ID: 1008030411

View in Genome Browser
Species Human (GRCh38)
Location 6:46688173-46688195
Sequence CGTCCACGAAGGACACCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030411_1008030423 19 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030411_1008030421 16 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383
1008030411_1008030418 11 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030411_1008030426 30 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030411_1008030424 20 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030411_1008030416 9 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030411_1008030413 -2 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030411_1008030419 12 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030411_1008030425 27 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030425 6:46688223-46688245 TGTGGGGGCTGGTGGGCGAGCGG 0: 1
1: 0
2: 11
3: 97
4: 1020
1008030411_1008030417 10 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030411 Original CRISPR CGTCCACGAAGGACACCCGC AGG (reversed) Exonic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG + Exonic
1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG + Intergenic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1104914752 12:132258846-132258868 CGTCCACGCTGGAGACCCACAGG + Intronic
1119178020 14:72583837-72583859 CAGCCATGGAGGACACCCGCCGG + Intergenic
1122967888 14:105139700-105139722 CGCCCACCATGGACACACGCAGG + Intergenic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1145029629 17:19494992-19495014 CGTCCAAGAGGCCCACCCGCAGG - Intergenic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
926826860 2:16914375-16914397 CCTCCACTGAGGTCACCCGCTGG - Intergenic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175907143 20:62386575-62386597 GGTGGGCGAAGGACACCCGCAGG - Intergenic
1183577537 22:38701241-38701263 CGTCCAGGTAGGACTCCCTCAGG - Intronic
981128390 4:141132545-141132567 CGCCCAAGCAGGACGCCCGCGGG - Exonic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG + Intergenic
1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG + Intronic
1053510921 9:38687104-38687126 CATCCACGAAGAACTCCAGCAGG + Intergenic
1060736405 9:126069111-126069133 CCTCCCCGAAGGACAACAGCGGG + Intergenic
1186480243 X:9891069-9891091 GGACCAGGAAGGACAGCCGCTGG - Exonic