ID: 1008030404

View in Genome Browser
Species Human (GRCh38)
Location 6:46688150-46688172
Sequence GCCAGCGAGGCCCCCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030404_1008030409 -3 Left 1008030404 6:46688150-46688172 CCGGCGCCGGGGGCCTCGCTGGC 0: 1
1: 0
2: 2
3: 16
4: 234
Right 1008030409 6:46688170-46688192 GGCCCTGCGGGTGTCCTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 85
1008030404_1008030413 21 Left 1008030404 6:46688150-46688172 CCGGCGCCGGGGGCCTCGCTGGC 0: 1
1: 0
2: 2
3: 16
4: 234
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030404 Original CRISPR GCCAGCGAGGCCCCCGGCGC CGG (reversed) Exonic
900120113 1:1045248-1045270 GCCAGCCAGGCCCACGCCCCGGG - Exonic
900176737 1:1294475-1294497 GCCAGCGCCGCCGCCAGCGCAGG + Exonic
900360256 1:2284809-2284831 GCCACCGGGGCCCCCAGCACAGG - Intronic
900462527 1:2808553-2808575 ACAAGAGAGGCCCCGGGCGCAGG + Intergenic
900676294 1:3888664-3888686 ACCACCGAGGCCCCCGGGACAGG - Intergenic
900796591 1:4712080-4712102 GCCAGCGCGGGTCCCGGCCCCGG + Exonic
900951420 1:5860079-5860101 GCCAGGGAGGACTCCGGTGCTGG - Intergenic
901464585 1:9413140-9413162 GCCAGCGAGGCCCTCCCTGCTGG - Intergenic
902514059 1:16980517-16980539 GTCGGCGGGTCCCCCGGCGCGGG - Intronic
904641945 1:31937933-31937955 TTCCCCGAGGCCCCCGGCGCCGG + Intronic
905137025 1:35808056-35808078 GCGTGCGCGGCCCCGGGCGCGGG - Intergenic
907076809 1:51586675-51586697 ACCAGCCAGGCCCCAGGTGCGGG + Intronic
907306071 1:53513828-53513850 GCCAGGCTGGCCCCAGGCGCAGG + Intronic
907464294 1:54624708-54624730 GACAGCAAGGCCCCCGATGCTGG + Intronic
910935201 1:92481252-92481274 GCCTGCGAGGCCCCAGGGCCCGG - Intronic
913697316 1:121339805-121339827 GCCAGCCAGGGCCCAGGCTCAGG - Intronic
914140242 1:144940248-144940270 GCCAGCCAGGGCCCAGGCTCAGG + Intronic
915588983 1:156860119-156860141 GCCAGCGCCGGCCCCGGGGCAGG - Intronic
916390027 1:164321364-164321386 GGAAGCGCGGCCCCCGGAGCTGG - Intergenic
921923137 1:220690447-220690469 GCCCTCGGGGCCCGCGGCGCAGG - Exonic
922306982 1:224352743-224352765 GCCGGCGGGGCCCGCGGGGCCGG + Intergenic
1063592268 10:7406890-7406912 GGCTGCGAGACCCCCGGCTCGGG + Intronic
1070820364 10:79350670-79350692 GCCAGGGAGCCCTCCCGCGCTGG - Intronic
1071857936 10:89644922-89644944 TCCAGCGAGGCCGCCTGAGCCGG - Exonic
1072804838 10:98417777-98417799 CCCAGAGAGGCCTCTGGCGCTGG - Intronic
1073820951 10:107263805-107263827 GGCAGCGAGTCTCCCGGAGCCGG + Intergenic
1075736742 10:124669011-124669033 GCCAGCCAGGCCCCTGGCCTGGG + Intronic
1076096721 10:127738790-127738812 GCCCGCCAGGCCCCCGGGGAAGG - Exonic
1076164726 10:128272661-128272683 GGCAGCGTGGCCCCCGGGCCTGG + Intergenic
