ID: 1008030408

View in Genome Browser
Species Human (GRCh38)
Location 6:46688163-46688185
Sequence GGACACCCGCAGGGCCAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 192}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030408_1008030424 30 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030408_1008030417 20 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030408_1008030419 22 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030408_1008030418 21 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030408_1008030423 29 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030408_1008030421 26 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383
1008030408_1008030416 19 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030408_1008030413 8 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030408 Original CRISPR GGACACCCGCAGGGCCAGCG AGG (reversed) Exonic
900906903 1:5565562-5565584 GGACACACTCAGGGCCATTGAGG + Intergenic
901381636 1:8878471-8878493 GCGCGCCCGCAGGCCCAGCGTGG - Intronic
902112591 1:14095112-14095134 GTACACACCCAGGGCCAGAGAGG - Intergenic
902813349 1:18902178-18902200 GGGAACCGGCAGGGCCACCGAGG + Intronic
904023898 1:27490118-27490140 GGACACAGGCAGGGCGAGCGCGG - Exonic
904045407 1:27605361-27605383 GGACCGCCGCAGGGCCAGTCAGG - Intergenic
904822618 1:33255862-33255884 GGAGACCCCCAGGGGCAGCCTGG + Intergenic
907559637 1:55376763-55376785 GGACACCCGCCTAGCCAGCCAGG + Intergenic
912439543 1:109687897-109687919 GGACATCCGCGGGGTGAGCGAGG + Exonic
913209219 1:116569800-116569822 GGAGACCAGCAGGGCCAACACGG - Intronic
915367366 1:155323651-155323673 GGACAGCAGCAGTGCCAGCTCGG - Intronic
915924766 1:160008082-160008104 GGACACCCTCAGGGCCCTCTAGG + Intergenic
920849430 1:209618595-209618617 GGGCAGCCACAGGGCCAGCACGG + Exonic
921472678 1:215567582-215567604 CGACGGCTGCAGGGCCAGCGGGG - Exonic
1068940995 10:62681218-62681240 GGCCACCAGCAGGGCCAGCATGG - Intergenic
1073461022 10:103665951-103665973 GGACCCCAGCAGGTCCAGCCAGG - Intronic
1075655093 10:124156093-124156115 GTGCCCTCGCAGGGCCAGCGGGG - Intergenic
1076156541 10:128210055-128210077 GGAAGCCCGCAGGGCCCGCGTGG + Intergenic
1077219957 11:1411441-1411463 GGACAGATGCAGGGCCGGCGGGG - Exonic
1077322450 11:1948351-1948373 GGACAGGCGAAGGGCCAGCGTGG - Intronic
1077540810 11:3145684-3145706 CCAGACCAGCAGGGCCAGCGAGG + Intronic
1077580423 11:3413797-3413819 GGAGTCCCGCAGGGACAGCTCGG + Intergenic
1080595847 11:33774054-33774076 GGGCACCTGCGGGGCCAGCGGGG + Intronic
1081547377 11:44081073-44081095 TGACACCCCCAAGGCCAGCCAGG - Intronic
1081705479 11:45180408-45180430 GGACACCCGCCCGGCCTCCGCGG + Intronic
1082189424 11:49224805-49224827 TGACACCAGCAGGGCCAACATGG + Intergenic
1084237351 11:67796626-67796648 GGAGTCCCGCAGGGACAGCTTGG + Intergenic
1086677101 11:89621697-89621719 TGACACCAGCAGGGCCAACATGG - Intergenic
1086733886 11:90282678-90282700 GGACACCAGCCTGGCCAACGTGG - Intergenic
1087857565 11:103110219-103110241 GGAGACCCACATGGCCAACGTGG - Intronic
1091229204 11:133976961-133976983 GGAGAACCACAGGGCCAGGGAGG - Intergenic
