ID: 1008030401

View in Genome Browser
Species Human (GRCh38)
Location 6:46688141-46688163
Sequence GCCCCCGGCGCCGGCATTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030401_1008030406 -7 Left 1008030401 6:46688141-46688163 CCCGGAATGCCGGCGCCGGGGGC 0: 1
1: 0
2: 2
3: 13
4: 111
Right 1008030406 6:46688157-46688179 CGGGGGCCTCGCTGGCCCTGCGG 0: 1
1: 1
2: 2
3: 50
4: 382
1008030401_1008030407 -6 Left 1008030401 6:46688141-46688163 CCCGGAATGCCGGCGCCGGGGGC 0: 1
1: 0
2: 2
3: 13
4: 111
Right 1008030407 6:46688158-46688180 GGGGGCCTCGCTGGCCCTGCGGG 0: 1
1: 0
2: 4
3: 44
4: 397
1008030401_1008030409 6 Left 1008030401 6:46688141-46688163 CCCGGAATGCCGGCGCCGGGGGC 0: 1
1: 0
2: 2
3: 13
4: 111
Right 1008030409 6:46688170-46688192 GGCCCTGCGGGTGTCCTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 85
1008030401_1008030413 30 Left 1008030401 6:46688141-46688163 CCCGGAATGCCGGCGCCGGGGGC 0: 1
1: 0
2: 2
3: 13
4: 111
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030401 Original CRISPR GCCCCCGGCGCCGGCATTCC GGG (reversed) Exonic
901836250 1:11925957-11925979 GCCACCAGGGCCGGCACTCCAGG + Exonic
902736913 1:18407355-18407377 ACCCCCGGGGCCCGCATTCCAGG + Intergenic
902917685 1:19648498-19648520 GACCCCGGAGCTGGCCTTCCTGG + Intronic
906365421 1:45205971-45205993 GGCCCCGGCGCCGGCGCTGCTGG - Exonic
907255673 1:53176983-53177005 GCCCCCTGCACAGGCAGTCCTGG - Intergenic
909735978 1:78962165-78962187 GCCACCGGGCCCGGCCTTCCAGG + Intronic
910237006 1:85047434-85047456 GCCTCCCGCGCCGGCGCTCCGGG - Intronic
912717282 1:111991040-111991062 ACCCGCGGCTCCGGCTTTCCCGG + Intergenic
913578080 1:120197228-120197250 GCTCCGGGCGCCGTCTTTCCCGG - Intergenic
913630092 1:120701124-120701146 GCTCCGGGCGCCGTCTTTCCCGG + Intergenic
914559996 1:148808648-148808670 GCTCCGGGCGCCGTCTTTCCCGG - Intronic
914612837 1:149321567-149321589 GCTCCGGGCGCCGTCTTTCCCGG + Intergenic
921384070 1:214551807-214551829 GCCCCCGGCGCGCGCCCTCCCGG - Intronic
922503121 1:226110860-226110882 GCCCCAGGCCCCGCCATCCCCGG - Intergenic
923554157 1:234987537-234987559 GCCTCTGGGCCCGGCATTCCTGG + Intergenic
1069780755 10:70953931-70953953 GCCCCAGGTGCCTGCATTGCTGG + Intergenic
1070954386 10:80454634-80454656 GGGCCCGGGGCCGGCACTCCTGG + Intronic
1075262922 10:120978486-120978508 CCCCCCGGAGCCTGTATTCCAGG - Intergenic
1076258206 10:129045309-129045331 GCCCCCTGCTCCGGCTTCCCTGG + Intergenic
1076417202 10:130300578-130300600 GGCCCCGGGGCCCGCATGCCGGG + Intergenic
1081611290 11:44565111-44565133 GGCCCCCACGCTGGCATTCCAGG - Intronic
1083758749 11:64804720-64804742 GGCCCCGCCGCCGGCCTTCCCGG + Exonic
1083764404 11:64835179-64835201 GCCCCAGGCCCCAGCAGTCCTGG + Intronic
1083920858 11:65780892-65780914 GCCCCCGGCGCCGGCGGTAACGG + Intergenic
1089543663 11:119206280-119206302 GCCGCCGCCGCCGGCTATCCGGG - Exonic
1089556262 11:119317255-119317277 GGCCCCGGCGCCGCCAGCCCGGG + Intronic
1091405016 12:203707-203729 GCCCCCGGCTCGGCCATCCCGGG - Intronic
1101390355 12:104294239-104294261 CCCCCCGCCGCCGGCTTTCCCGG + Intronic
1104702268 12:130916008-130916030 TCCCACGGCGCCGGGATTACAGG + Intergenic
1122145083 14:99684193-99684215 GCCTCCGGCTCCGGCGCTCCGGG - Intergenic
1122418583 14:101561709-101561731 GCCCCCGGCGGCGGCGGCCCAGG - Exonic