1076370066 10:129946942-129946964 GCCAGCGAGGCCCCAGGGAAAGG - Intronic
1076949749 10:133670939-133670961 TGCAGCGCGGCCCCCGGCGGGGG + Intronic
1076950733 10:133674238-133674260 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076951723 10:133677548-133677570 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076952712 10:133680858-133680880 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076953696 10:133684157-133684179 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076955669 10:133743819-133743841 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076956659 10:133747129-133747151 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076957646 10:133750438-133750460 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076959620 10:133757047-133757069 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1076960604 10:133760346-133760368 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
1077143363 11:1034541-1034563 GCCAGCGAGGGCCCCATCCCAGG - Intronic
1080826441 11:35852956-35852978 GTCAGGGAGGCCCCCCGAGCAGG + Intergenic
1081625876 11:44654794-44654816 GCCTGCGGGGCTCCCTGCGCTGG - Intergenic
1083722079 11:64608116-64608138 GTCAGCGAGGGCCAGGGCGCAGG + Intronic
1083920852 11:65780883-65780905 GCCACCCCGGCCCCCGGCGCCGG + Intergenic
1084110906 11:67013678-67013700 TCAAGTGTGGCCCCCGGCGCAGG + Intronic
1084332782 11:68439612-68439634 GCCAGAGAGGCCTGCGGCTCAGG + Intronic
1084639416 11:70415744-70415766 CCCATCGGGGCCCCCGGAGCGGG - Intronic
1084734163 11:71093835-71093857 GACAGCGAGGCCCCCGTCTTGGG + Intronic
1085152158 11:74260969-74260991 GCCAGCGATGCCCCCTGCCCAGG + Intronic
1086926304 11:92644102-92644124 GCCACCTTGGCCCCCGGCCCTGG - Intronic
1088883480 11:113989545-113989567 GCCAGCGAGGCCTCCCGAGGTGG - Exonic
1090383898 11:126345449-126345471 GGCTTCGAGGCCCCCGGCTCAGG + Exonic
1091802601 12:3334030-3334052 GCCAGCCAGGCCCTCGGCAGGGG + Intergenic
1094682686 12:32679694-32679716 GCTAGCCAGGCCCGCCGCGCCGG - Intronic
1096116864 12:49060128-49060150 GCTCGCGCGGCCCCGGGCGCCGG - Intergenic
1097183337 12:57183465-57183487 GCCAGCGAGGTCCCGGACACTGG - Exonic
1097284270 12:57865468-57865490 CCCCGCGAGGGCCCCAGCGCTGG - Intergenic
1098426066 12:70366548-70366570 GCCAGCGACGCCCCCGGCGGCGG - Exonic
1099315493 12:81078155-81078177 CCCTCCGAGCCCCCCGGCGCTGG - Exonic
1102043342 12:109814765-109814787 TCCAGCGAAGGCCCCCGCGCGGG - Exonic
1104687160 12:130793965-130793987 GCCAGCCAGGCCCGGGGCACAGG + Intronic
1105240971 13:18609530-18609552 GCCCGCGCGGCCACAGGCGCGGG + Intergenic
1105964428 13:25371983-25372005 GCCAGCGGGGCCCGCCGCGGTGG + Intergenic
