ID: 1008030411

View in Genome Browser
Species Human (GRCh38)
Location 6:46688173-46688195
Sequence CGTCCACGAAGGACACCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030411_1008030424 20 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030411_1008030421 16 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383
1008030411_1008030413 -2 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030411_1008030423 19 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030411_1008030419 12 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030411_1008030417 10 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030411_1008030426 30 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030411_1008030418 11 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030411_1008030416 9 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030411_1008030425 27 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030425 6:46688223-46688245 TGTGGGGGCTGGTGGGCGAGCGG 0: 1
1: 0
2: 11
3: 97
4: 1020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030411 Original CRISPR CGTCCACGAAGGACACCCGC AGG (reversed) Exonic