ID: 1008030402

View in Genome Browser
Species Human (GRCh38)
Location 6:46688142-46688164
Sequence GGCCCCCGGCGCCGGCATTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030402_1008030409 5 Left 1008030402 6:46688142-46688164 CCGGAATGCCGGCGCCGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1008030409 6:46688170-46688192 GGCCCTGCGGGTGTCCTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 85
1008030402_1008030406 -8 Left 1008030402 6:46688142-46688164 CCGGAATGCCGGCGCCGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1008030406 6:46688157-46688179 CGGGGGCCTCGCTGGCCCTGCGG 0: 1
1: 1
2: 2
3: 50
4: 382
1008030402_1008030413 29 Left 1008030402 6:46688142-46688164 CCGGAATGCCGGCGCCGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030402_1008030407 -7 Left 1008030402 6:46688142-46688164 CCGGAATGCCGGCGCCGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1008030407 6:46688158-46688180 GGGGGCCTCGCTGGCCCTGCGGG 0: 1
1: 0
2: 4
3: 44
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030402 Original CRISPR GGCCCCCGGCGCCGGCATTC CGG (reversed) Exonic
900205646 1:1431004-1431026 GGGCCCCTGCCCCGGCACTCGGG - Intergenic
900527982 1:3138431-3138453 TGCCCCCGGAGCCGGCGTTGGGG + Intronic
903077908 1:20786660-20786682 CGCCCCCGCCGCCGCCATTACGG - Exonic
903946579 1:26967803-26967825 GGCTCCCTGCCCCGCCATTCTGG + Intergenic
904535298 1:31195472-31195494 GGCCCCCGCCACCTGCACTCTGG + Intronic
904641952 1:31937941-31937963 GGCCCCCGGCGCCGGCGCGGGGG + Intronic
905137142 1:35808401-35808423 GGCCCCCGCCGCCGCCATGGAGG + Exonic
908354406 1:63316976-63316998 GGGCCCCGGGGCCTCCATTCGGG + Intergenic
908501110 1:64744900-64744922 GGCCCCCGGCCCCGGCGCACAGG - Intergenic
910669972 1:89762908-89762930 GGGCACCGGCGCCTGCACTCTGG + Intronic
912471660 1:109911019-109911041 GGCGCCCGGCGCGGTCATACGGG - Exonic
920027161 1:203007435-203007457 GGCTCCCGGGGCCGGCTCTCCGG + Exonic
922453535 1:225755925-225755947 GGCCCCCTGCCCCAGCATCCAGG + Intergenic
1063593487 10:7412517-7412539 GGCCCCCTGCGCCGCCAGTATGG + Intergenic
1075119119 10:119651547-119651569 GGTGCCCGGCGCCGGCTTCCCGG + Exonic
1076728767 10:132427306-132427328 CACCCCAGGCGCCGGCATGCTGG - Intergenic
1076890223 10:133279787-133279809 GGCCCCCGGCTCCTGCACCCAGG - Exonic
1083176140 11:60951534-60951556 GGCGCGCGGCGCGGGCATCCTGG + Exonic
1083868535 11:65471997-65472019 GGCCCCCAGGGCCAGCATCCTGG - Intergenic
1083995399 11:66269134-66269156 GGCCCCAGGAGCCGGGCTTCAGG - Intronic
1084385573 11:68841291-68841313 GGCCCCGGGCGAAGGCATCCTGG + Intronic
1089556261 11:119317254-119317276 GGGCCCCGGCGCCGCCAGCCCGG + Intronic
1089865609 11:121628566-121628588 GGCCCTCGGCCCGGGCATTGGGG + Intronic
1091405017 12:203708-203730 GGCCCCCGGCTCGGCCATCCCGG - Intronic
1092843092 12:12561997-12562019 GGCGCCCGGCACCGGGAGTCGGG + Intronic
1096495423 12:52037071-52037093 GGCCGCCGCCGCCGGGATTCCGG + Intronic
1101875005 12:108591945-108591967 GGCCCCCGGCCCGGTCACTCTGG + Exonic
1103527810 12:121579389-121579411 GGCCCCCGGTTCCGGCTTCCCGG - Intronic
1114633976 14:24177269-24177291 GACCCCTGGCGTGGGCATTCTGG + Intronic
