ID: 1008030405

View in Genome Browser
Species Human (GRCh38)
Location 6:46688156-46688178
Sequence CGCAGGGCCAGCGAGGCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 490}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030405_1008030409 -9 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030409 6:46688170-46688192 GGCCCTGCGGGTGTCCTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 85
1008030405_1008030417 27 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030405_1008030413 15 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030405_1008030418 28 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030405_1008030419 29 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030405_1008030416 26 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030405 Original CRISPR CGCAGGGCCAGCGAGGCCCC CGG (reversed) Exonic
900109349 1:999077-999099 CGCAGGGCCCGGGTGGGCCCTGG - Exonic
900116497 1:1031451-1031473 CAAAGGGCCATTGAGGCCCCAGG - Intronic
900117962 1:1036572-1036594 CCCAGGCCCAGCGCTGCCCCAGG - Intronic
900287128 1:1907151-1907173 AGCAGGGCCATCCAGGCCCAGGG + Intergenic
900324584 1:2102168-2102190 GGCAGGGCCAGGCAGGCACCAGG - Intronic
900639948 1:3683918-3683940 GGCAGGGCCAGTGAGGCCTCCGG + Intronic
900642245 1:3693374-3693396 CGCTGGGCCAGCCTGGCCCTGGG + Intronic
900783107 1:4630782-4630804 TGCTGGGCCTGCGAGACCCCAGG + Intergenic
901086260 1:6613955-6613977 CGCAGGGCGAGGGCGGACCCGGG - Exonic
901087437 1:6620031-6620053 CGCAGGGACAGTGATGCGCCTGG + Exonic
901639815 1:10687514-10687536 CTGAGGGCCAGCCAGGCGCCAGG - Intronic
901879296 1:12184763-12184785 CACAGGGCCAGGGCGGCTCCAGG - Intronic
902214240 1:14924448-14924470 GGCCGGGCCCGCGCGGCCCCCGG + Intronic
902262467 1:15237072-15237094 TGCAGGGCAAGGGAGGCCTCAGG - Intergenic
902811814 1:18892334-18892356 GACAGAGACAGCGAGGCCCCTGG + Intronic
903269534 1:22178697-22178719 GGCAGGGGCAGCCGGGCCCCAGG - Intergenic
903299185 1:22365903-22365925 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
903397168 1:23010625-23010647 CACAGGGCCAGGGAGGAACCAGG + Intergenic
903420848 1:23217191-23217213 CCCCGGGCCCCCGAGGCCCCAGG + Intergenic
903606426 1:24578312-24578334 CTGAGGGCCAGCAAAGCCCCCGG - Intronic
904606524 1:31700935-31700957 CCCAGGGCGAGGGAGGCCCATGG - Intronic
905765235 1:40595224-40595246 GGCAGGGCCCAGGAGGCCCCTGG - Intergenic
905896178 1:41547394-41547416 GGGAGGGCCAGGGAGGCTCCAGG + Intronic
907268557 1:53277128-53277150 AGCCGGACCAGCGGGGCCCCAGG - Intronic
910147535 1:84100082-84100104 CACATGGCCAGAGAGGCCTCAGG + Intronic
911073162 1:93847831-93847853 CCCTGGGCCACCGAGGCCCGGGG - Intergenic
911255615 1:95629582-95629604 CGCATGGCTAGGGAGGCCTCAGG - Intergenic
911306192 1:96235211-96235233 CAAAGGGACAGGGAGGCCCCTGG - Intergenic
911994639 1:104750005-104750027 AGCATGGCCAGGGAGGCCTCAGG + Intergenic
912474654 1:109927910-109927932 CACAGGCCCAGCTAGGGCCCAGG - Intronic
914754274 1:150553994-150554016 AGCAGGGGCAGCCAGGCGCCCGG - Exonic
914983802 1:152439679-152439701 CTCAGGGCTAGCGAGGTGCCTGG - Intergenic
918097447 1:181346767-181346789 GGCAGGGACAGGGAGGCACCTGG + Intergenic
918534578 1:185560006-185560028 CATAGGGCCAGCCAGGCTCCTGG + Intergenic
919129090 1:193431972-193431994 CACAGGGCTAGGGAGGCCCCAGG + Intergenic
921152601 1:212414250-212414272 CGCGGGGACAGCGAGGCCTTGGG + Intronic
921324845 1:213980023-213980045 CGCAGGGCCCCCGAGGCTGCGGG + Intergenic
922098385 1:222461723-222461745 CACAGGGCTAGGGAGGCCTCAGG - Intergenic
922306978 1:224352737-224352759 CCCAGGGCCGGCGGGGCCCGCGG + Intergenic
922503126 1:226110882-226110904 AGCAAGGTCAGCAAGGCCCCGGG - Intergenic
922561760 1:226574852-226574874 CTCGGGGTCAGCGGGGCCCCAGG + Intronic
923719776 1:236456839-236456861 CGCTGGGTCAGTGAGGCCACAGG - Intronic
1063449216 10:6140320-6140342 GGCAGGGCCAGCCAGGTCCACGG - Intergenic
1063594170 10:7418511-7418533 CGCAGGGCTGGGGAGGCCTCAGG + Intergenic
1064389101 10:14926067-14926089 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
1065945312 10:30600804-30600826 CTCAGGGCCAGCTAGGTGCCTGG + Intergenic
1066542112 10:36458609-36458631 CACAGGGCTGGGGAGGCCCCAGG + Intergenic
1067087285 10:43249658-43249680 CCCAGGGCCAGCCAGGGTCCAGG - Intronic
1069211951 10:65772902-65772924 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1069426648 10:68294409-68294431 GGCAGAGCCAGCAAGGCCCCAGG - Intronic
1070451070 10:76557629-76557651 AGCATGTCCAGGGAGGCCCCAGG - Intronic
1070931014 10:80260594-80260616 CGCAGGCACACCAAGGCCCCCGG + Intergenic
1071717648 10:88113497-88113519 TGAAGGGCCAGCCAGGCACCAGG + Intergenic
1071927763 10:90430419-90430441 CGCAGGGCTAGGGAAGCCTCAGG - Intergenic
1072770086 10:98130621-98130643 AGCATGGCCAGAGAGGCCTCAGG + Intergenic
1073425362 10:103452505-103452527 CGGAGGGCCAGCACGGCCCAGGG - Intergenic
1074119029 10:110479597-110479619 CACAGGGCCAGTGAGTCCCCTGG + Intergenic
1074481749 10:113828704-113828726 CGCATGGCTAGGGAGGCCTCAGG + Intergenic
1075711800 10:124534630-124534652 CTGAGGCCCAGTGAGGCCCCCGG + Intronic