1106437943 13:29740331-29740353 GCCAGCCAGCCACCGGGCGCTGG + Intergenic
1112752550 13:102597212-102597234 GCCCCCGAGGGCCCGGGCGCGGG + Intronic
1113913311 13:113854963-113854985 GACAGCGATGCCACCGGGGCTGG - Intronic
1113920621 13:113906708-113906730 GCCACCTGGGCCCCCGGCTCTGG - Intergenic
1122637886 14:103138780-103138802 GGGAGCGAGTCCCCCAGCGCGGG + Intergenic
1122904320 14:104795104-104795126 GCCAGCGAGGCAGCCGGCGGAGG - Intronic
1123490385 15:20775609-20775631 GCCCGCGCGGCCACAGGCGCGGG - Intergenic
1123546886 15:21344696-21344718 GCCCGCGCGGCCACAGGCGCGGG - Intergenic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1128119233 15:65133548-65133570 GCCAGCGCCGCCTCCGCCGCGGG + Exonic
1128506770 15:68278154-68278176 GCCCGCCAGGTCCCAGGCGCCGG - Exonic
1131182763 15:90251686-90251708 GCCCGCCAGGCCCCAGGGGCTGG - Intronic
1202955217 15_KI270727v1_random:71912-71934 GCCCGCGCGGCCACAGGCGCGGG - Intergenic
1132556386 16:574544-574566 GGCAGCCAGGCCCCCCGTGCTGG - Exonic
1133119247 16:3596169-3596191 GCCAGCCAGGCCCCCACTGCCGG + Exonic
1133156603 16:3880547-3880569 GCGAGCGGGGCCGCCGGGGCGGG + Exonic
1133223768 16:4330488-4330510 GCCAGGGAGCCCCAGGGCGCTGG - Intronic
1133973016 16:10580549-10580571 GCCAGCGCAGCCGCCAGCGCCGG - Exonic
1136020973 16:27439838-27439860 CCCAGCGAGGCCCAGGGCCCAGG - Intronic
1136791192 16:32969206-32969228 CCCAGCCAGGCCCCAGGGGCTGG + Intergenic
1136878622 16:33884726-33884748 CCCAGCCAGGCCCCAGGGGCTGG - Intergenic
1137655226 16:50153425-50153447 GGGAGCGACGCCGCCGGCGCCGG + Intronic
1138425873 16:56931839-56931861 ACCTGCGAGGCCCCCAGCTCGGG - Intergenic
1138688761 16:58748952-58748974 GCCAGCCAGCCCGCCGGCCCCGG + Intergenic
1141430512 16:83968480-83968502 GCCGGCCCGCCCCCCGGCGCCGG + Intergenic
1142291603 16:89195823-89195845 TCCAGCCAGGCCCCAGGCACTGG - Exonic
1203093401 16_KI270728v1_random:1230668-1230690 CCCAGCCAGGCCCCAGGGGCTGG + Intergenic
1203123046 16_KI270728v1_random:1555408-1555430 GGCGGAGAGGCCCACGGCGCCGG - Intergenic
1144841548 17:18189536-18189558 GCCAGCAAGGCCCCCTGGACAGG + Intronic
1145979986 17:29005671-29005693 GGCTGCGCTGCCCCCGGCGCCGG - Intronic
1146052726 17:29566493-29566515 CGCAGGAAGGCCCCCGGCGCTGG + Exonic
1148568311 17:48646765-48646787 GGCAGCGACGCCGACGGCGCTGG + Intergenic
1150690983 17:67366634-67366656 CCCCTCGAGGTCCCCGGCGCTGG + Intergenic
1151559134 17:74861461-74861483 GCGAGGGAGGCGGCCGGCGCGGG - Intronic
1151679826 17:75617323-75617345 CCCAGTGAAGCCCACGGCGCAGG - Intergenic
1151854384 17:76710741-76710763 GCGGGCGAGGCCGCCGGCTCGGG + Exonic
1152108356 17:78343293-78343315 GCCAGAGAGGCCCCTGGTGTAGG + Intergenic