1118796862 14:69152322-69152344 AGCCCCCGTCGCCGGCGTTAAGG - Intronic
1122604570 14:102939630-102939652 GGGCCCAGGCGACGGCATGCAGG - Exonic
1122722162 14:103728201-103728223 GGAACCCGGCGCCGGCGCTCGGG + Intronic
1202872395 14_GL000225v1_random:177077-177099 GGCCCCCAGCGCGGACTTTCGGG + Intergenic
1126789133 15:52204690-52204712 GGCCCTGGGCGCCAGCATCCCGG + Intronic
1131056618 15:89378828-89378850 CGCCCCCCGCGCCCGCACTCTGG - Intergenic
1132460759 16:53447-53469 CGCGCCCAGCGCCGGCCTTCGGG + Intronic
1133340643 16:5033586-5033608 GACTCCCGGCGCCGGCGGTCTGG - Exonic
1133750371 16:8720638-8720660 GGCCCACGGCTCCGGCTTTATGG + Intronic
1142147221 16:88497665-88497687 GGCTCCCAGCGCCGGGATGCTGG - Intronic
1142483130 17:230596-230618 GGCCCCAGGCTCAGGCATACAGG + Intronic
1143627889 17:8121586-8121608 TGCCCCCGCCGCCCGCTTTCTGG - Exonic
1144952642 17:19002460-19002482 GGTCCCCGAAGCCAGCATTCTGG + Intronic
1145286727 17:21511752-21511774 GGCCGCTGGCGCCGGCTGTCGGG + Intergenic
1146052727 17:29566501-29566523 GGCCCCCGGCGCTGGTGATCCGG + Exonic
1148826394 17:50397335-50397357 GGGCCCCGGCTCCGGGGTTCCGG + Exonic
1148878637 17:50707885-50707907 GTCCCCCGGAGCCGGCCTTCGGG - Exonic
1150658318 17:67055258-67055280 GTCCCCCGGCCCCGGCGCTCAGG - Intronic
1160894190 19:1395084-1395106 GGCCCCCGGCCCCAGCCCTCAGG - Intronic
1160957590 19:1700554-1700576 GGCCCCCGCCGCCGGCCCGCAGG + Intergenic
1161150126 19:2702993-2703015 AGCCCCCGGAGCTGGCATGCAGG - Intergenic
1161487379 19:4543517-4543539 TGCCCCGGGCCCCGGCGTTCTGG + Exonic
1161957658 19:7505575-7505597 GTGCCCCGGCCCCGGCAGTCTGG + Exonic
1164977128 19:32581510-32581532 GGCCCCCGCCGCCAGCCTCCTGG - Intronic
1166857983 19:45792705-45792727 GGGCCCCGGCGCCGCCATGGGGG - Exonic
1168282444 19:55312693-55312715 GGCCCTCCGCGCCGGCACACAGG + Intergenic
1168307226 19:55442338-55442360 GGCCCCCGGCACCCCCAGTCCGG + Exonic
1168309192 19:55452149-55452171 CGCCCCCGGCCCCCGCCTTCCGG - Intergenic
925969299 2:9095834-9095856 GGCCTCCGGCGCCGCCAGGCAGG - Intergenic
926147446 2:10405273-10405295 GGCCCCTGAAGCTGGCATTCTGG + Intronic
934670395 2:96208731-96208753 GGCGCCCGGGGCCGGGATGCAGG + Exonic
936826365 2:116586664-116586686 GGCCACCCACCCCGGCATTCTGG + Intergenic
940199970 2:151139927-151139949 GGCCCCTGGGGCTGGAATTCAGG - Intergenic
944831125 2:203534993-203535015 GGCGCCCGGCCCCGCCATCCGGG - Intronic
946191627 2:218010628-218010650 GGCGCCCGGCGCCGGGCGTCCGG + Intergenic
946921348 2:224584902-224584924 GGCCCCCGGCCCCGGGGTCCCGG + Intronic
948993738 2:241567906-241567928 GGCCACGGGCACAGGCATTCTGG - Intronic
949046601 2:241875082-241875104 GGCCCCCGAGGCCTGGATTCTGG - Intergenic
949046617 2:241875134-241875156 GGCCCCCGAGGCCTGGATTCTGG - Intergenic
949046633 2:241875186-241875208 GGCCCCCGAGGCCTGGATTCTGG - Intergenic
949046649 2:241875238-241875260 GGCCCCCGAGGCCTGGATTCTGG - Intergenic
1169218571 20:3807423-3807445 GGCCCCGGGCGCCATCATGCTGG + Intergenic
1172458061 20:35093006-35093028 GGCCCCCGGGCCCAGCATTTCGG + Intergenic
1175404374 20:58717110-58717132 GCCCCCCGACGCCGGCAGGCAGG - Intronic
1175905998 20:62379741-62379763 GACCCCAGGCCCCAGCATTCCGG - Intergenic