1076043787 10:127274474-127274496 TGGAGGGCCAGCGAGAGCCCTGG + Intronic
1076370071 10:129946948-129946970 TCCCCGGCCAGCGAGGCCCCAGG - Intronic
1076846673 10:133072536-133072558 GGCAGGGCCAGGCAGTCCCCCGG - Intronic
1076911010 10:133389621-133389643 CGCTGTGCCAGCGAGACCGCAGG - Exonic
1077490327 11:2858102-2858124 GGCTGGGCCAGCCAGGCGCCGGG - Intergenic
1078553955 11:12302954-12302976 CACATTGCCAGGGAGGCCCCAGG + Intronic
1078565415 11:12410182-12410204 GGCTGGGCCACCCAGGCCCCCGG + Intronic
1079304451 11:19310005-19310027 CCCTGGTCCAGCCAGGCCCCGGG - Intergenic
1080332388 11:31154183-31154205 AGCATGGCCAGGGAGGCCTCAGG - Intronic
1080740092 11:35055827-35055849 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
1080889019 11:36392657-36392679 CGCATGGCTAGGGAGGCCTCAGG + Intronic
1081309943 11:41557864-41557886 CACAGGGCTAGGGAGGCCTCAGG - Intergenic
1082759727 11:57115629-57115651 TGCAGGGCCGGGGAGGCCTCAGG - Intergenic
1083472070 11:62890710-62890732 CGCAGGACCAGCCAGGCACGTGG - Intergenic
1083669410 11:64291821-64291843 CTCAGGGGCAGGGACGCCCCAGG + Intronic
1084040456 11:66539618-66539640 CGAGGGCCCAGCGGGGCCCCAGG + Exonic
1084074437 11:66762211-66762233 TGCAGGGCCCGCGAGGCCGCAGG + Intronic
1084277799 11:68063893-68063915 TGCATGGCCAGGGAGGCCTCAGG - Intronic
1084385611 11:68841431-68841453 CCCGGGGCCAGCGGGGCCACCGG - Intronic
1084566613 11:69932199-69932221 AGCAGGGCCAGCGGGGGTCCTGG + Intergenic
1085303725 11:75473528-75473550 GGGAGGGCCAGTGAGGCCTCAGG - Intronic
1087634491 11:100687378-100687400 CGCGGGGGCGGCGAGGCTCCGGG - Intergenic
1088519180 11:110676367-110676389 CTCAGGGCTAGGGAGGCCTCAGG + Intronic
1088535699 11:110858570-110858592 CCCAGAGCCAGCAAGGTCCCTGG + Intergenic
1089180595 11:116580562-116580584 CGCAGGGCCCGCGAGGCGCCCGG + Intergenic
1089522984 11:119078037-119078059 CGCAGCGATAGGGAGGCCCCAGG + Exonic
1089712502 11:120325618-120325640 CGCCGTCCCTGCGAGGCCCCGGG + Intronic
1092779025 12:11968189-11968211 CACAGGGGCAGCGAGGGCCCTGG + Intergenic
1093810414 12:23485791-23485813 AGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1094048595 12:26195432-26195454 CGCAGCGCCTGCCGGGCCCCGGG - Intronic
1094218496 12:27970317-27970339 CGCGGGGCGAGCGAGGGCGCAGG + Intronic
1095655746 12:44667881-44667903 CTCAGGGCCTGTGAGGGCCCAGG - Intronic
1096077565 12:48814842-48814864 CGCCGGGCCAGCGAGCCCAAGGG + Intronic
1096116877 12:49060159-49060181 CGCGGGGCCGGCGGGGCCGCGGG + Intergenic
1096503801 12:52080800-52080822 CCCAGGGCCACCCAGGCCCCTGG - Intergenic
1096587347 12:52631434-52631456 CCCAGGACCAGCAAGACCCCAGG + Intergenic
1097333256 12:58355233-58355255 CGCATGGCTAGGGAGGCCTCAGG - Intergenic
1098593065 12:72237709-72237731 CGCATGGCTAGGGAGGCCTCAGG - Intronic
1101068230 12:101045758-101045780 GGCAGGGCCACCGGGGTCCCTGG - Intronic
1101192901 12:102353624-102353646 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1101741498 12:107503421-107503443 TCCAGGGTCAGCAAGGCCCCAGG + Intronic
1101959695 12:109239580-109239602 TCCAGGGTCAGCAAGGCCCCAGG + Intronic
1102234741 12:111287262-111287284 CTCATGGCCAGCAGGGCCCCTGG + Intronic
1103439844 12:120954992-120955014 CGCAGGGACAACGTGGACCCAGG - Intergenic
1103722279 12:122981269-122981291 CGCAAGGCCAGCACGGCCCCTGG + Exonic
1104611248 12:130229517-130229539 CGCATGGCTGGGGAGGCCCCAGG + Intergenic
1104906536 12:132216457-132216479 CGCAGGCCCAGCGAGGAGCCAGG + Intronic
1105979236 13:25501583-25501605 CCCAGGGTCAGTGAAGCCCCAGG + Intronic
1106395701 13:29379100-29379122 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
1106838483 13:33661548-33661570 CGCATGGCCGGGGAGGCCTCAGG + Intergenic
1108065396 13:46572184-46572206 AGCAGGGTCAGGGAGTCCCCAGG - Intronic
1108154740 13:47573688-47573710 TGCAGGGCCTGGGAGGCCCCAGG - Intergenic
1108229023 13:48318543-48318565 GGCAAAGCCAGCGAGGTCCCGGG - Intronic
1108490904 13:50980502-50980524 CACAGGGCTAGGGAGGCCTCAGG - Intergenic
1109171789 13:59106622-59106644 TGCAGGGCTAGGGAGGCCTCAGG - Intergenic
1111038021 13:82704871-82704893 CGCAAGGCTTGGGAGGCCCCAGG + Intergenic
1111619316 13:90703446-90703468 CACAGGGCTAGGGAGGCCTCAGG + Intergenic
1112290745 13:98142905-98142927 CGCTGGGCTCGGGAGGCCCCTGG + Intronic
1112494872 13:99896444-99896466 CCCAGGGCCGGCGGGACCCCAGG - Exonic
1113483134 13:110636145-110636167 CCCAGCGCCAGCGAGGCATCTGG + Intronic
1114580059 14:23749123-23749145 AGCAGGGCCTGAGAGACCCCAGG - Intergenic
1116077349 14:40127606-40127628 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
1119676895 14:76562563-76562585 CACAGTGCCATAGAGGCCCCAGG + Intergenic
1120207355 14:81600889-81600911 CCCAGGGTCAGCAAGGCCTCAGG - Intergenic
1120318057 14:82921438-82921460 TGCATGGCCAGGGAGGCCTCAGG - Intergenic
1120377927 14:83733138-83733160 CACAGGGCTGGGGAGGCCCCAGG - Intergenic
1121318472 14:92976054-92976076 TGCAGGGCCAGGGAGGCCTTAGG - Intronic
1121436193 14:93921741-93921763 CCCTGGGCTAGCAAGGCCCCTGG + Intronic
1122022123 14:98846735-98846757 TGCAGGGCCGGGGAGGCCTCAGG - Intergenic
1122059085 14:99124676-99124698 GGCTGGCCCAGCGAGGGCCCTGG - Intergenic