1202805468 11_KI270721v1_random:3664-3686 GGACAGGCGAAGGGCCAGCGTGG - Intergenic
1095942974 12:47738396-47738418 GCACACCCAGAGGCCCAGCGGGG + Intronic
1095976333 12:47943101-47943123 GGACAGCAGCAGGGCCAGGGTGG - Intergenic
1096127353 12:49129683-49129705 GGACACCAGCCTGGCCAACGTGG + Exonic
1096134311 12:49186794-49186816 GGACACCAGCCTGGCCAACGTGG + Exonic
1096144596 12:49269482-49269504 GGACACCAGCCTGGCCAACGTGG - Exonic
1096243774 12:49973386-49973408 GGTCACCTGGAAGGCCAGCGGGG + Exonic
1097352423 12:58562900-58562922 GGACACGGGGAGGGCCAGAGTGG + Intronic
1100306154 12:93351874-93351896 GGAGACCTGCAGGGCAAGCAAGG - Intergenic
1102146960 12:110661424-110661446 AGTCACCCGCAGGGCCAAGGTGG - Exonic
1104906534 12:132216450-132216472 GCACAGCCGCAGGCCCAGCGAGG + Intronic
1107036885 13:35911422-35911444 GGACACCCACGGGGCCACAGTGG + Intronic
1107865692 13:44701204-44701226 GGACACATGCACGGCCAGGGAGG + Intergenic
1113750937 13:112776026-112776048 GGACTCCAGCCGGGCCAGGGAGG - Intronic
1113936909 13:113999701-113999723 GGACCCCAGCCGGGACAGCGGGG - Intronic
1118282961 14:64445776-64445798 AGACACCAGCTGGGCCAGCTAGG - Intronic
1122076742 14:99240102-99240124 AGACAACCACAGGGCCAGCAGGG + Intronic
1122119293 14:99543336-99543358 AGCCACCCACAGGACCAGCGGGG + Intronic
1122580548 14:102769039-102769061 GCAGACCCGCAGGACCAGTGGGG - Intergenic
1122817304 14:104320077-104320099 GGACACACGCAGGGGCTGCTGGG - Intergenic
1124375466 15:29126405-29126427 GGGCGCCCACAGGGCCATCGGGG + Exonic
1124516662 15:30372184-30372206 GAACACCAGCAGGGCGAGGGCGG + Exonic
1124726257 15:32158547-32158569 GAACACCAGCAGGGCGAGGGCGG - Exonic
1125021174 15:34988261-34988283 GCACGTCCGCAGGGCCGGCGCGG + Exonic
1127257658 15:57305779-57305801 GGACACCAGCATGGCCAACATGG - Intergenic
1128344055 15:66842644-66842666 GGGCGCCCGCAGGCCCCGCGGGG - Intergenic
1129357556 15:75001666-75001688 GGACACCAGCCTGGCCAACGTGG + Intronic
1129382144 15:75174628-75174650 GGACACGCACAGGGCAAGAGCGG - Intergenic
1132518319 16:376168-376190 GAACACCGGCATGGACAGCGGGG - Exonic
1132667561 16:1089179-1089201 GGACCACCCCAGGGCCAGGGAGG - Intergenic
1133270950 16:4610591-4610613 GGGCAGCGGCAGGGCCGGCGGGG - Intronic
1134685079 16:16152850-16152872 GGACACCCTCAGGGTCAGAGGGG + Intronic
1137944209 16:52718084-52718106 GGACACCTGCAGGCTCACCGTGG - Intergenic
1138549663 16:57740528-57740550 AGGCACCCGGAAGGCCAGCGTGG - Intronic
1138960414 16:62022638-62022660 GGACACCCTCGGGGACAGTGTGG + Intronic
1139290859 16:65856579-65856601 GGACACCAGCAGGGCCAGCCTGG - Intergenic
1139659637 16:68411924-68411946 GGCCACCCTCTGGGCCAGAGGGG + Intronic
1141464248 16:84195994-84196016 GGACACCAGGTGGGCCAGCAGGG - Exonic
1141649522 16:85385605-85385627 TGGCACCCCCAGGGCCAGCCTGG + Intergenic
1141755758 16:85989538-85989560 GGACTCCCGCATGGCCATCAGGG - Intergenic
1142018529 16:87765672-87765694 GCTCTCCCGCAGGGCCGGCGCGG + Intronic
1142432552 16:90037859-90037881 CGCCAACTGCAGGGCCAGCGTGG - Intronic
1144786637 17:17835960-17835982 GGTCACCCCCAGGACCAGCAAGG - Intronic
1147200587 17:38799170-38799192 CGTCACCGGCAGGGCCTGCGGGG + Intronic
1151467929 17:74299725-74299747 GGACACCCGAAAGGGCAGCCTGG + Exonic