1123505764 15:20940780-20940802 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123562998 15:21514486-21514508 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1123599245 15:21951769-21951791 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1126436714 15:48645117-48645139 GCCCCCGGCGGCAGCAGCCCCGG + Intronic
1126789134 15:52204691-52204713 GCCCTGGGCGCCAGCATCCCGGG + Intronic
1127877207 15:63121900-63121922 GCCCCCGGGGGCGGCAGCCCGGG - Exonic
1128374415 15:67065403-67065425 GACCCGGGCGGCGGCAGTCCTGG - Intronic
1130984242 15:88834372-88834394 GCCCCTGCCCCTGGCATTCCTGG + Intronic
1131056617 15:89378827-89378849 GCCCCCCGCGCCCGCACTCTGGG - Intergenic
1131096121 15:89655285-89655307 GCCCTGGGAGCCGGCACTCCTGG - Intronic
1202971350 15_KI270727v1_random:241621-241643 GCCCCCGCCGCGGGCAGCCCTGG - Intergenic
1132551779 16:556571-556593 GCCCCCGGGGCTGGCCTTCCTGG - Intergenic
1132654824 16:1037395-1037417 CCCCACGGCGTCGGGATTCCTGG - Intergenic
1132686247 16:1163317-1163339 TACCCCGGCGCCGGCCTCCCAGG - Intronic
1133286051 16:4691367-4691389 GCCCCGGGCGCCTGCCTTCCAGG + Intergenic
1134128304 16:11631354-11631376 GCCCCCAGCCCCGGGATGCCTGG - Intronic
1134531884 16:14989880-14989902 GCCACCAGGGCCGGCACTCCAGG + Intronic
1136277419 16:29187147-29187169 GGCCCCTTCGCCTGCATTCCAGG - Intergenic
1136683656 16:31981959-31981981 GCCCCCGCCGCCGCCAGCCCGGG - Intergenic
1139584503 16:67893270-67893292 GCCGCCGCCGCCGCCATTCTCGG - Exonic
1139806216 16:69566686-69566708 GCCGCCGGCCCCGGCCTCCCGGG + Intronic
1143551228 17:7631608-7631630 GCTGCCTGCGCCGGGATTCCTGG + Exonic
1145979985 17:29005662-29005684 GCCCCCGGCGCCGGCCAAGCCGG - Intronic
1147134734 17:38428408-38428430 GCCCCCGGCCCCGCCCCTCCCGG + Exonic
1147263566 17:39222549-39222571 GCCCCAGGAGCCGGAATACCTGG - Intronic
1152197126 17:78924633-78924655 GCCCCCAGCGCTGGCATCCCAGG + Intronic
1152606714 17:81295115-81295137 GCCCCCGCAGCCGGCCTTCGAGG - Exonic
1152924608 17:83081196-83081218 GCTCCCGGCGCCGGCGTTCCCGG - Intronic
1157608601 18:48941835-48941857 CCCCCCAGCACTGGCATTCCAGG + Intronic
1158953814 18:62522397-62522419 GGCCCCGGCGCCGCGATCCCGGG - Intergenic
1161237538 19:3205311-3205333 TCCCCCAGCGCCCGCAGTCCCGG + Intronic
1161290718 19:3492153-3492175 GCCCCCGGGAACGGCATCCCGGG - Intronic
1162030931 19:7916959-7916981 GGCCCCAGCGCCCGGATTCCAGG - Intronic
1163102718 19:15107732-15107754 GCCCGCAGCGCTGGCATCCCCGG - Intronic
1163437259 19:17303074-17303096 GCCCCCGGCCCCCGCCTTCCAGG + Intronic
1165829808 19:38724743-38724765 TCCCCAGGTGCCGGGATTCCAGG - Intronic
1166876538 19:45901388-45901410 GCCCCCGGCGCCGCCACACCTGG + Exonic
1168336587 19:55600568-55600590 GCCCCCGCCGCCCGCTTACCCGG + Intronic
926140823 2:10366862-10366884 GCCCCCGGCCCCAGCATCCTTGG - Intronic
926158852 2:10474216-10474238 CCCACCAGTGCCGGCATTCCTGG + Intergenic
932773255 2:74513361-74513383 GCCCCCGCCGCCGCCCTGCCCGG - Intergenic
947697838 2:232207446-232207468 GCCCTCGGAGCACGCATTCCAGG + Intronic
948261653 2:236608379-236608401 GCCCGCAGCCCTGGCATTCCAGG - Intergenic
1172515214 20:35528526-35528548 GCCCTGGTCGCTGGCATTCCTGG + Exonic
1173228249 20:41174587-41174609 GCCCCCTGTGGCGGCCTTCCGGG + Exonic
1174180333 20:48670363-48670385 GCCCACGTGGCGGGCATTCCAGG + Intronic
1175456251 20:59117222-59117244 GCCCCCGGAGATGACATTCCTGG - Intergenic
1175819719 20:61902285-61902307 ACCCCCGGGGCCTCCATTCCAGG + Intronic