1122079121 14:99254632-99254654 GCCGGGGCCAGCGAGGCCCTGGG + Intronic
1122211754 14:100178214-100178236 CGCTGGGCCCGCGACTCCCCTGG - Intergenic
1122272408 14:100574098-100574120 CCCAGCACCAGCGAGGCCCTTGG - Intronic
1122722308 14:103729028-103729050 CTCAGTGCCACCGAGGCTCCCGG - Intronic
1122829892 14:104390751-104390773 CTCAAGGCCAGCGATGTCCCAGG + Intergenic
1122881842 14:104693788-104693810 CCCAGGGCCTGCAAGGACCCAGG - Intronic
1122904322 14:104795110-104795132 CGCTGGGCCAGCGAGGCAGCCGG - Intronic
1122959373 14:105087528-105087550 GGAAGGGCCAGGGAGGCTCCTGG - Intergenic
1124048451 15:26173124-26173146 CGCATGGCCTGGGAGGCCTCAGG + Intergenic
1125021177 15:34988268-34988290 CGCAGGGCCGGCGCGGCAACGGG + Exonic
1129091049 15:73151538-73151560 TGCAGGGCTAGGGAGGCCTCGGG + Intronic
1129092643 15:73167400-73167422 CTCAGGGCCAGCTAGGTGCCTGG + Intronic
1129819900 15:78592429-78592451 TTCAGGGCCAGGGAAGCCCCTGG + Intronic
1130023673 15:80252032-80252054 CGCCGGCCCAGCCAGGACCCCGG - Intergenic
1130026237 15:80272891-80272913 TGCAGGGCTAGGGAGGCCTCAGG - Intergenic
1130411835 15:83654222-83654244 CGCCGAGCCCGCGCGGCCCCGGG + Exonic
1131066022 15:89435581-89435603 CTCAGCCCCAGGGAGGCCCCAGG - Intergenic
1131924716 15:97369658-97369680 CGCATGACCAGGGAGGCCTCAGG - Intergenic
1131962841 15:97807587-97807609 AGCAGAACCAGCAAGGCCCCTGG + Intergenic
1132112711 15:99114187-99114209 CGCAGGGCTGGGGAGGCCTCAGG + Intronic
1132208003 15:99999593-99999615 ACCAGGGCCAGCCAGGCCCTAGG - Intronic
1132525722 16:413595-413617 CCCAGGACCAGCCAGGCCACTGG + Intergenic
1132578204 16:673593-673615 TGAAGAGCCAGTGAGGCCCCTGG + Exonic
1132606699 16:796650-796672 CTCAGGGCCAGAGAGCCGCCGGG - Intronic
1132796098 16:1723790-1723812 CTGGGGGCCAGTGAGGCCCCAGG - Intronic
1132838057 16:1964572-1964594 CCCAGGGCCACCAGGGCCCCCGG + Exonic
1132908685 16:2297583-2297605 CGCAAGGCCAGCCTGGGCCCGGG - Intronic
1135170915 16:20182603-20182625 CGCAGGGCCAGGAAGAGCCCTGG + Intergenic
1135685612 16:24496227-24496249 CTCAGGGCCAGCTAGGTGCCTGG + Intergenic
1135743259 16:24994958-24994980 CGCAGGGCTGGGGAGGCCTCAGG + Intronic
1135891678 16:26363136-26363158 AGCACGGGCAGCGAGGCCCCGGG - Intergenic
1137524746 16:49224847-49224869 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1137567371 16:49541876-49541898 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
1137618185 16:49858794-49858816 GGCAGGGGCCGCGAGGCGCCTGG + Intergenic
1139507473 16:67406329-67406351 TGCAGGGCCAGCGATCCCGCCGG - Exonic
1140772220 16:78215536-78215558 CGCATGGCTAGGGAGGCCTCAGG - Intronic
1140908779 16:79432269-79432291 CGCATGGCTAGGGAGGCCTCAGG - Intergenic
1141648202 16:85378494-85378516 CCCAGGGCCAGAGAGACCCCAGG + Intergenic
1141773985 16:86110129-86110151 AGCAGCCCCAGCGAGGCCCAAGG - Intergenic
1141845747 16:86607802-86607824 TGCAGGGCTGGGGAGGCCCCAGG + Intergenic
1141955066 16:87365250-87365272 AGCAGGGGCAGCGAGCTCCCTGG + Intronic
1142110283 16:88327498-88327520 CCCAGGGCCAGCTAGGGGCCAGG + Intergenic
1142113512 16:88344644-88344666 CACAGGCCCAGAGAGGGCCCGGG - Intergenic
1142193052 16:88726662-88726684 AGCGGGGCCAGCGGGGCCCCAGG + Intronic
1142247937 16:88978370-88978392 CCCAGGGCAGGGGAGGCCCCGGG - Intergenic
1142550013 17:732612-732634 CGCGGCGCCAGCGAGGCGGCCGG + Exonic
1142638268 17:1270935-1270957 CGCAGGGCCCGCGGGGCGCGGGG - Exonic
1143095077 17:4474427-4474449 CCCAGGGACAGCGAGCCCCCAGG + Intronic
1143240399 17:5438878-5438900 CGCAGGGTCCGCGAGGCCGCAGG + Exonic
1143503438 17:7351708-7351730 CGCGGGGCCAGCGAGCCCCAGGG - Intergenic
1143527005 17:7478964-7478986 CGCAGGGCGAGCTGGGGCCCCGG - Intronic
1143719372 17:8799168-8799190 CGCAGGGCGGGCGCGGCCCCAGG + Exonic
1143783637 17:9241858-9241880 GTGAGGGCCAGCGTGGCCCCTGG - Exonic
1143784128 17:9244218-9244240 AGCACGGCCAGCAAGGCCCTAGG - Intergenic
1143784294 17:9245168-9245190 CCCAGGGCCAGCGGGGCCGCTGG + Intergenic
1144519645 17:15945226-15945248 GGCCGGGCCAGCTGGGCCCCGGG - Exonic
1144631956 17:16878234-16878256 CCCAGGTCCACCGAGGGCCCCGG - Intergenic
1144670602 17:17130611-17130633 AGCAGGCCCAGCGTGGACCCTGG + Intronic
1144740119 17:17577066-17577088 AGCAGGGCCTGTGAGCCCCCAGG + Intronic
1144942778 17:18952869-18952891 TCCAGGGGCAGCGGGGCCCCTGG + Intronic
1144949908 17:18988574-18988596 TTCAGGGCAAGAGAGGCCCCTGG - Intronic
1145242498 17:21248122-21248144 CACTGGGCCAGCGAGGAGCCAGG + Intronic
1145956598 17:28858977-28858999 CACAGGCCCAGCCAGGGCCCTGG + Exonic
1148105795 17:45118206-45118228 GGCTGGGCCAGGAAGGCCCCAGG + Intronic
1148143616 17:45345541-45345563 GGCAGGGCAAGCTAGACCCCAGG - Intergenic
1148271737 17:46266946-46266968 GGCAGGGCCGGCGGGGCCCTCGG - Intergenic
1150267827 17:63842471-63842493 CGCGGGGCCCGCGGGGCCCATGG + Exonic
1150352749 17:64458608-64458630 CTCAGGGCAAGAGAGGCCTCTGG + Intronic
1150353748 17:64466028-64466050 CGCAGGGCTTGGGAGGCCTCGGG + Intronic
1150625870 17:66840761-66840783 CGCAGTGACAGCGAGACCCCAGG + Intronic
1150666558 17:67144688-67144710 CGCAGGGCCACCAAGGCTTCTGG + Intronic