1152136118 17:78504712-78504734 GCAAGCGCGTCCCCCGGCTCAGG - Intronic
1152151256 17:78602764-78602786 GCCAGCGAGGCCCTCGCCTGGGG + Intergenic
1152587385 17:81195132-81195154 TCCAGCCTGGCCCCGGGCGCTGG - Intronic
1152714388 17:81891485-81891507 GCCAGCGAGGCGGCCGGGGCGGG - Exonic
1152924610 17:83081205-83081227 GCCTCGGAGGCTCCCGGCGCCGG - Intronic
1153263788 18:3248022-3248044 GCCAGCCAGGTCCCCGGTTCTGG + Intronic
1153285650 18:3452163-3452185 GCCAGGGAGGACCACGGCGCTGG - Exonic
1154447995 18:14450378-14450400 GCCCGCGCGGCCACGGGCGCGGG - Intergenic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1160005019 18:75063286-75063308 GCCAGCGCCGCCCCCTGAGCAGG + Exonic
1160543568 18:79638462-79638484 CCCGGCGCGGACCCCGGCGCTGG - Intergenic
1160866187 19:1257177-1257199 CCCAGCGAGGCCTCCGGCTTGGG + Exonic
1160901434 19:1430530-1430552 ACCAGCGAGGCCACAGGCGATGG - Intronic
1161069699 19:2253905-2253927 GCCTGTGCGGCCCCGGGCGCAGG + Intronic
1161317900 19:3626805-3626827 GCGAGGAAGGCCCCCAGCGCAGG - Exonic
1161397899 19:4054439-4054461 GCCGGCGGGGCCACCGGCGGCGG + Exonic
1161401149 19:4066648-4066670 CCCGGCGCGGCCCCCGGCACGGG - Intronic
1162030858 19:7916694-7916716 GCCAGGGCGGGCCCCGGGGCCGG - Exonic
1162997153 19:14343427-14343449 GCCAGCCAGGCCCCTGGGCCTGG + Intergenic
1163232894 19:16016006-16016028 GCCAACCAGGCCCCGGACGCTGG - Intergenic
1165433430 19:35784717-35784739 GCCAGCGAGGGCAGCGGCTCTGG - Intronic
1166219106 19:41353839-41353861 GACAGCGAGGGCCCCGGCCGGGG - Exonic
1166290488 19:41860366-41860388 GGCCCCGAGGCGCCCGGCGCGGG + Intronic
1166358572 19:42242218-42242240 GGCAGCGGAGGCCCCGGCGCAGG - Exonic
1167391288 19:49196750-49196772 GCCAGCGGGGGCCCCGGGCCTGG + Exonic
1168414440 19:56159650-56159672 GCCTGGGAGTCCCCAGGCGCCGG - Exonic
925036580 2:692044-692066 TCCAGCTGGGGCCCCGGCGCGGG - Intergenic
927567257 2:24123735-24123757 GCGCGGGAGGCCCCCGGCCCGGG + Intronic
927882806 2:26700500-26700522 GCCAGAGAGGCCACCAGCCCAGG - Intronic
928149093 2:28810529-28810551 GACAACCAGGCCCCCGGGGCTGG - Intronic
929701903 2:44169323-44169345 GCCGCCGAGGCCCCGGGCCCTGG + Intronic
934954771 2:98608472-98608494 GCGAGCGAGGCCCCAGTCTCAGG + Exonic
935593059 2:104857967-104857989 GCCAGCGAGGCCGCCGAGCCAGG + Exonic
937217494 2:120321906-120321928 CCCAGGAAGGCCCCCGGCTCAGG - Intergenic
937989731 2:127655430-127655452 GCCAGCGAGGGCCCCTGTGCTGG + Intronic
938077213 2:128346230-128346252 GCCTGGGAGGCCCCAGGGGCAGG + Intergenic
938312260 2:130301196-130301218 GCCACCGAGGCTCCCCTCGCTGG + Intergenic
938812202 2:134863673-134863695 CCCAGCGGTGCCCCCGGCCCAGG - Intronic
940052578 2:149479908-149479930 GCCAGCAAGTCCCCCTGCACTGG + Intergenic