1175950833 20:62582273-62582295 GCCCCCTGCCCCCGCACTCCGGG + Intergenic
1176029830 20:63006596-63006618 GCCCGCGGCTACGGCACTCCGGG - Exonic
1180070722 21:45434791-45434813 GCCCCCAGAGCCGGGCTTCCCGG + Intronic
1180077228 21:45468960-45468982 GCCTCCGGCGCAGGCCTCCCGGG + Intronic
1185409629 22:50674866-50674888 GCCCCAGGGGCCGGGCTTCCCGG - Intergenic
952764689 3:36944398-36944420 GCCCCCGGGGCAAGCATTCTTGG - Intronic
954602233 3:51878635-51878657 GCCCCCAGGGTCTGCATTCCTGG + Intergenic
955971931 3:64445204-64445226 GCCCGCGGGGCCGGCTTACCTGG + Intronic
956749862 3:72336915-72336937 GCCCCCCCCGCCGGCTTCCCTGG - Intergenic
958900089 3:99876071-99876093 GGCCCCGGCGCAGGCAGTTCAGG - Intronic
961532505 3:127547897-127547919 GCCCCGCGCGCCGCCATGCCTGG + Intergenic
964622825 3:158733015-158733037 GCCCCTGGCTCCGGCGTCCCGGG - Intronic
968542182 4:1173194-1173216 GCTCCCGGCGCAGGCATCCCTGG + Intronic
968576668 4:1369360-1369382 GTCCCCGCCTCCGGCACTCCTGG - Intronic
969590888 4:8121391-8121413 GCCCCCGGCACCCACATTCCTGG + Intronic
985551391 5:535208-535230 GCCCCCGGCCCCTGCCTTCTGGG + Intergenic
985658231 5:1142966-1142988 GCCCCGGGCCCCGGTATTCATGG + Intergenic
985908796 5:2863366-2863388 GCCCCCAGGGCCCACATTCCTGG - Intergenic
986336942 5:6762417-6762439 GCCCCTGGACCCGGCATTCGAGG + Intergenic
995462710 5:112419864-112419886 GCCGCCGCGGCAGGCATTCCCGG - Intergenic
1002204686 5:177554347-177554369 GCCCCCGCCGCCGCCAAGCCTGG - Exonic
1008030401 6:46688141-46688163 GCCCCCGGCGCCGGCATTCCGGG - Exonic
1010204555 6:73310446-73310468 GCCCCCGGCCCCTGCGTTTCTGG - Intergenic
1017738096 6:157381566-157381588 GGCCCCGGCGCCGGCTTCCTCGG - Exonic
1018959801 6:168440569-168440591 GCCCCCGGCGCAGCCTTTCCTGG + Intergenic
1019168004 6:170111879-170111901 GCCTCCTCCACCGGCATTCCTGG + Intergenic
1020125971 7:5532645-5532667 GCCCCGGGCTGCAGCATTCCTGG + Intronic
1026385735 7:69845860-69845882 GCCCCAGGCACCTGCATCCCAGG - Intronic
1032080193 7:128854793-128854815 GCCCCCAGCGCCAGCCTCCCGGG - Exonic
1032080713 7:128857145-128857167 GGCCCCCGAGCCGGCATTCAGGG - Exonic
1035317013 7:158002671-158002693 GGCCCCGGCCCCAGGATTCCTGG - Intronic
1035344967 7:158191850-158191872 GCCCCCGGGGCAGGCTTGCCGGG + Intronic
1036795061 8:11749754-11749776 GCCCCCGGCACCTGCAGCCCCGG + Intronic
1041167350 8:55102694-55102716 GCCCGCGGAGCCGCCACTCCCGG - Exonic
1045115238 8:98973855-98973877 GGCCCCGGCACCGGCGGTCCTGG - Intergenic
1045847821 8:106658154-106658176 GCCCCCGGCGCCGTCCAGCCCGG + Intronic
1049237177 8:141518226-141518248 GCCCCCGGAGCCCGCCTTCCCGG + Exonic
1051936348 9:22447152-22447174 GCCCCCGTCCCCGGCGTTGCCGG + Exonic
1055308223 9:74952283-74952305 TCCCCCGGCCCCGGCAGTACGGG + Exonic
1055754104 9:79539090-79539112 GCCCCCAGCTCCGGCAGTGCAGG - Intergenic
1056773911 9:89497970-89497992 GCCGCCGCCGCCGCCATTCCTGG - Intronic
1059942140 9:119369037-119369059 GCACCCGGCGCCGCCTTACCTGG + Exonic
1060295835 9:122342479-122342501 GCACATGGCCCCGGCATTCCTGG - Intergenic
1060849299 9:126860994-126861016 GCCAGCGGCGCCGGGACTCCAGG - Intronic
1062039462 9:134397397-134397419 GCCCTGGGTGCTGGCATTCCGGG + Intronic
1062051336 9:134448613-134448635 GCCCCAGGCACCTGCAGTCCAGG - Intergenic
1062096218 9:134705362-134705384 GCCCCCTGCGCCTGCAGACCAGG + Intronic
1062110416 9:134779133-134779155 GCCCCCGGCACCGGGATTCCAGG - Intronic