1150790319 17:68197192-68197214 CGCAGGGACAGCAAATCCCCAGG + Intergenic
1151014217 17:70535565-70535587 CGCATGGCTAGGGAGGCCTCAGG + Intergenic
1151384777 17:73748391-73748413 CCCAGGGCTAGCGAGGGGCCCGG + Intergenic
1151403875 17:73874375-73874397 CTCAGGGTCAGCCAGACCCCAGG - Intergenic
1151969782 17:77451630-77451652 CCCAGGGACAGCGTGGCTCCCGG - Intronic
1152108353 17:78343287-78343309 TGCCCGGCCAGAGAGGCCCCTGG + Intergenic
1152190155 17:78883315-78883337 GGCTGGGACAGAGAGGCCCCAGG + Intronic
1152245439 17:79182733-79182755 CGCCTGGCGAGGGAGGCCCCAGG - Intronic
1152321721 17:79611583-79611605 CCCAGGGACAGCGAGGCACAAGG - Intergenic
1152572694 17:81127520-81127542 GGCAGGGCAAGGGAGGGCCCCGG + Intronic
1152819619 17:82430134-82430156 CGGAGGGGCAGAGTGGCCCCGGG - Intronic
1155508235 18:26550965-26550987 CCCGGAGCCAGCGCGGCCCCCGG - Intronic
1156169473 18:34464374-34464396 TGCATGGCCAGGGAGGCCTCAGG + Intergenic
1156452557 18:37274920-37274942 AGCAGGGCCAGGGAGGGGCCGGG + Intronic
1157331640 18:46708433-46708455 TCCAGGGTCAGCAAGGCCCCAGG - Intronic
1157453129 18:47802699-47802721 AGCAGGGAAAGCGAGGGCCCAGG - Intergenic
1158548213 18:58413797-58413819 CGCAGAGGAAGCAAGGCCCCAGG - Intergenic
1158903204 18:61985520-61985542 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
1159586724 18:70289213-70289235 GGCCGGGCCAGGGAGGCCGCCGG + Intronic
1159952189 18:74492756-74492778 CACAGGGCCAGAGAGTCTCCTGG + Intergenic
1160009071 18:75089958-75089980 CGCAGAGGCACAGAGGCCCCGGG + Intergenic
1160866183 19:1257171-1257193 GGCAGCCCCAGCGAGGCCTCCGG + Exonic
1160918868 19:1510577-1510599 CGCCGGCCCAGCCCGGCCCCTGG - Intronic
1160967733 19:1753939-1753961 GGCATGGCCTGCGAGGCGCCGGG + Exonic
1161114278 19:2488211-2488233 CGCTGGGCCAGGGAGACCGCAGG + Intergenic
1161263014 19:3347977-3347999 CGCAGGGACGGAGGGGCCCCAGG + Intergenic
1162787616 19:13045545-13045567 AGCAGGGCAAGCCAGGCCCAAGG + Intronic
1162997151 19:14343421-14343443 CACAGAGCCAGCCAGGCCCCTGG + Intergenic
1163294492 19:16403566-16403588 CGCAGGGCCAAGGACTCCCCAGG - Intronic
1163575748 19:18110018-18110040 CGCAGGGACGCCGAGGCCGCCGG - Intronic
1163669742 19:18620575-18620597 CTCAGGGCAAGTGAGGCCCGAGG - Exonic
1165096193 19:33411197-33411219 CGCAGGGCCGCAGAGGCCACGGG + Intronic
1165129194 19:33621787-33621809 CGCGGCGCCCGCGAGCCCCCGGG + Intergenic
1165354183 19:35293660-35293682 AGCAGGGCCAGGAAGGCCCAGGG - Intronic
1165357536 19:35313131-35313153 CGCAGGCCCAGCGAGCCCTGCGG - Intronic
1165533911 19:36427016-36427038 CGCATGGCTAGGGAGGCCTCAGG - Intergenic
1165896582 19:39145250-39145272 CGCAGGGCCAGCGACGCCTGGGG - Intronic
1166795657 19:45423881-45423903 AGCACGGCCAGCGTGGCCCAGGG + Intronic
1166853848 19:45772735-45772757 CCCAGGGACAGTGAGGTCCCAGG - Exonic
925063318 2:910182-910204 CGCAGTGCAGGCGAGGACCCCGG - Intergenic
925139759 2:1542037-1542059 GGCAGTGCCAGCAAGTCCCCTGG + Intronic
925181137 2:1817637-1817659 AGCAGGCCCAGCGCGGCCCTGGG + Intronic
925256910 2:2498233-2498255 TGCAGGGCTGGGGAGGCCCCAGG - Intergenic
925672412 2:6325568-6325590 AGCAGGCTCAGCGAGGCCCAGGG - Intergenic
925897088 2:8480896-8480918 CCTAGGGCCAGGGAGGGCCCTGG - Intergenic
925922079 2:8645035-8645057 CACCGGGCCAGTGAGGTCCCTGG - Intergenic
926198814 2:10778977-10778999 CGCAGGGCCCGAGTGGCTCCTGG + Intronic
926346132 2:11947348-11947370 CACAGGGCCCGGGAGGCCTCAGG + Intergenic
926891594 2:17643861-17643883 GGGAGAGCCAGCAAGGCCCCAGG + Intronic
926911559 2:17856369-17856391 TGCAGGGCTGGAGAGGCCCCAGG - Intergenic
928021912 2:27712118-27712140 CTCAGGGCCAGCTGGGACCCCGG - Intronic
928033363 2:27799827-27799849 CGCAGAGCAAGCCTGGCCCCTGG - Intronic
928605797 2:32944522-32944544 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
929075590 2:38076728-38076750 CTCAGGGCCAGCTGCGCCCCAGG - Intronic
929444007 2:41988781-41988803 CACAGGGCTAGGGAGGCCTCAGG + Intergenic
930333496 2:50016503-50016525 CGCAGGGCTACGGAGGCCTCAGG + Intronic
931931377 2:67139547-67139569 TGCATGGCCAGGGAGGCCTCAGG + Intergenic
932440193 2:71729966-71729988 CACAGGGCTGGAGAGGCCCCAGG + Intergenic
934653303 2:96104394-96104416 CCCCAGGCCAGCGAGGCCCCAGG - Intergenic
934700714 2:96437806-96437828 TGCATGGCCAGGGAGGCCTCAGG - Intergenic
934844932 2:97656571-97656593 GGCAGGGCCAGCTAGGCCTGTGG - Exonic
935313344 2:101806938-101806960 GCCAGGGCCAGCCAGGCCCAGGG - Intronic
935392001 2:102562625-102562647 CTCAGGGCTAGGGAGGCCTCAGG + Intergenic
935855832 2:107271841-107271863 CGCATGGCTAGGGAGGCCTCAGG - Intergenic
936086375 2:109472303-109472325 AGGAGGGCCCGGGAGGCCCCTGG - Intronic
936940740 2:117881957-117881979 TGCATGGCCAGGGAGGCCTCAGG - Intergenic
937209149 2:120256626-120256648 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
937336845 2:121067449-121067471 CCCAGGGGCAGAGAGACCCCAGG - Intergenic
937760950 2:125603119-125603141 CACATGGCCAGGGAGGCCTCAGG - Intergenic
937907726 2:127060538-127060560 CACAGGGCCAGCCAGGGCGCGGG + Intronic
937913817 2:127089241-127089263 CCCAGGACCACAGAGGCCCCTGG + Intronic
938109702 2:128555598-128555620 CGCAAGGCCAGGGAGGCCCCTGG - Intergenic