941095890 2:161239013-161239035 CCCCGCGCGGCCCCCAGCGCCGG + Intergenic
941104892 2:161341121-161341143 GCGGGCGAGGCCGCCGGCTCGGG + Intronic
945699427 2:213151758-213151780 GGCAGCGGAGCCCCGGGCGCGGG + Intronic
948569159 2:238906721-238906743 TCCAGGGAGGCCCCAGGCACTGG - Intronic
948645464 2:239401195-239401217 GCCGGCCAGGCGCCCGGGGCGGG - Intronic
948755040 2:240154752-240154774 GCCAGTGAGGCCCTGGGCTCAGG + Intergenic
948816212 2:240511646-240511668 GCCACCCAGGCCCCGTGCGCAGG + Intronic
1169274202 20:4221948-4221970 GCCAGAGAGGGCGGCGGCGCCGG + Exonic
1171424187 20:25039274-25039296 GACAGCAAGGCCCCTGGAGCTGG - Intronic
1171504654 20:25623745-25623767 GCAAGAGCGGCCCGCGGCGCCGG + Intronic
1172109334 20:32536274-32536296 GCCAGCCAGGCCCCGCGGGCGGG + Intronic
1172618731 20:36306491-36306513 GCGGCCGAGGCGCCCGGCGCAGG + Exonic
1173606759 20:44337171-44337193 GCCTGCCAGGCCCACGGTGCTGG - Exonic
1173672866 20:44810279-44810301 GCGGCCGAGGCGCCCGGCGCCGG - Intronic
1179149500 21:38797703-38797725 GCCAGCCAGGCCCCCGGGCCAGG + Intergenic
1180354231 22:11825228-11825250 CCCAGAGAGGCCCACAGCGCTGG - Intergenic
1180384022 22:12167127-12167149 TCCAGAGAGGCCCACAGCGCTGG + Intergenic
1180854780 22:19039004-19039026 GCCAGAGAGGCCCCCGCAGTGGG + Exonic
1181064688 22:20299835-20299857 GCCAGCGAGCAGCCCGCCGCGGG + Intergenic
1181478112 22:23180869-23180891 GCCAGCCCGGCCCCGGGCGCCGG - Exonic
1183548507 22:38468028-38468050 GCCAGGGCGGCCGCCGGCGCAGG - Intergenic
1183942209 22:41302165-41302187 GCCCCCGAGACCCCCTGCGCGGG - Intronic
1184168083 22:42742464-42742486 GCCTGCGAGGCCCCCAGAGGAGG + Intergenic
1184730160 22:46367344-46367366 GGCAGTGAGGGCCCCGGCTCAGG + Intronic
1185236568 22:49716855-49716877 GCCAGCGATGCCACCTGAGCGGG + Intergenic
949133553 3:535648-535670 GCCAGCCAGGCAGCCGGCTCAGG - Intergenic
952419028 3:33114619-33114641 GGCAACGCGGCCCCGGGCGCAGG - Intronic
953863821 3:46566461-46566483 GCCAGCGCGAGCCCCGGCCCAGG + Exonic
954305432 3:49723097-49723119 CCCAGCTGGGCCCCTGGCGCTGG - Exonic
954656770 3:52198608-52198630 CCCAGTGAGGCCCAAGGCGCTGG + Intronic
954713110 3:52514603-52514625 TCCAGGGAGCCCCCCGGCCCTGG + Intronic
955060058 3:55486345-55486367 GCCAGCGCGCACCCCGGCGCGGG - Intronic
956496499 3:69831964-69831986 GCCAGCCAGTCTCCCGGAGCCGG + Intronic
961545302 3:127629152-127629174 GCCCGCGCGGCCCCTGACGCGGG + Intergenic
963107624 3:141660277-141660299 GCCACCCAGGGCGCCGGCGCCGG - Intergenic
963236694 3:142963433-142963455 TGCAGCGACGCCCCCGGCGTGGG - Exonic
966182195 3:177197551-177197573 GCTCGCGAGGCCCGCGGCGGCGG + Intergenic
966883663 3:184362946-184362968 GGCACCGAGGACCCCGGGGCCGG - Intronic
