967359 13:56326307-56326329 CTGGCCTTCTTACAGGTACCAGG - Intergenic
1111015524 13:82376052-82376074 CTCACTTTTTTCCAGGCTGCTGG - Intergenic
1112248460 13:97755992-97756014 CTGTCCTCCTTACAGGATTCAGG - Intergenic
1118313569 14:64710027-64710049 GTCTCCTTCTTACATGCTGCAGG - Intronic
1118502879 14:66379632-66379654 CTGCCCTTATTTCTGGCTGCTGG - Intergenic
1118943784 14:70363280-70363302 CTGCCCTTCTAACAAGCTTCTGG + Intronic
1120928570 14:89823263-89823285 CTCATTTTCTTACAGGCTGTTGG - Intronic
1122083229 14:99281534-99281556 CTGCTTTTCTCACAGGCTGCTGG - Intergenic
1122343088 14:101041483-101041505 CTGGCCATCTAACAGGTTGCTGG - Intergenic
1131296820 15:91156542-91156564 CTAACCTGCTCCCAGGCTGCTGG - Intronic
1135255268 16:20936641-20936663 CTGACCTTCTTCCAGGTACCTGG - Exonic
1138548024 16:57730868-57730890 CTGACCTTCACCCAGGCTGCAGG - Intronic
1141816722 16:86415589-86415611 ATGACCTTTTTCCTGGCTGCTGG + Intergenic
1142612239 17:1115429-1115451 CTGAGCTTCATACAGTCTGGAGG - Intronic
1147880752 17:43651852-43651874 CTGACCTTCTTACAGCTCACGGG + Intronic
1151967249 17:77437819-77437841 CTGACTTTCTTACAGGGAGTGGG - Intronic
1161655227 19:5510297-5510319 CTGACCTTCTCCCTGTCTGCGGG - Intergenic
1164639931 19:29817265-29817287 CTGACCTCAGTACAGGCAGCGGG - Exonic
1166317684 19:41998180-41998202 CAGCCCTGCCTACAGGCTGCAGG - Intergenic
1168404152 19:56102257-56102279 CTGTTCATCTTGCAGGCTGCGGG - Intronic
1168646226 19:58060648-58060670 CTGACATTCCTACAGGAGGCTGG - Intronic
925063501 2:911395-911417 CCCATTTTCTTACAGGCTGCTGG - Intergenic
925121025 2:1418362-1418384 CTCACCTTCCTACAGTTTGCAGG - Intronic
926435314 2:12831529-12831551 CTGATCTGCTCACAGCCTGCTGG + Intergenic
926772666 2:16392349-16392371 CTGACCTCCTGACAAGCTGATGG + Intergenic
931981095 2:67694899-67694921 CTCTCCTTCTTGCAGGCAGCAGG - Intergenic
932437729 2:71712526-71712548 CTGAACTGCTGACAGGCTTCTGG + Intergenic
933674570 2:85042943-85042965 CTGACCTGGTTACAAGCTTCTGG + Intronic
933841573 2:86290890-86290912 GTGACTTTCTAACAGGCTGGAGG + Intronic
934035813 2:88087847-88087869 CTGCCCTTCCCACAGGCTGGCGG + Exonic
937131689 2:119518681-119518703 CTGACCTTCACTCAGGCTTCGGG - Intronic
938755540 2:134375882-134375904 TTCATCTTCTTCCAGGCTGCTGG + Intronic
939118978 2:138093196-138093218 CTGGCCTTCTTACTGGTTGGTGG + Intergenic
939294586 2:140243758-140243780 CTGGTCTTCTTTCAGTCTGCTGG + Intronic
942083349 2:172422410-172422432 CTCACCTTCTTCCCGGCTGAGGG - Intergenic
943949206 2:194108093-194108115 CTGACATTCTCACAAACTGCTGG - Intergenic
946819081 2:223611890-223611912 CTGAGCTTTCTGCAGGCTGCAGG + Intergenic
947200593 2:227611563-227611585 CTGACCTTCATTCACCCTGCGGG - Exonic