1151786093 17:76275760-76275782 GGGGGCCGGCAGGGCCAGCGGGG + Intronic
1151999565 17:77637007-77637029 GGACACCTGCAGGGGCCGGGAGG + Intergenic
1152257899 17:79251007-79251029 GGACACCAGCCGGGCCAACATGG - Intronic
1152471835 17:80493810-80493832 GGACACCTGGAGGCCCAGAGAGG + Intergenic
1152534081 17:80940606-80940628 GGGCACCCGCACAGCCAGCCAGG + Intronic
1152729498 17:81962451-81962473 GGACATACGCAGGGCCAGCGGGG + Intergenic
1153920212 18:9782261-9782283 GGCCACCCCCAGGCCCAGGGCGG + Intronic
1155036119 18:22026419-22026441 GGCCATCTGCAGGGCCAGCCTGG - Intergenic
1155633366 18:27921959-27921981 GGACACCCGCAGGGGAACCCCGG - Intergenic
1160204728 18:76822966-76822988 GGGCCGCGGCAGGGCCAGCGGGG - Intronic
1160804111 19:984252-984274 GGCCACCCGCTGGGGCCGCGGGG + Exonic
1160838514 19:1136032-1136054 GAACACCCGCTCGGCCAGTGCGG - Intronic
1161034765 19:2078417-2078439 GGCCAGCCGCAGGTCCAGCCCGG + Exonic
1161342168 19:3749070-3749092 GGAGACCAGCCTGGCCAGCGTGG - Intronic
1162815175 19:13189798-13189820 GGAAACCCCCAGGGCCACTGTGG + Intergenic
1163008358 19:14410133-14410155 GGACACCCGCACGGCCCACATGG - Intronic
1163777119 19:19225159-19225181 GGGCCCCCGCAGCGCCGGCGCGG - Exonic
1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG + Intergenic
1165431168 19:35774177-35774199 CGACACCAGCATGGCCAGCATGG - Intergenic
1166069589 19:40379316-40379338 GGGCGAGCGCAGGGCCAGCGGGG + Exonic
1166077307 19:40421182-40421204 GGTGACCCGAGGGGCCAGCGGGG - Intergenic
1166854273 19:45775367-45775389 GGAGACCAGCCTGGCCAGCGTGG - Intronic
1166879741 19:45920517-45920539 AGAGACCCCGAGGGCCAGCGAGG + Intergenic
1167492683 19:49801443-49801465 GGACAGCAGCAGCGCCCGCGTGG - Exonic
1168639347 19:58020380-58020402 GGACACACCCAGGGCCACCAGGG - Intergenic
926129359 2:10291912-10291934 GGAGACCAGCTGGGCCAACGTGG - Intergenic
926274258 2:11391593-11391615 AGACACTCTCAGGGCCAGTGAGG - Intergenic
926688846 2:15718729-15718751 GGAAGCCGGCAGGGCCAGGGAGG - Intronic
929762768 2:44819947-44819969 TGACACCAGCAGGGCCTGTGGGG - Intergenic
930041493 2:47128691-47128713 GGACTCCCACTGGGCCAGAGGGG - Intronic
930511584 2:52351862-52351884 GGAGACCAGCTGGGCCAACGTGG - Intergenic
932039316 2:68282215-68282237 GGATACCCACGGGGCCAGCCTGG - Intergenic
932405739 2:71511808-71511830 GGACACCTGCAGGACCAGCGAGG - Exonic
937221302 2:120344554-120344576 GGACAGAGGCAGGGCCTGCGCGG + Intergenic
937309515 2:120893405-120893427 GCTCAGCAGCAGGGCCAGCGGGG - Intronic
938201993 2:129379746-129379768 GGACCTCAGCTGGGCCAGCGTGG - Intergenic
943525135 2:189006939-189006961 GAGCACCAGCAGGGCCAGCAGGG - Exonic
944666200 2:201961553-201961575 GGAGGCCCCCAGGGCCAGAGAGG - Intergenic
948577597 2:238964751-238964773 GGACTCCCTCAGAGCCTGCGGGG + Intergenic
948880693 2:240855856-240855878 GGACACGCACTGGGGCAGCGAGG - Intergenic
1169257542 20:4110634-4110656 GGACAAGCTCAGGGCCAGCCAGG - Intergenic
1170827324 20:19808291-19808313 GGTCCCCAGCAGGGCCAGAGAGG + Intergenic
1171352935 20:24518650-24518672 GGACACGAGCAGGGCCACCCAGG - Intronic
1172908269 20:38385872-38385894 GGATGCCAGCATGGCCAGCGAGG + Intergenic
1172959401 20:38787875-38787897 GGACACCGGCAGCAGCAGCGAGG + Intergenic