968008705 3:195259705-195259727 ACCAGGGCGGCCCCCGGAGCCGG + Intronic
968084578 3:195868590-195868612 GCTGGCGAAGCCCTCGGCGCGGG - Exonic
968323457 3:197791578-197791600 GCCGGGGCGGCTCCCGGCGCCGG - Intronic
968965365 4:3766616-3766638 GCCAGCGCCGCCGCCAGCGCCGG - Exonic
969625054 4:8298071-8298093 GGCAGCGAGTGCCCCGGTGCTGG - Intronic
969682238 4:8649767-8649789 GGCAGCGGGGCCCCCGGCCCCGG - Intergenic
980234766 4:130090777-130090799 GCCAGCTAGGCCCCTGGGTCAGG + Intergenic
984884760 4:184440443-184440465 GCCGGGGAGGCCCCTGGAGCTGG - Intronic
985064326 4:186105542-186105564 GCCTGCGTGGCCCCCGGGGCTGG + Intronic
985452219 4:190068424-190068446 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
985453203 4:190071721-190071743 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985454193 4:190075014-190075036 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985455181 4:190078307-190078329 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985456169 4:190081607-190081629 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985457153 4:190084901-190084923 TGCAGCGCGGCCCCCGGCGGGGG + Intergenic
985458140 4:190088194-190088216 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985459129 4:190091494-190091516 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985463382 4:190174263-190174285 TGCAGCGCGGCCCCCGGCGGGGG + Exonic
985487891 5:162289-162311 GCCTGCGAGCTCCCCCGCGCCGG + Intronic
985569931 5:639358-639380 GCCAGGGAGGGCCCAGGCGCGGG - Intronic
985722169 5:1495092-1495114 GCCAGCGAGGACACAGGCGGAGG - Intronic
985996690 5:3600853-3600875 GCCAGCGCGGCTCCCGGCTGGGG - Intronic
988825305 5:34929669-34929691 GCCAGCGAGCCCGGCGGCGGCGG - Exonic
988856205 5:35230141-35230163 GAGAGCGGGGCCACCGGCGCGGG - Intronic
992056588 5:72996860-72996882 GCCACGGGGGCCCCCGGGGCCGG + Intronic
998446099 5:142199589-142199611 CCCAGAGAGGCGCCCGGTGCCGG - Intergenic
1001334311 5:170784848-170784870 GCCAGAGATGCCCTCGGGGCAGG + Intronic
1002579772 5:180200839-180200861 GCCAGCGTGGGCCCTGGAGCCGG - Intronic
1002638393 5:180619207-180619229 GACGGCGAGACCCCGGGCGCGGG - Intronic
1002980095 6:2127692-2127714 GCCAGCTGGGCCCCCTGGGCTGG - Intronic
1006070327 6:31493975-31493997 ACCAGCGCGGCCCAGGGCGCTGG - Intergenic
1006313768 6:33278609-33278631 GCCAGTGAGGGCCCCTGCGTTGG - Exonic
1006840919 6:37027499-37027521 GCAAGAGCGGCCCCCGGGGCTGG + Exonic
1007371190 6:41427888-41427910 GCCTGCGTCGCTCCCGGCGCTGG - Intergenic
1007413729 6:41679899-41679921 GCCAGCGAGGACCCTGGCGCAGG - Intergenic
1008030404 6:46688150-46688172 GCCAGCGAGGCCCCCGGCGCCGG - Exonic
1014517709 6:122399929-122399951 GTCTGCGAGGCCCGCGGTGCGGG + Intronic