1176029831 20:63006597-63006619 GGCCCGCGGCTACGGCACTCCGG - Exonic
1179657436 21:42853891-42853913 TTTCCCCGGCGCCGGCATTTGGG - Intronic
1179951550 21:44711451-44711473 GGCCCCCGGCCACGGCACGCAGG - Exonic
1180077227 21:45468959-45468981 GGCCTCCGGCGCAGGCCTCCCGG + Intronic
1180285705 22:10742399-10742421 GGCCCCCAGCGCGGACTTTCGGG - Intergenic
1180921764 22:19524880-19524902 GGACCCCGGGGCGGGCTTTCTGG - Intronic
1181934634 22:26429641-26429663 GGACCCGGGCGCCCGCATCCCGG + Intronic
1185094458 22:48798711-48798733 GGCCCCCGAGGCCTGCATCCTGG - Intronic
1185264002 22:49888654-49888676 GCCCACCGGCTCCTGCATTCTGG - Exonic
954333401 3:49902678-49902700 GCCCCCCGGCGCCTGCGTTTTGG + Exonic
954540649 3:51391302-51391324 CGCCCCCGGCGCCGCCATCTTGG - Exonic
960864308 3:122184352-122184374 CGCTCCCGGCGCCCGCCTTCGGG - Exonic
968730194 4:2265850-2265872 GGTCCCCTGCACCAGCATTCAGG + Intergenic
968819952 4:2843343-2843365 GGCCCCCGGGCCCGGCCTGCGGG - Intergenic
976595581 4:86892252-86892274 GGCCGCCGGCGCCGGCTCGCGGG - Intronic
985551390 5:535207-535229 TGCCCCCGGCCCCTGCCTTCTGG + Intergenic
988564787 5:32312553-32312575 GGACCCCGGCGCAGGCAGGCAGG - Intronic
992104099 5:73436373-73436395 GGCCCCCAGCGAGGCCATTCAGG + Intergenic
997470626 5:134115119-134115141 GGGCCCCGGCGCCGGCCCCCGGG - Exonic
1003921498 6:10837887-10837909 GTCCCCGGGCGCCGGGAGTCCGG + Intronic
1006515630 6:34544206-34544228 GGCCCCTGGGGCCAGCAGTCGGG - Exonic
1008030402 6:46688142-46688164 GGCCCCCGGCGCCGGCATTCCGG - Exonic
1022396218 7:29989794-29989816 GGGCCCCAGCGCCGGGAGTCTGG - Intronic
1023955596 7:44884718-44884740 GGCCCCCGGCGCCGCCTCCCGGG + Exonic
1027244543 7:76358501-76358523 GCCCCGCGGCGCTGCCATTCAGG - Intronic
1029281591 7:99439067-99439089 GGCCGCCGCCGCCGCCATGCAGG + Exonic
1032080194 7:128854794-128854816 GGCCCCCAGCGCCAGCCTCCCGG - Exonic
1032080714 7:128857146-128857168 AGGCCCCCGAGCCGGCATTCAGG - Exonic
1037788953 8:21919890-21919912 GGCCCGCGCCGCCGCCACTCGGG + Intronic
1038739239 8:30202302-30202324 GGCAGCCGGCGCCGGCTTCCTGG - Intergenic
1038895473 8:31777448-31777470 AGCCCCAGGCTCAGGCATTCTGG + Intronic
1040638798 8:49306569-49306591 GGCACCCAGCGCGGGCACTCCGG - Intergenic
1043463894 8:80486696-80486718 CGCCCCCGCCCCCGGCGTTCCGG - Exonic
1044648968 8:94474805-94474827 GGCCCCCGGGGCCAGCAACCAGG + Intronic
1049409764 8:142467319-142467341 GGCAGCCGGTGCCGGCATTCAGG + Intronic
1049728153 8:144160866-144160888 AGCCCCCGGCGCCTGGGTTCTGG - Intronic
1059283140 9:113151387-113151409 GGCCCCCGGCCCCGGACCTCTGG + Intronic
1060389804 9:123268238-123268260 GCCCCGCGGCTCCGGCATTGTGG - Intronic
1061052159 9:128203363-128203385 GCCCCGCGGCGCAGGCAGTCTGG + Exonic
1061512901 9:131071668-131071690 GGCCCCCAGCGCCTGCAGTCTGG + Intronic
1061955744 9:133960442-133960464 GGCTCCCGTGGCCGGCACTCAGG - Intronic
1062078543 9:134605849-134605871 GCCCCCAGGCCCTGGCATTCTGG + Intergenic
1062366258 9:136210591-136210613 TGACCCCGGCCCCGGCAGTCAGG + Intronic
1203732055 Un_GL000216v2:99465-99487 GGCCCCCAGCGCGGACTTTCGGG - Intergenic
1199699105 X:150363459-150363481 GGCCGCCGGCGCGGGCAGCCTGG - Exonic