1173613623 20:44388756-44388778 GGACGCCCTCCGGCCCAGCGCGG + Intronic
1173820188 20:46014395-46014417 GGATCCCCGGAGCGCCAGCGAGG + Exonic
1175733530 20:61370249-61370271 AGCCACCCCCAGGGCCAGCCAGG - Intronic
1175813950 20:61873952-61873974 GGACACCCACAGGACCCTCGGGG + Intronic
1176177886 20:63737288-63737310 GGTCACCCGCAGGGACACGGAGG + Intronic
1176256197 20:64154425-64154447 GGACAGACCCAGGGCCAGAGGGG - Intronic
1177669728 21:24209176-24209198 GGAGACGCGGAGAGCCAGCGAGG + Intergenic
1181557420 22:23679267-23679289 GGACAACCGCAGGGGCTGAGAGG + Intergenic
1182355315 22:29720187-29720209 GGGGCCCCGCAGGGGCAGCGGGG - Exonic
1182477611 22:30584712-30584734 GGATACCTGCATGGCCAGTGAGG + Exonic
1182483721 22:30626753-30626775 GGAGACCTGCAGGGCCAGGCTGG - Exonic
1182881697 22:33739231-33739253 GCACACCGGCAGGACCAGCCTGG + Intronic
1182903651 22:33919781-33919803 GGACCCCCTCAGGGCCTGCTCGG - Intronic
1183388391 22:37528380-37528402 TGAGACCCGCATGGCCAGCATGG - Intergenic
1184059540 22:42073867-42073889 GGCCACCCACCGGGCCACCGGGG - Intergenic
1184265348 22:43343274-43343296 GCACGCCCGCACGCCCAGCGGGG - Exonic
950153771 3:10707788-10707810 AGACCCCCGCCGGGCCAGGGCGG - Intronic
950282396 3:11719449-11719471 GGTCCCCCGCAGGGCCAGGCCGG - Intronic
954379687 3:50212982-50213004 GGACACCCTGAAGGCCAGCCTGG - Intronic
957053295 3:75426392-75426414 GGAGTCCCGCAGGGACAGCTCGG + Intergenic
959484633 3:106913101-106913123 GGACACCTGGAGGGTGAGCGAGG - Intergenic
961301531 3:125925151-125925173 GGAGTCCCGCAGGGACAGCTCGG - Intergenic
961482416 3:127192741-127192763 GGAGGCCCACAGGGCCAGAGGGG - Intergenic
961627756 3:128275513-128275535 GGGCTCCCCCAGGGCCAGCTTGG - Intronic
968904655 4:3445711-3445733 GGACCCCGGCGGGGCCAGCCCGG + Intronic
969317461 4:6390728-6390750 TGAGAGCCGCAGGGCCACCGGGG + Intronic
970194989 4:13544069-13544091 GGACGCGCGGGGGGCCAGCGGGG - Exonic
974009325 4:56592762-56592784 GGACAGCAGCAGTGCCGGCGGGG + Intronic
974019221 4:56678135-56678157 GGACACTCCCAGCTCCAGCGAGG - Intronic
975796040 4:78007681-78007703 GGAGACCAGCCTGGCCAGCGCGG + Intergenic
979755793 4:124338905-124338927 GGAGACGCCCAGAGCCAGCGAGG - Intergenic
984795887 4:183659462-183659484 GGAGACCCGCGGGGCCAGGCGGG + Intronic
985051789 4:185998730-185998752 GGACACGCTCAGGGGCAGGGTGG - Intergenic
986321216 5:6633761-6633783 GTAGAGCGGCAGGGCCAGCGAGG - Exonic
986648866 5:9944725-9944747 GGGGACCTGCAGGGCCAGTGAGG - Intergenic
987050273 5:14143126-14143148 GGGCTCCCGCAGGGCTGGCGGGG - Intergenic
993278899 5:85898924-85898946 GGACACACCCTGGGCCAGAGAGG - Intergenic
998447285 5:142208152-142208174 TGAGACCAGCACGGCCAGCGTGG - Intergenic
998965640 5:147537715-147537737 GGAGACCAGCCTGGCCAGCGTGG - Intergenic
1005504740 6:26459701-26459723 AGACATCAGCAGGGGCAGCGTGG + Exonic
1006016847 6:31088302-31088324 GGAGACCCGCCTGGCCAGCATGG - Intergenic
1007371313 6:41428308-41428330 GCTCACCTGCAGGGCCAGCCAGG - Intergenic
1007399038 6:41593389-41593411 GGACACGGGGAGGGCCAGCAAGG - Intronic
1007553080 6:42745230-42745252 GGTGACCAGCAGGGCCATCGTGG - Exonic
1008030408 6:46688163-46688185 GGACACCCGCAGGGCCAGCGAGG - Exonic