938133391 2:128735652-128735674 CGGAGGGGCAGCAAGGCCCTGGG + Intergenic
938138144 2:128775711-128775733 CACAGGGACAGCGATGGCCCTGG - Intergenic
939037272 2:137148264-137148286 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
939683010 2:145162035-145162057 AGCATGGCCAGGGAGGCCTCAGG + Intergenic
940578957 2:155551223-155551245 CTCAGGGCCAGAGAGACCTCAGG + Intergenic
940598750 2:155829439-155829461 CCCATGGCCAGGGAGGCCTCAGG + Intergenic
941580757 2:167293349-167293371 GGCAGCGCCCGCGACGCCCCCGG + Intergenic
942278621 2:174340628-174340650 CCCAGAGGCAGCGGGGCCCCGGG + Intergenic
943112685 2:183625207-183625229 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
944304101 2:198158722-198158744 AGCAGGGCTAGAGAGTCCCCAGG - Intronic
944911804 2:204317826-204317848 CGCAGGGCCCGCCAGACCCACGG - Intergenic
945336466 2:208598931-208598953 TGCATGGCCAGGGAGGCCTCAGG + Intronic
945931057 2:215855024-215855046 CACAGGGGCAGAGAGGCCCAAGG + Intergenic
946059364 2:216928490-216928512 TGCATGGCCAGGGAGGCCTCAGG + Intergenic
946274275 2:218618899-218618921 TGCAGGGCTAGGGAGGCCCAAGG + Intronic
947334396 2:229067035-229067057 TGCAGGGCTAGGGAGGCCTCAGG + Intronic
948267773 2:236648619-236648641 CGCAGGGCTGGGGAGGCCTCAGG + Intergenic
948311653 2:236991646-236991668 TGCAGGGCCGGGGAGGCCTCAGG - Intergenic
948569160 2:238906727-238906749 AGGAGGTCCAGGGAGGCCCCAGG - Intronic
948880692 2:240855849-240855871 CACTGGGGCAGCGAGGCCCACGG - Intergenic
1169131578 20:3168560-3168582 CGCAGGGGGAGCCAGGCCTCGGG + Intronic
1169257541 20:4110627-4110649 CTCAGGGCCAGCCAGGCCATAGG - Intergenic
1169580765 20:7021435-7021457 TGCAGGGCTAGGGAGGCCTCAGG - Intergenic
1171175484 20:23048783-23048805 CACTGGGCCAGGGAGGCGCCGGG - Exonic
1171899398 20:30843225-30843247 CACATGGCCAGGGAGGCCTCAGG - Intergenic
1172774166 20:37397635-37397657 CTGAGGGGCAGGGAGGCCCCAGG + Intronic
1173631808 20:44521877-44521899 CGCAGGTCCGGCGAGGACTCGGG + Intronic
1174863167 20:54111570-54111592 CGCATGGCCAAGGAGGCCTCAGG + Intergenic
1174985969 20:55452406-55452428 TGCAGGGCTAGGGAGGCCTCAGG - Intergenic
1175496169 20:59415802-59415824 TGCAGAGCCAGTGAGGCCCATGG + Intergenic
1175822032 20:61915213-61915235 GGCAGGGCCAGCGAGGAACCTGG - Intronic
1175921011 20:62450712-62450734 TGCAGGGCCAGGCAGGCACCAGG + Intergenic
1176156994 20:63626955-63626977 AGCAGGCCCGGCGCGGCCCCAGG - Intronic
1176212293 20:63930805-63930827 TGCATGGCCTCCGAGGCCCCTGG - Intronic
1177338105 21:19759993-19760015 GGCAGGACCTGCGAGGCCGCAGG + Intergenic
1178218283 21:30625608-30625630 CACAGGGGCAGCAGGGCCCCGGG + Intergenic
1178377186 21:32076517-32076539 TGCGAGGCCGGCGAGGCCCCAGG + Intergenic
1179070074 21:38063447-38063469 TGCATGGCCAGGGAGGCCTCAGG + Intronic
1179346488 21:40562378-40562400 CACATGGCTAGGGAGGCCCCAGG - Intronic
1179545023 21:42107940-42107962 CGCAGAGCCAGCGAGAGCCCAGG - Intronic
1179608187 21:42531924-42531946 AGAAGGGCCAGAGAGGCGCCCGG + Intronic
1180036888 21:45254712-45254734 CGGAGGGCCAGGGAGGAGCCTGG + Intergenic
1180072754 21:45444630-45444652 TGCAGGGCGAGAGAGGCTCCGGG + Intronic
1180170997 21:46058115-46058137 AGCAGGGACAGTGAGGCCTCAGG + Intergenic
1180177457 21:46097744-46097766 CGCAGGGCCGACGGGGGCCCTGG - Intergenic
1180333212 22:11551503-11551525 CACATGGCCAGGGAGGCCTCAGG - Intergenic
1180762837 22:18222475-18222497 GGCACAGCCAGCGAGGCCCCGGG + Intergenic
1180772809 22:18402072-18402094 GGCACAGCCAGCGAGGCCCCGGG - Intergenic
1180772830 22:18402133-18402155 GGCACAGCCAGCGAGGCCCCGGG - Intergenic
1180804188 22:18651688-18651710 GGCACAGCCAGCGAGGCCCCGGG - Intergenic
1180806565 22:18717728-18717750 GGCACAGCCAGCGAGGCCCCGGG + Intergenic
1180806586 22:18717789-18717811 GGCACAGCCAGCGAGGCCCCGGG + Intergenic
1180874570 22:19169254-19169276 CGCAGGAGCAGCTAGGGCCCAGG + Intergenic
1181217511 22:21343510-21343532 GGCACAGCCAGCGAGGCCCCGGG + Intergenic
1181217532 22:21343571-21343593 GGCACAGCCAGCGAGGCCCCGGG + Intergenic
1181831583 22:25564689-25564711 CGCCGGCCCAGCGAGGCCGCTGG + Intergenic
1182049558 22:27302405-27302427 TCCAGGGCCAGCGAGGTGCCTGG - Intergenic
1182791894 22:32960128-32960150 TCCAGGGCCAGCAAGGCCCAGGG - Intronic
1184198776 22:42950810-42950832 CACAGGCCCAGCGAGGTGCCTGG - Intronic
1185061494 22:48609403-48609425 CGCATGGCCAGTGATGCCACAGG - Intronic
1185182916 22:49373296-49373318 AGCAGGGCCCGGGAGGCCTCAGG + Intergenic
1185239240 22:49733775-49733797 TGCAGGGCTGGCCAGGCCCCTGG + Intergenic
1203234644 22_KI270731v1_random:143060-143082 GGCACAGCCAGCGAGGCCCCGGG - Intergenic
1203234665 22_KI270731v1_random:143121-143143 GGCACAGCCAGCGAGGCCCCGGG - Intergenic
949749945 3:7340328-7340350 CGCATGGCCAGTGAGGCCTTAGG + Intronic
950282391 3:11719442-11719464 CGCAGGGCCAGGCCGGCCCCAGG - Intronic
950321581 3:12059727-12059749 CTCAGGGCTAGCTAGGCGCCTGG + Intronic
950482659 3:13254293-13254315 CTCCTGGCCAGCGAGGCCTCAGG - Intergenic
950522407 3:13504986-13505008 CCCAGGCACAGCGAGGGCCCTGG + Exonic
951217995 3:20041616-20041638 CGCAGGGCCAGCCTGCCCCGCGG - Intronic