1170250983 20:14282464-14282486 CTGGGCTTCTTACAGCCTGATGG + Intronic
1170916319 20:20629583-20629605 CTGACTTTCTTCCAGACTGTTGG - Exonic
1172801491 20:37579390-37579412 CTGCCCTGCTTACAGGCCCCAGG - Intergenic
1172856117 20:38003906-38003928 CAGAAGTTCTTACAGGCTGGTGG - Intronic
1173018267 20:39246131-39246153 CTGGCCTGCTTGCATGCTGCAGG + Intergenic
1173248048 20:41349767-41349789 CTCACCTGCTGAGAGGCTGCAGG - Exonic
1173298135 20:41777499-41777521 CTGACTTTATTACAGGATCCAGG + Intergenic
1173451453 20:43167796-43167818 TTGAGTTTCTTGCAGGCTGCTGG - Intronic
1173470302 20:43318524-43318546 CTGTCCTTTTTACAGGGTGCTGG + Intergenic
1174190685 20:48738364-48738386 CTGCCCTTCCCACAGGCTGAAGG - Intronic
1175023207 20:55873531-55873553 CTGCCCAGCTTTCAGGCTGCAGG + Intergenic
1175097740 20:56555128-56555150 CTGGCCTTTTTCCAGGTTGCAGG - Intergenic
1175220699 20:57414884-57414906 GTCAACTTCTCACAGGCTGCTGG - Intergenic
1176661541 21:9639911-9639933 CTAACATTTTTGCAGGCTGCTGG - Intergenic
1178617509 21:34146641-34146663 TTGGCCTGCTTACAGGCTCCTGG + Intergenic
1178709248 21:34899774-34899796 TTGACCATCTTGCAAGCTGCTGG - Intronic
1178781092 21:35604047-35604069 CTGAATTTCCTAGAGGCTGCAGG - Intronic
1179494737 21:41764410-41764432 CTGGGCCTCTTCCAGGCTGCTGG - Intronic
1179571689 21:42282326-42282348 CTGACCACCTGACAGGCTCCCGG - Exonic
1180201057 21:46224488-46224510 CTGCCCTTCTTCCAGGGTGTAGG - Intronic
1181132174 22:20738463-20738485 CTGACCTCCTTACAGGGGTCTGG - Intronic
1181745734 22:24953664-24953686 CTGACCTTTTCACACCCTGCTGG + Intronic
1183668751 22:39259807-39259829 CTGGCCTTGTTCCAGGCTCCGGG - Intergenic
1184585182 22:45442972-45442994 CTGAGCTTCTTAAAATCTGCAGG + Intergenic
1184782907 22:46658035-46658057 CTGACCTTCCTCCAGGGTGCGGG - Intronic
951656615 3:25016365-25016387 CTGAACATCCTACAGTCTGCAGG - Intergenic
953381420 3:42475427-42475449 CTCACTTTCTTGCTGGCTGCTGG - Intergenic
961183107 3:124891624-124891646 CTGACATTCTGACATGCAGCTGG + Intronic
962232731 3:133679902-133679924 CTGAAATTCTTATATGCTGCTGG - Intergenic
968945740 4:3662713-3662735 CCGGCCTTCTTCCAGGCTGCAGG + Intergenic
970254747 4:14155637-14155659 ATGGCCTTCTCCCAGGCTGCAGG + Intergenic
971487730 4:27177139-27177161 CAGACCTTCTCCCAGGCTGCTGG - Intergenic
975537525 4:75467882-75467904 CAGACCTTCTTTCTGGCTGATGG + Intergenic
980658127 4:135816382-135816404 CTGCCCTTCTTACAAGGTTCAGG - Intergenic
985413854 4:189716636-189716658 CTAACATTTTTGCAGGCTGCTGG + Intergenic
986446538 5:7826002-7826024 CAGCCCCTCTTGCAGGCTGCTGG - Intronic
987441341 5:17960831-17960853 CTAACCTGCATACAGGCTGAGGG + Intergenic
989091339 5:37736204-37736226 CTGTCATTCTGTCAGGCTGCTGG - Intronic
