ID: 1008030410

View in Genome Browser
Species Human (GRCh38)
Location 6:46688172-46688194
Sequence GTCCACGAAGGACACCCGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030410_1008030423 20 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030410_1008030419 13 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030410_1008030418 12 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030410_1008030425 28 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030425 6:46688223-46688245 TGTGGGGGCTGGTGGGCGAGCGG 0: 1
1: 0
2: 11
3: 97
4: 1020
1008030410_1008030424 21 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030410_1008030417 11 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030410_1008030416 10 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030410_1008030413 -1 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030410_1008030421 17 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030410 Original CRISPR GTCCACGAAGGACACCCGCA GGG (reversed) Exonic
900585465 1:3430491-3430513 GTGCACGAGGGGCACCCTCAGGG - Intronic
901599483 1:10411645-10411667 GTCCATGCAGGCCACCCGAATGG - Intronic
903345128 1:22679649-22679671 GTCCACCAAGGAGCCACGCAGGG + Intergenic
914201199 1:145487192-145487214 GAGCACGAAGGACAGCCGAATGG + Intergenic
914480313 1:148060324-148060346 GAGCACGAAGGACAGCCGAATGG + Intergenic
920231873 1:204476013-204476035 GACCAAGAAGGCCACCCCCAAGG + Intronic
1067564243 10:47325486-47325508 GTCCTCGAAGTTTACCCGCAGGG - Exonic
1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG + Intronic
1072828028 10:98628270-98628292 GTCCAGGAAGGAAATCAGCATGG + Intronic
1076238255 10:128882730-128882752 CTCCAAGAAGGACCCCCGGATGG + Intergenic
1076484415 10:130806802-130806824 GTGTACTAAGGACAGCCGCATGG - Intergenic
1077114353 11:876610-876632 GTCCAAGGAGGACACTGGCAAGG - Intronic
1085524100 11:77154426-77154448 TTCCACGAATGACACCCACATGG - Intronic
1087832831 11:102838219-102838241 GTCCACGAGGGAAAGCTGCATGG + Intronic
1089502723 11:118941724-118941746 GTGCCTGAAGGACACCCGGATGG - Intronic
1096487644 12:51994484-51994506 GTCCCCGAAGGAAACCCTCAGGG - Intronic
1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG + Intronic
1108468920 13:50748562-50748584 GTCACCTGAGGACACCCGCATGG - Intronic
1116186384 14:41605754-41605776 ATCCACGGAGGCCACCCGTATGG + Intergenic
1121734577 14:96209033-96209055 GACCACTTAGGAAACCCGCAGGG - Intronic
1126603409 15:50451676-50451698 GTCCATGAAAGACACCAACATGG - Intronic
1130882724 15:88069038-88069060 GTACATGAAGGTCACCGGCAAGG + Intronic
1133248301 16:4463677-4463699 GCTCACCAAGCACACCCGCAAGG - Exonic
1145029628 17:19494991-19495013 GTCCAAGAGGCCCACCCGCAGGG - Intergenic
1155225813 18:23728253-23728275 GTCCAGGAAGGTCACCAGCCTGG - Intronic
1157711733 18:49854489-49854511 GTCCAAGAAGGACAACATCATGG - Intronic
1162909306 19:13840774-13840796 GTCCACCCAGGACACCAGGAGGG + Intergenic
1164179665 19:22807549-22807571 GCCCACGACGGCCACCGGCAGGG + Intergenic
1164734506 19:30530959-30530981 GTGCTGGCAGGACACCCGCAGGG - Intronic
925279371 2:2671998-2672020 GTCCCAGAAGGGCAGCCGCATGG + Intergenic
938263002 2:129908642-129908664 GACCACGAAGGACACCTGGGAGG + Intergenic
946167444 2:217873592-217873614 GTCCATGAGGGCCACCTGCAGGG + Intronic
1176120320 20:63451671-63451693 ATTCACGACGGACACCCCCACGG + Intronic
1178234078 21:30821735-30821757 GTCTTCAAAGGACAACCGCACGG - Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1180090533 21:45531594-45531616 GTCCCCACAGGCCACCCGCAGGG + Exonic
1185011080 22:48315061-48315083 GTCCACTAGGGACACCAGGAGGG + Intergenic
1185149098 22:49154128-49154150 GGCCAAGAAGGACCCCCGCAAGG - Intergenic
959670392 3:108970763-108970785 GTCTACAAAGGGCTCCCGCAGGG - Intronic
961359143 3:126356657-126356679 GTCCGCGAAGGACTCGCGCGTGG + Intronic
986026088 5:3852766-3852788 GTGAAAGCAGGACACCCGCACGG - Intergenic
987608308 5:20167911-20167933 GTCCACGAAGCTAACCCGCATGG - Intronic
990334583 5:54759603-54759625 GTCCAGGAAGGTCACCTGCATGG - Intergenic
990955220 5:61333059-61333081 GGCCAGTGAGGACACCCGCAGGG - Intronic
992879039 5:81087055-81087077 GTGCCCGAAGGACCCCCCCACGG + Intronic
998286895 5:140871091-140871113 CTCCACCAACGACACCAGCACGG - Exonic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1017575241 6:155794811-155794833 GTCCACGAATGACTTCTGCATGG + Intergenic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1019197956 6:170292988-170293010 GTCCAAAAAGGACACCATCATGG - Intergenic
1024582294 7:50809856-50809878 CTCCAGGAGGGACACCTGCAGGG + Intergenic
1028382082 7:90211505-90211527 GACCACGGAGGAACCCCGCAGGG + Intronic
1032494365 7:132349665-132349687 CTCCACGAAGGACATCAGAAGGG - Intronic
1035726891 8:1830287-1830309 GCCCACCAAGGACAGCCGCCTGG - Intronic
1037324213 8:17672559-17672581 GTCCAGGAAGAACACTCTCAAGG - Intronic
1040634148 8:49252997-49253019 GTGCAGGAAGGAGACCCACATGG + Intergenic
1048929082 8:139296651-139296673 GTCCACTAAGTACATCTGCAAGG - Intergenic
1053510922 9:38687105-38687127 ATCCACGAAGAACTCCAGCAGGG + Intergenic
1061900941 9:133671668-133671690 CCCCACAAAGGACAGCCGCATGG + Exonic
1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG + Intergenic
1185777143 X:2812500-2812522 GTCCCCGAAGGAAACCAGAAAGG + Intronic
1201292869 Y:12438951-12438973 GTCCCCGAAGGAAACCAGAAAGG - Intergenic