1008597976 6:53061893-53061915 AGGGACGCGCAGGGCCAGCGAGG - Intronic
1008918975 6:56823031-56823053 GGACACCAGCCTGGCCAACGTGG - Intronic
1015097317 6:129431196-129431218 TGAGACCAGCATGGCCAGCGTGG + Intronic
1018447205 6:163868669-163868691 GGAAACCTGCAGGGCCTGAGGGG + Intergenic
1018893174 6:167996725-167996747 GGACAGCGGGAGGGACAGCGGGG + Intronic
1019577850 7:1746141-1746163 GGACACCCCCAAGGCCAGCAAGG + Exonic
1019631277 7:2051176-2051198 GGACACAAGCAGGGCCTGCAGGG - Intronic
1021231028 7:18086659-18086681 GGAGACCCGCAGGGCGGGCCGGG - Intergenic
1021791485 7:24210439-24210461 GGAGAACCGCAGGGCCAGAAAGG - Intergenic
1022807313 7:33835499-33835521 TGACACCATCAGGGTCAGCGGGG - Intergenic
1024222688 7:47300789-47300811 AGACACAAGCAGGGCCAGGGTGG + Intronic
1025240491 7:57268052-57268074 TGAGACCAGCATGGCCAGCGTGG + Intergenic
1025611671 7:63080244-63080266 GGACTCCAGCAGGGCCTGCGGGG + Intergenic
1025712569 7:63926345-63926367 GGACACCTGGGGGGGCAGCGCGG + Intergenic
1029437094 7:100569500-100569522 GGACACCTACAGGCCGAGCGGGG + Intergenic
1029608645 7:101614928-101614950 GGCCACCCTCAGGTCCAGCAAGG + Intronic
1030348280 7:108456544-108456566 GGACGCCCGCAGGGAGTGCGGGG - Intronic
1032439210 7:131928992-131929014 GGACAGCGGCAGGGCCAGTCAGG - Intergenic
1040101798 8:43512626-43512648 GGACACCCCCAGGACCATCCAGG + Intergenic
1048322010 8:133407420-133407442 TGACATCCTCAGAGCCAGCGTGG + Intergenic
1048981625 8:139705660-139705682 GGGCGCCCGCAGACCCAGCGAGG - Intergenic
1049402426 8:142434475-142434497 GGCCACCTGCAGGGCCACTGAGG + Intergenic
1049799377 8:144510679-144510701 GGACACCCTGGGGGCCAGCATGG + Exonic
1049962950 9:753967-753989 GGAGACCAGCCTGGCCAGCGTGG + Intergenic
1052840576 9:33288935-33288957 GGACCCCCAGTGGGCCAGCGGGG - Intergenic
1053069581 9:35093153-35093175 GCCCAGCAGCAGGGCCAGCGTGG + Exonic
1053422312 9:37987356-37987378 GGACAGCCACAGGGCAAGCGAGG + Intronic
1054779074 9:69149947-69149969 CGACACCAGCCGGGCCAACGTGG + Intronic
1057046505 9:91890210-91890232 AGACACCAGCAGGACCAGCAAGG + Intronic
1060886816 9:127160419-127160441 GCAAACCCCCAGGGCCAGAGTGG - Intronic
1061165490 9:128919791-128919813 GGACAGCCTCAAGGCCAGGGTGG - Intergenic
1061926126 9:133806906-133806928 AGACACCCGCAGGGCAGGCGAGG + Intronic
1062059313 9:134486433-134486455 GCACGCCCGCAGTGCCAGCCCGG - Intergenic
1062171545 9:135137499-135137521 GGCCCCCCACAGGGCCAGGGCGG - Intergenic
1062295286 9:135821981-135822003 GGAGAAGCGCAGGGCCATCGAGG - Exonic
1062585229 9:137246239-137246261 GGACACACGCAGGGCCCACCAGG + Intronic
1062607023 9:137353021-137353043 GGAGACCCGGAAGGCCAGCCGGG - Intronic
1062731328 9:138111759-138111781 TGTCACCCGAAGGGCCAGGGAGG - Intronic
1190115000 X:47620399-47620421 GGTCACACGCAGTGCCCGCGGGG + Intergenic
1190116638 X:47629731-47629753 GGACACCCCTGGGGCCAGCTGGG + Intronic
1192436663 X:71147551-71147573 GGACTCCCTCAGGGCCAGACAGG - Exonic
1199032208 X:143013755-143013777 GGACACACTCTGGGCCAGAGAGG + Intergenic
1200054242 X:153450452-153450474 GGACAGCCCAAGGGGCAGCGGGG - Intronic
1200074021 X:153542454-153542476 GGCCACCCTCCGGGCCAGCCTGG + Intronic
1201416487 Y:13752918-13752940 GGACCCCCGCGGGGCCTGCGCGG + Intergenic