952661568 3:35856400-35856422 CACAGTGGCAGCGAGGACCCTGG - Intergenic
953715824 3:45316265-45316287 CAGAGGGACAGAGAGGCCCCGGG + Intergenic
954717158 3:52532652-52532674 CCCTGGGACAGAGAGGCCCCAGG + Intronic
954782956 3:53074023-53074045 GGCAGGCCCTGCGAGGGCCCAGG + Intronic
957032993 3:75264784-75264806 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
957126230 3:76164846-76164868 GGCAGTCCCAGCCAGGCCCCAGG - Intronic
957515784 3:81249218-81249240 TGCAGGGCCAGGGAGGCCTCAGG - Intergenic
958566666 3:95821150-95821172 CGCAGGGCTGGGGAGGCCTCAGG + Intergenic
958949381 3:100400666-100400688 GGCAGGGCCAGTCCGGCCCCGGG - Exonic
959405153 3:105952667-105952689 CGCATGGCTAGGGAGGCCTCAGG + Intergenic
961353224 3:126316869-126316891 AGCAGGACCAGCGAGCCCTCAGG + Intergenic
963939884 3:151087079-151087101 CGCTGGGCCAACTTGGCCCCGGG - Intronic
964299239 3:155269841-155269863 TGCATGGCCAGGGAGGCCTCAGG - Intergenic
965387064 3:168057436-168057458 CGCATGGCTAGGGAGGCCTCAGG + Intronic
966378927 3:179323690-179323712 CGCAGCGCCAGCGAGGACCCAGG - Intronic
967230362 3:187332104-187332126 CACATGGCCAGGGAGGCCTCAGG + Intergenic
968483727 4:848921-848943 CGCAGGGCCAAGGTGGCCTCCGG - Intergenic
968571873 4:1346520-1346542 CCCAGGGCCAGCCCGGGCCCAGG + Intergenic
968941675 4:3642290-3642312 CGCAGAGCAAGCGAGAGCCCCGG - Intergenic
969130529 4:4987795-4987817 TGCGGGGCCAGGGAGGCCCCTGG - Intergenic
969563023 4:7961385-7961407 CGCACGGCCAGCTATGACCCTGG + Intergenic
969582392 4:8072848-8072870 CGCAGGCCCTGCAAGGCCCCTGG + Intronic
969898892 4:10330178-10330200 TGCTGGGCCTGCCAGGCCCCTGG + Intergenic
969908204 4:10417321-10417343 TGCAGGGCTAGAGAGGCCTCAGG + Intergenic
970324241 4:14906652-14906674 CTCAGGGCTAGGGAGGCCTCAGG - Intergenic
971350979 4:25855797-25855819 CTCAGGGCCACTGAGGCACCTGG - Intronic
971352116 4:25863523-25863545 CGCAGGGCGAGTGTGCCCCCTGG + Intronic
971884399 4:32424178-32424200 TGCAGTGGCAACGAGGCCCCAGG + Intergenic
974832768 4:67210108-67210130 TGCAGGGCTGGGGAGGCCCCAGG - Intergenic
975227448 4:71891322-71891344 GGCAGGGGTAGTGAGGCCCCCGG - Intergenic
975417886 4:74127095-74127117 GGCAGGGCCGGGGAGGCCTCAGG - Intronic
981260208 4:142709636-142709658 AGCATGGCCAGGGAGGCCTCAGG - Intronic
982803763 4:159736741-159736763 CGCATGGCTGGGGAGGCCCCAGG - Intergenic
983545398 4:168957983-168958005 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
983636084 4:169899155-169899177 CGCATGGCTAGGGAGGCCTCAGG - Intergenic
985362982 4:189194928-189194950 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
985490063 5:174115-174137 CGCAGGGCCTGCCAGGCTCAGGG + Intronic
986333314 5:6734183-6734205 CGAAGGGCCAGGGAGGCCGCTGG + Intronic
986507643 5:8469756-8469778 CGCAGGGCTAGGGAGGCCTCAGG + Intergenic
986647712 5:9934264-9934286 AGCAGGGCTAGGGAGGCCTCAGG + Intergenic
986648862 5:9944718-9944740 TGCAGGGCCAGTGAGGGGCCTGG - Intergenic
986806050 5:11309971-11309993 AGCAGGGCTGGGGAGGCCCCAGG - Intronic
987597673 5:20021688-20021710 AGCATGGCCAGGGAGGCCTCAGG - Intronic
988133716 5:27140579-27140601 TGCATGGCCAGGGAGGCCTCAGG + Intergenic
989082306 5:37636012-37636034 CACAGGGCTAGGGAGGCCTCAGG - Intronic
989193044 5:38689846-38689868 GGCATGGCTAGGGAGGCCCCAGG - Intergenic
989336490 5:40323307-40323329 TGCATGGCCAGGGAGGCCTCAGG + Intergenic
991080381 5:62592656-62592678 CGCAGGGCTGGGGAGGCCTCAGG + Intronic
991120467 5:63007911-63007933 TGCATGGCTAGGGAGGCCCCAGG + Intergenic
991247462 5:64523172-64523194 CCCAGGTCCAGCAGGGCCCCAGG + Intronic
993391586 5:87325069-87325091 CGCAGGGCTGGGGAGGCCTCAGG + Intronic
995266767 5:110171308-110171330 TGCAGGGCCGGGGAGGCCTCAGG - Intergenic
997346996 5:133199259-133199281 CGCAGGGCCAGCTCAGCCCTGGG - Exonic
997735384 5:136209130-136209152 GGCAGACCCAGCCAGGCCCCGGG + Intergenic
997850931 5:137332053-137332075 AGCAAGGCCTGCAAGGCCCCAGG + Intronic
998674742 5:144394803-144394825 CGCATGGCTAGAGAGGCCTCAGG - Intronic
998990622 5:147811754-147811776 CACAGGGCCAGCAAGGCCATGGG + Intergenic
999775802 5:154812393-154812415 TGCATGGCCAGGGAGGCCTCAGG + Intronic
1000225767 5:159260476-159260498 CACAGGGCTAGGGAGGCCTCAGG - Intergenic
1001316030 5:170641851-170641873 GGCAGGACTAGCGAGGTCCCGGG - Intronic
1001505369 5:172275102-172275124 CGCAGGGCTGGGGAGGCCTCAGG + Intronic
1002307336 5:178291575-178291597 GGCAGGGCCAGCCAAGCCCGGGG + Intronic
1002428750 5:179191155-179191177 CGCAGTGGCCGAGAGGCCCCTGG - Intronic
1002518536 5:179776720-179776742 TGCAGGGCCAGCGAGCCCCGGGG - Exonic
1002638395 5:180619213-180619235 CGCTGGGACGGCGAGACCCCGGG - Intronic
1002925876 6:1605361-1605383 CGCAGGGTGGGCGAGTCCCCAGG - Intergenic
1003181932 6:3799580-3799602 TGCAGGGCCAGGGAGGCCAGAGG - Intergenic
1003212306 6:4079033-4079055 TGCAGGGCCTGCGAAGCCCGCGG + Exonic
1003661264 6:8064395-8064417 CGCAGGCGCAGCGTGGCCGCGGG - Exonic
1003809716 6:9766607-9766629 AGCATGGCCAGGGAGGCCTCAGG + Intronic
1003974125 6:11326747-11326769 GGCAGGGGCAGCTGGGCCCCAGG - Intronic
1005952413 6:30641794-30641816 AGCCGGGCCAACGAGGACCCTGG - Intronic
1006447507 6:34088016-34088038 CCCAGGACTAGCCAGGCCCCAGG + Intronic