1014913892 6:127121257-127121279 CCCAGCGAGGACCACGGCGCAGG + Intronic
1016386706 6:143536932-143536954 GGCAGCGCAGCCCTCGGCGCCGG + Intronic
1017163859 6:151390530-151390552 GCCACCCCCGCCCCCGGCGCCGG - Intronic
1017482991 6:154875851-154875873 TCCAGCGAGGCCCAGGGCACAGG - Intronic
1018856560 6:167679086-167679108 GCCAGCGCAGCCCCCGGCCAGGG - Intergenic
1019337934 7:494071-494093 GCCAGCGTGGCCGCAGGGGCAGG + Intergenic
1019343642 7:519689-519711 CGCAGCGAGGCCCCGGGCGGCGG - Intronic
1019522656 7:1467752-1467774 GCCACCAAGGCCCCGGGCCCTGG + Intergenic
1019531241 7:1504463-1504485 GCGCGAGAGGCCCGCGGCGCCGG + Intergenic
1019636341 7:2078096-2078118 GCCATCGAAGCCCCCAGCTCCGG + Intronic
1019689649 7:2403563-2403585 GCCGGCCCCGCCCCCGGCGCAGG - Exonic
1020070836 7:5226038-5226060 GCCAGTGAAGACCCCGGAGCTGG + Intronic
1020138205 7:5598230-5598252 GCCAGTGAGGCACCCACCGCGGG - Intronic
1020431794 7:8122997-8123019 GCCAGAGAGGCCACCTGAGCTGG - Intronic
1026205501 7:68254174-68254196 GCCAGGGAGGCTCACGGCTCAGG + Intergenic
1029849307 7:103445998-103446020 GACAGCGAGGGCCCCTGCTCGGG + Intronic
1032087298 7:128890917-128890939 GGCAGCAAGGCCCCTGGCGCGGG + Exonic
1034446141 7:151115185-151115207 GCCGCCGAGGCGCCGGGCGCGGG + Intronic
1035350077 7:158239348-158239370 GCCAGCAAGGAGCCCGGAGCTGG + Intronic
1036210285 8:6835361-6835383 GCCTGTGCGGCTCCCGGCGCCGG + Intronic
1037547702 8:19939979-19940001 GCCCGCGAGTCCCCGGGCGGGGG - Intronic
1039554745 8:38467917-38467939 TCCCGAGCGGCCCCCGGCGCCGG - Intronic
1049387922 8:142353664-142353686 GCCAGCGAGGGCCCCTCAGCCGG + Intronic
1049454538 8:142680386-142680408 GCCAGTGAGGGCCCCGGGGCTGG - Intronic
1049673018 8:143878106-143878128 GCCTGCGAGACCCCCGCCCCTGG + Intronic
1050151577 9:2622851-2622873 GACTGCGACTCCCCCGGCGCGGG + Intronic
1051504437 9:17812143-17812165 TCCAGAGAGGCCCCGGGAGCTGG + Intergenic
1051936477 9:22447627-22447649 CCCAGCGCAGCCCCCGCCGCAGG - Exonic
1060147978 9:121268330-121268352 TCCAGCGATGCCCCCGCGGCCGG - Intronic
1060831840 9:126722386-126722408 GCCAGCCAGGTCCCCGAGGCCGG - Intergenic
1061595763 9:131628288-131628310 GCCAGGGAGGGCCCTGGGGCTGG + Intronic
1061852377 9:133423770-133423792 CCCAGCGTGGCCCCAGGCACTGG - Intronic
1062230703 9:135480039-135480061 GCCCCCGAGCCCCCCGGCCCCGG - Intronic
1062306247 9:135908242-135908264 CCCAGCGCGGGCCCCGACGCAGG - Intergenic
1062558838 9:137130118-137130140 GCCAGGGTGGCCCCCAGCCCAGG - Intergenic
1062575606 9:137205861-137205883 GGCAGCCAAGCCGCCGGCGCCGG - Exonic
1187900695 X:24025146-24025168 TGCTGCGAGGCCCCCGGCGTTGG - Intronic
1200249882 X:154547175-154547197 GCGCGCGAGGCCGCCGGGGCAGG - Exonic