ID: 1008030413

View in Genome Browser
Species Human (GRCh38)
Location 6:46688194-46688216
Sequence CGTGCATCCCGATGTGATCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030408_1008030413 8 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030405_1008030413 15 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030411_1008030413 -2 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030401_1008030413 30 Left 1008030401 6:46688141-46688163 CCCGGAATGCCGGCGCCGGGGGC 0: 1
1: 0
2: 2
3: 13
4: 111
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030410_1008030413 -1 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030404_1008030413 21 Left 1008030404 6:46688150-46688172 CCGGCGCCGGGGGCCTCGCTGGC 0: 1
1: 0
2: 2
3: 16
4: 234
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1008030402_1008030413 29 Left 1008030402 6:46688142-46688164 CCGGAATGCCGGCGCCGGGGGCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030413 Original CRISPR CGTGCATCCCGATGTGATCC CGG Exonic
1063367936 10:5502638-5502660 CGTGTATCCCTGTGTGATGCAGG + Intergenic
1064644385 10:17445906-17445928 CATGCATTCCTAGGTGATCCTGG - Intronic
1073521870 10:104138716-104138738 AATGCATCCTGATGAGATCCTGG + Intronic
1078251738 11:9622288-9622310 CGTTCATCCCGGTGGGCTCCTGG + Intergenic
1081295049 11:41375637-41375659 CTACCATCCTGATGTGATCCAGG - Intronic
1090792378 11:130102532-130102554 CCTGCAGCCAGATTTGATCCTGG + Intronic
1104211169 12:126690156-126690178 AGTTCATCCAGGTGTGATCCTGG + Intergenic
1116940374 14:50785062-50785084 CGTGCATCTCAATGTCATGCTGG + Intronic
1118920085 14:70142073-70142095 AGTGCAGCCCCATGTGAGCCAGG + Intronic
1129184746 15:73899268-73899290 GGTGCATCCAGCTGTGAGCCAGG - Intergenic
1150641524 17:66952973-66952995 TGTGCATCCCTGTGTGTTCCTGG - Intergenic
1163364657 19:16869254-16869276 TGTGCAGCCCCATGTGCTCCTGG - Intronic
1163419465 19:17206052-17206074 CGTGCATCTCCACGTGTTCCAGG - Exonic
928152421 2:28843996-28844018 CATGCCTCCCTATATGATCCAGG - Intronic
933029718 2:77313203-77313225 TGTGCCTCCCGATGTTTTCCTGG + Intronic
935863947 2:107364477-107364499 TGTTCATCCCCATGTAATCCAGG - Intergenic
943782040 2:191835940-191835962 CGTGCAGCCCGCCGTGCTCCAGG - Exonic
948735209 2:239999226-239999248 CGTGCATCCCTACGTGAAACAGG - Intronic
1170800584 20:19586746-19586768 GCTGAATCCCGATGAGATCCAGG - Intronic
1176870701 21:14081249-14081271 CGAGCATGCCGCTGTGCTCCAGG + Intergenic
1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG + Intergenic
1184482328 22:44755098-44755120 CGTGCCTCCTGATGTGAGCAAGG - Intronic
949875314 3:8622889-8622911 CCTGCATCCCAACATGATCCTGG - Intronic
950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG + Intronic
962910772 3:139847604-139847626 CAAGCATGCAGATGTGATCCTGG + Intergenic
966226851 3:177607029-177607051 AAAGCATCTCGATGTGATCCGGG - Intergenic
968641284 4:1716362-1716384 CGTGCATCCCCTTCTGAGCCTGG + Exonic
1003106459 6:3220296-3220318 CGGGCCTCCCTATGTTATCCAGG + Intergenic
1006376474 6:33674221-33674243 CCTGCTCCCCGATGCGATCCAGG - Exonic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1016568791 6:145489987-145490009 CGTCCATCCAGATCTGCTCCAGG - Intergenic
1039332062 8:36548509-36548531 AGAGCATCCCGTTGTGCTCCTGG - Intergenic
1061505736 9:131030946-131030968 AGTGCATCCTGGGGTGATCCAGG + Intronic