1006809125 6:36808535-36808557 CCCAGGGCCAGGGAGGGCCCAGG + Intronic
1006950833 6:37819984-37820006 CGCAGGGACAGCGAGGCGGCAGG - Exonic
1007821057 6:44561066-44561088 CCCAGGGCCAGCAAGGCCACGGG + Intergenic
1008030405 6:46688156-46688178 CGCAGGGCCAGCGAGGCCCCCGG - Exonic
1009614919 6:65991476-65991498 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1009661594 6:66619615-66619637 CGCATGGCTAGGGAGGCCTCAGG + Intergenic
1010208987 6:73348388-73348410 TGCAAGGTCTGCGAGGCCCCGGG + Intergenic
1010722277 6:79296938-79296960 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1011129631 6:84040263-84040285 CGCAGGGCTAGGGAGGCCTCAGG - Intronic
1011598426 6:89038204-89038226 CACAGGGCTAGGGAGGCCTCAGG + Intergenic
1011830978 6:91371052-91371074 AGCATGGCCAGGGAGGCCCTAGG - Intergenic
1012271571 6:97218802-97218824 CCCATGGCCAGAGAGGCCTCAGG + Intronic
1013661080 6:112297728-112297750 CGCATGGCTAGGGAGGCCTCAGG + Intergenic
1014668546 6:124271173-124271195 CACATGGCCAGTGAGGCCCCAGG - Intronic
1015522603 6:134146827-134146849 TGCAGGGCTGGGGAGGCCCCAGG + Intergenic
1015522629 6:134146959-134146981 TGCAGGGCTGGGGAGGCCCCAGG + Intergenic
1015635395 6:135269617-135269639 CCCAGGCCCAGAGAGGCCCATGG + Intergenic
1015842216 6:137488341-137488363 GCCAGGGAGAGCGAGGCCCCGGG + Intergenic
1016452006 6:144192989-144193011 GGCATGGCCAGGGAGGCCTCAGG + Intergenic
1016786059 6:148011681-148011703 CACATGGCCAGGGAGGCCTCAGG - Intergenic
1016948836 6:149560953-149560975 TCCAGGGCCAGCAAGGCCCCAGG + Intergenic
1017121176 6:151025213-151025235 CTCAGGGCCCGCGAGCCCACAGG + Intronic
1017881288 6:158564331-158564353 TGCAGGCCCACTGAGGCCCCAGG - Intronic
1017978009 6:159375111-159375133 CGCAGCCCCAGCCTGGCCCCAGG + Intergenic
1018034059 6:159866804-159866826 CCCAGGCACAGCCAGGCCCCGGG - Intergenic
1018093772 6:160367163-160367185 TGCAGGGCTAGGGAGGCCTCAGG + Intronic
1018137471 6:160791535-160791557 GGCAGGGCCACAGAGTCCCCTGG + Intergenic
1018477837 6:164160493-164160515 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1018710890 6:166497603-166497625 CAAAGGACCAGCGAGGCCCTGGG + Intronic
1018731672 6:166656429-166656451 GGCAGGGCAGGGGAGGCCCCTGG - Intronic
1019111891 6:169723891-169723913 CGCGGGGACAGCGCAGCCCCGGG + Exonic
1019312628 7:370073-370095 CACAGGTACAGCCAGGCCCCTGG - Intergenic
1019536055 7:1530574-1530596 CGCGGGGCCAGCGGCCCCCCGGG + Intergenic
1019725288 7:2598720-2598742 TGGAGGGCCAGCCAGGCCCCAGG + Intronic
1020729565 7:11865089-11865111 TGCAGGGCTAGGGAGGCCTCAGG - Intergenic
1021688711 7:23211932-23211954 CTCAGGGCTAGCTAGGCGCCTGG - Intergenic
1021807913 7:24375176-24375198 TCCAGGGTCAGCAAGGCCCCAGG - Intergenic
1022047958 7:26638423-26638445 CGCAGGGCTGGGGAGGCCTCAGG - Intronic
1022507220 7:30914699-30914721 CTCAGGGCCAGAGAGGCTGCAGG - Intronic
1023376594 7:39562275-39562297 CGCAGGGCTGGGGAGGCCTCAGG + Intergenic
1023563038 7:41495737-41495759 AGCAGGGCCAGGGTGGACCCTGG + Intergenic
1023684108 7:42717450-42717472 CGCATGGCTAGAGAGGCCTCAGG - Intergenic
1025050969 7:55734320-55734342 CACAGGGCTAGGGAGGCCTCAGG - Intergenic
1025258782 7:57403637-57403659 TGCAGGGCCAGAGAGCCCCTTGG - Intergenic
1027156614 7:75772769-75772791 AGCAGGGGCAGGCAGGCCCCAGG + Intronic
1027476739 7:78641131-78641153 TGCAGGGCTAGGGAGGCCTCAGG - Intronic
1027614037 7:80399331-80399353 AGCAGGGCTAGGGAGGCCGCAGG - Intronic
1029258729 7:99287018-99287040 CGCAGGGCCAGAGAGGCACTGGG + Intergenic
1029643588 7:101836916-101836938 CTCAGAGCCATCGAGGGCCCAGG - Intronic
1029729818 7:102432123-102432145 CACAGACCCAGCGAGACCCCTGG - Intergenic
1029977629 7:104849447-104849469 TGCAGGGCCACCCAGCCCCCAGG - Intronic
1031454647 7:121964293-121964315 CGCAGGGCTGGGGAGGCCTCGGG + Intronic
1031656540 7:124362838-124362860 TGCAGGGCCAGGGAGGTCTCAGG - Intergenic
1032087296 7:128890911-128890933 AGGAGGGGCAGCAAGGCCCCTGG + Exonic
1032795055 7:135270150-135270172 GGCAGAGCCAGCGCAGCCCCCGG - Intergenic
1033159343 7:138982036-138982058 CTCAGGGCCTGGGAGGCCCGCGG + Intergenic
1034016289 7:147590512-147590534 CGCATGGCCAGGGAGGCCTCAGG - Intronic
1034160921 7:148993757-148993779 GGCTGTGCCAGCGAGGCTCCTGG + Intergenic
1034395911 7:150824835-150824857 CGCTGGGCCAGGAGGGCCCCGGG - Intronic
1034992657 7:155557966-155557988 GGCAAGGCCAGCGAGGCACATGG + Intergenic
1035252660 7:157607380-157607402 GGCAGGGCCCTAGAGGCCCCTGG - Intronic
1035597973 8:875572-875594 AGCAGGGCTAGGGAGGCCCAAGG - Intergenic
1035727600 8:1834416-1834438 CACAGGCCCAGGGAGGACCCTGG + Intronic
1036061689 8:5329140-5329162 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1036384344 8:8265555-8265577 CGCAGGGCGGGGGAGGCCCCAGG + Intergenic
1036579304 8:10057792-10057814 AGCATGGCCAGGGAGGCCTCAGG - Intronic
1037913701 8:22759246-22759268 CGGAGGCCCAGGGAGGCCCAGGG + Intronic
1038455781 8:27671165-27671187 CCCAGGGCCAGAAGGGCCCCCGG + Exonic
1038903073 8:31865701-31865723 CACAGGGCTAGAGAGGCCTCAGG - Intronic
1039527650 8:38231259-38231281 CGCAGGGACTGCGCGGCCCCGGG - Intronic
