ID: 1008030413

View in Genome Browser
Species Human (GRCh38)
Location 6:46688194-46688216
Sequence CGTGCATCCCGATGTGATCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030401_1008030413 30 Left 1008030401 6:46688141-46688163 CCCGGAATGCCGGCGCCGGGGGC 0: 1
1: 0
2: 2
3: 13
4: 111
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030408_1008030413 8 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030410_1008030413 -1 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030404_1008030413 21 Left 1008030404 6:46688150-46688172 CCGGCGCCGGGGGCCTCGCTGGC 0: 1
1: 0
2: 2
3: 16
4: 234
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030411_1008030413 -2 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030402_1008030413 29 Left 1008030402 6:46688142-46688164 CCGGAATGCCGGCGCCGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030405_1008030413 15 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030413 Original CRISPR CGTGCATCCCGATGTGATCC CGG Exonic