990902543 5:60768641-60768663 CTGACATTCTTTCAGTCTGATGG + Intronic
1002318075 5:178357269-178357291 CTTCCCTTCTCACAGGCTTCTGG + Intronic
1003015326 6:2463090-2463112 CTGTGCTTCCTACAGGCAGCCGG + Intergenic
1003520946 6:6857643-6857665 TTGCATTTCTTACAGGCTGCTGG + Intergenic
1007380444 6:41487122-41487144 CTGCCATCCTTACAGGTTGCAGG - Intergenic
1008027480 6:46653934-46653956 CTGACCTTCTTACAGGCTGCTGG + Intronic
1009567023 6:65322488-65322510 CTGGACTTCTTACACCCTGCTGG - Intronic
1011852423 6:91646732-91646754 CTCAGCTCCTTGCAGGCTGCTGG - Intergenic
1014776697 6:125519235-125519257 CTGTCCTTCATCCATGCTGCTGG + Intergenic
1015460221 6:133482369-133482391 CTGAGCTCCTCACAGTCTGCTGG - Intronic
1015668446 6:135658801-135658823 CTGCCTTTCTAACAGGCTCCAGG - Intergenic
1017800526 6:157891733-157891755 CTGGCCTTCCCACAGCCTGCTGG - Intronic
1022961373 7:35429856-35429878 CTGAACTACTCCCAGGCTGCTGG - Intergenic
1032401958 7:131629955-131629977 CTGCTCTTCCTGCAGGCTGCGGG + Intergenic
1034269546 7:149796984-149797006 CTGCCCTTCTAACAAGCTCCAGG - Intergenic
1036711540 8:11082618-11082640 TTGACTTTCTCCCAGGCTGCAGG - Intronic
1037085857 8:14849201-14849223 CTGAACTTCTTACACTCTACTGG + Intronic
1037164427 8:15810009-15810031 CTGAATTTCTTACATGCTGTTGG + Intergenic
1037748289 8:21663412-21663434 CTGAGCTGCTCACAGGCTGGGGG - Intergenic
1038134771 8:24773432-24773454 CTGTCATCCTGACAGGCTGCAGG + Intergenic
1040707050 8:50141297-50141319 CTGAAGCTCTTACAGGTTGCTGG - Intronic
1044269201 8:90221154-90221176 CTGAAGTTCTAACAGGCTTCTGG - Intergenic
1047028068 8:120846408-120846430 ATGACCTTGTTTCAGGCTCCGGG + Intergenic
1050378740 9:5001554-5001576 CTGACCTTTTTATATGCTCCTGG + Intronic
1052695503 9:31872176-31872198 CTGACATTATTACAGGGTTCTGG + Intergenic
1053118811 9:35529888-35529910 CTGACCTTCTCAAAGCCAGCTGG + Intronic
1056929913 9:90865806-90865828 CTGACTTCCTAACAGGCTGGAGG - Intronic
1059786463 9:117591547-117591569 CTGACATTCTTAAAGTCTTCTGG + Intergenic
1060028085 9:120190101-120190123 CTCAACATCTGACAGGCTGCAGG - Intergenic
1060721814 9:125984584-125984606 CTGACCTGATGACAGGGTGCAGG - Intergenic
1203639104 Un_KI270750v1:141754-141776 CTAACATTTTTGCAGGCTGCTGG - Intergenic
1186840272 X:13478301-13478323 CTGACCATCTCAGAGCCTGCAGG + Intergenic
1186935854 X:14449686-14449708 CTGAACTGCTCCCAGGCTGCAGG - Intergenic
1192220083 X:69191906-69191928 GTGATCTTCCAACAGGCTGCGGG - Intergenic
1195610020 X:106855817-106855839 GGGGCATTCTTACAGGCTGCTGG - Intronic
1195943841 X:110188697-110188719 TTGACCTTCTCCAAGGCTGCAGG + Intergenic
1196661766 X:118278125-118278147 CTGAACTTCTCACAGGGTGATGG + Intergenic
1197829269 X:130624423-130624445 CTGGCCTTCTTACAGTCTGTTGG - Exonic