1040384967 8:46908790-46908812 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
1040567550 8:48581534-48581556 CGCAGGGCCGGCGTGGCCCTGGG + Intergenic
1042164755 8:65934678-65934700 TGCAGGGCTAGGGAGGCCTCAGG - Intergenic
1045294278 8:100860319-100860341 AGCAGGGCCAGGCAGGACCCAGG + Intergenic
1045717723 8:105067790-105067812 TGCATGGCCAGGGAGGCCTCAGG - Intronic
1046145925 8:110158497-110158519 TGCAGGGCTGGGGAGGCCCCAGG - Intergenic
1046495850 8:115011926-115011948 CACAGGGCTAGCGAGGCCTCAGG - Intergenic
1047079993 8:121449190-121449212 CACAGGGCTAGGGAGGCCTCAGG + Intergenic
1047262588 8:123275206-123275228 AGCGGGGCCAGCGAGGGCCAGGG + Intronic
1047309532 8:123680116-123680138 CGCAGGGCTGGGGAGGCCTCAGG - Intergenic
1048289713 8:133171480-133171502 CGCAGAGTCAACGATGCCCCAGG + Intergenic
1048591708 8:135826597-135826619 TGCAGGGCCGGGGAGGCCTCAGG + Intergenic
1048882732 8:138883782-138883804 CGCATGGCTGGGGAGGCCCCAGG - Intronic
1049213450 8:141397115-141397137 CTCAGGGCCAGAGCGGCTCCTGG + Intronic
1049237174 8:141518211-141518233 CGCAGGTCCCGCGGCGCCCCCGG + Exonic
1049250305 8:141584835-141584857 CGCAGGGCTGGGGAGGCCACAGG - Intergenic
1049538008 8:143191411-143191433 AGCAGGGCCAGGGAGGCCTCAGG + Intergenic
1049583568 8:143423164-143423186 GGCAGGGCCAGCCAGGGCCCGGG - Intronic
1049604701 8:143523945-143523967 CCCAAGGCCAGCCAAGCCCCCGG + Intronic
1049685406 8:143937384-143937406 CGCAGGGAAAGGGAGGCCACCGG + Intronic
1049988610 9:973029-973051 CTTAGGGCCAGCGAGGTCACAGG + Intergenic
1050426793 9:5519409-5519431 TTCAGGGTCAGCAAGGCCCCAGG + Intronic
1055351965 9:75398932-75398954 CGCATGGCTAGAGAGGCCTCAGG + Intergenic
1056148825 9:83764401-83764423 TGCATGGCTAGCGAGGCCTCAGG - Intronic
1056625924 9:88253003-88253025 GGCATGGCCAGGGAGGCCTCAGG - Intergenic
1057906416 9:98987062-98987084 CCCTGGGCCAGAGAGGCCCTTGG - Intronic
1058350003 9:104010112-104010134 CACATGGCCAGAGAGGCCTCAGG - Intergenic
1058990964 9:110255571-110255593 GGCAGGGCAGCCGAGGCCCCCGG + Intronic
1059178710 9:112191735-112191757 CGCATGGCCGGGGAGGCCTCAGG + Intergenic
1060759242 9:126234385-126234407 AGCAGAGCCAGCCAGGCCCATGG + Intergenic
1061145005 9:128792442-128792464 CCAAGGCCCAGCTAGGCCCCGGG - Intronic
1061276155 9:129570292-129570314 AGCTGGGCCAGTGAGGCCCAGGG + Intergenic
1061844015 9:133376508-133376530 CGCAGGGGGAGCGAGGCCCAGGG + Exonic
1061875116 9:133539740-133539762 CGAAGGGACAGGGAGGCTCCGGG - Intronic
1061971096 9:134045940-134045962 CTTAGGTCCAGCTAGGCCCCTGG - Intronic
1062025438 9:134338193-134338215 GGGAGGCCCAGGGAGGCCCCGGG - Intronic
1062267525 9:135694101-135694123 CCCTGTGTCAGCGAGGCCCCTGG - Intronic
1062419992 9:136475995-136476017 CTCAGGCTCAGCCAGGCCCCAGG - Exonic
1062426251 9:136507539-136507561 CTCAGGTCCAGCGAAGCCACGGG + Intronic
1062438331 9:136556964-136556986 GGCAGTCCCAGCCAGGCCCCAGG + Intergenic
1062731324 9:138111752-138111774 CGAAGGGCCAGGGAGGCCTCGGG - Intronic
1203370061 Un_KI270442v1:295050-295072 CACATGGCCAGGGAGGCCTCAGG + Intergenic
1185463292 X:342058-342080 TGCAGGGGCATCGGGGCCCCGGG - Intronic
1185643028 X:1598829-1598851 AGCAGGCCCAACAAGGCCCCGGG - Intronic
1185736470 X:2500430-2500452 CGCGGGGCGTGCGAGCCCCCGGG + Intronic
1185770600 X:2762891-2762913 CTCAAGGCCAGCGAGGTGCCTGG - Intronic
1186055446 X:5644726-5644748 CTCAGGGCCAGCTAGGTGCCTGG + Intergenic
1186177919 X:6944554-6944576 CTCAGGGCCAGCTAGGTGCCTGG - Intergenic
1186620573 X:11236157-11236179 CGCAGGGCTGGGGAGGCCTCAGG + Intronic
1187070245 X:15880628-15880650 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1187663333 X:21574444-21574466 CACAGGGCTAGGGAGGCCTCAGG + Intronic
1188422744 X:30009429-30009451 CGCATGGCCGGGGAGGCCTCAGG - Intergenic
1189268908 X:39736626-39736648 CGCAGGGCCTGCCAGAGCCCAGG + Intergenic
1194137353 X:90162732-90162754 CGCAGGGCTGGGGAGGCCTCAGG + Intergenic
1194338304 X:92677179-92677201 CGCATGGCCAGGGAGGCCTCAGG + Intergenic
1194682008 X:96865601-96865623 CCCAGGGCCTGGCAGGCCCCTGG + Intronic
1195127798 X:101825303-101825325 CGCATGGCTAGGGAGGCCTCAGG + Intergenic
1196518257 X:116640097-116640119 CACAGGGCCAGAGATGCCCAAGG - Intergenic
1197262711 X:124334411-124334433 AGAAGGTCCAGAGAGGCCCCAGG + Intronic
1197262760 X:124334597-124334619 AGAAGGTCCAGAGAGGCCCCAGG + Intronic
1197262807 X:124334783-124334805 AGAAGGTCCAGAGAGGCCCCAGG + Intronic
1197870534 X:131058801-131058823 GACAGGGCAAGCCAGGCCCCAGG + Intronic
1198618615 X:138483033-138483055 CACAGGGCCTGGGAGGCACCTGG - Intergenic
1198991665 X:142521470-142521492 TGCAGGGCTAGGGAGGCCTCAGG + Intergenic
1199204332 X:145130864-145130886 TGCAGGGCCGGGGAGGCCTCAGG + Intergenic
1200067771 X:153512384-153512406 CACAGGGGCAGCCAGGGCCCAGG + Intergenic
1200256423 X:154585347-154585369 CGCAGGGGCAGCAAGGGCCTCGG + Exonic
1200261346 X:154619056-154619078 CGCAGGGGCAGCAAGGGCCTCGG - Exonic
1200267329 X:154653353-154653375 CGCAGGGGCAGCAAGGGCCTCGG - Exonic
1200483085 Y:3732673-3732695 CGCAGGGCTGGGGAGGCCTCAGG + Intergenic
1200646706 Y:5793962-5793984 CGCATGGCCAGGGAGGCCTCAGG + Intergenic