ID: 1008030416

View in Genome Browser
Species Human (GRCh38)
Location 6:46688205-46688227
Sequence ATGTGATCCCGGTGCAGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030405_1008030416 26 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030408_1008030416 19 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030411_1008030416 9 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030412_1008030416 -2 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99
1008030410_1008030416 10 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030416 Original CRISPR ATGTGATCCCGGTGCAGCTG TGG Exonic
904078341 1:27856614-27856636 ATGTGAGCACAGTGCTGCTGAGG + Intergenic
905092807 1:35442925-35442947 ATTTCATCAAGGTGCAGCTGAGG - Exonic
905463106 1:38134090-38134112 ATCTTCTCCCGGAGCAGCTGGGG + Intergenic
907520182 1:55018646-55018668 ATGGGAAGCCGGGGCAGCTGGGG + Intergenic
910134757 1:83954677-83954699 ATGTGATTCCAGTGCAGCTAAGG + Intronic
910919516 1:92328989-92329011 ATGTGATCCGTCTTCAGCTGTGG + Intronic
920275964 1:204804460-204804482 AGGAGCTCCCGGTGTAGCTGGGG + Intergenic
923737483 1:236624621-236624643 ATAAGATCCAGGTGCAGGTGAGG - Intergenic
1063574077 10:7245383-7245405 ATGTGATTTTGGTGGAGCTGCGG + Intronic
1067276325 10:44838348-44838370 GTGTGCTCCCGGACCAGCTGGGG + Intergenic
1076310367 10:129501987-129502009 ATGTGATACTGGGACAGCTGTGG + Intronic
1076767498 10:132644542-132644564 CTGTGAGCCAGGTGGAGCTGTGG - Intronic
1079297011 11:19242387-19242409 AAATGATCCAGGTGCAGCCGAGG - Intergenic
1083952024 11:65961865-65961887 TTGTGTTCCCGGTGCCGCGGCGG - Exonic
1087850001 11:103017239-103017261 ATGTGATAACTGTGCAGGTGGGG + Intergenic
1089613189 11:119681053-119681075 ATGACAGCCCAGTGCAGCTGTGG + Intronic
1092200925 12:6582229-6582251 ATGTGAGCCGGGGGCAGATGGGG - Exonic
1096634175 12:52948259-52948281 TTGGGAGCCAGGTGCAGCTGGGG + Intronic
1101664073 12:106793707-106793729 CTGTCATCCCAGTGCAACTGTGG + Intronic
1112570323 13:100588362-100588384 GTGTTAGCCCGGTTCAGCTGAGG + Intronic
1117647873 14:57871196-57871218 ATGTGATCCCTCTGGGGCTGGGG - Intronic
1121299476 14:92859177-92859199 CTGTGATCCCAGCTCAGCTGGGG - Intergenic
1125505626 15:40266069-40266091 GTGTGCCCCCGTTGCAGCTGAGG - Exonic
1125921237 15:43527064-43527086 ATGGGATTCCGGGGCAGGTGTGG - Exonic
1127342784 15:58065395-58065417 CTGTCATCCCGGCGCAGCAGAGG - Intronic
1129493353 15:75951459-75951481 ATGTCATGCTGGTGCAGGTGTGG - Intronic
1129809904 15:78501849-78501871 ATGCCATCCAGGAGCAGCTGAGG + Intergenic
1131388722 15:92029775-92029797 CTGGGCTCCCAGTGCAGCTGAGG + Intronic
1131711349 15:95059680-95059702 ACATGAACTCGGTGCAGCTGGGG - Intergenic
1133207542 16:4242299-4242321 ATGTGATCCCAGGGCTGCAGGGG - Intergenic
1134522913 16:14926734-14926756 GTGTGCTCCCGGGGCTGCTGCGG + Intronic
1134549714 16:15133324-15133346 GTGTGCTCCCGGGGCTGCTGCGG - Intronic
1134710581 16:16325385-16325407 GTGTGCTCCCGGGGCTGCTGCGG + Intergenic
1134718751 16:16369673-16369695 GTGTGCTCCCGGGGCTGCTGCGG + Intergenic
1134949021 16:18343260-18343282 GTGTGCTCCCGGGGCTGCTGCGG - Intergenic
1134956005 16:18382486-18382508 GTGTGCTCCCGGGGCTGCTGCGG - Intergenic
1135915149 16:26599040-26599062 ATGTGTTCCTCATGCAGCTGGGG + Intergenic
1143344729 17:6241374-6241396 GTGTGATCCGGGGGCAGCAGTGG - Intergenic
1146531844 17:33614094-33614116 ATTAAAACCCGGTGCAGCTGAGG - Intronic
1149635639 17:58166810-58166832 AGCTGATCTCTGTGCAGCTGAGG - Intergenic
1154227163 18:12515859-12515881 ATGTGATGCAGATGCAGCAGAGG - Intronic
1155984798 18:32218657-32218679 ATGTGATGTGGTTGCAGCTGAGG + Intronic
1157556412 18:48615769-48615791 AGGAGACCCCGGGGCAGCTGAGG + Intronic
1161837572 19:6658356-6658378 AGGTGTTGCCGTTGCAGCTGAGG + Intergenic
1165862433 19:38916200-38916222 AGGTGAGCCCTGTGCCGCTGGGG - Exonic
1166122120 19:40692245-40692267 ACCTCATCCCGGTGCTGCTGCGG - Exonic
1166320792 19:42017733-42017755 ATGTGCGCCTGGTGCAGCTGGGG + Intronic
1166719913 19:44990844-44990866 CTGTGCTCTCGGTCCAGCTGTGG - Exonic
927475193 2:23409271-23409293 ATGTGAGCTCAGTACAGCTGCGG - Intronic
931470920 2:62536992-62537014 CTCTGATGCCAGTGCAGCTGTGG - Intergenic
934018910 2:87922867-87922889 ATCTGATCCCAATGCATCTGTGG + Intergenic
934855420 2:97726332-97726354 ATGGTATCCAGGTGCAGCTGAGG + Intronic
935349450 2:102141238-102141260 AGGTAATTCCAGTGCAGCTGGGG - Intronic
938947539 2:136226739-136226761 GTGTCATCCCAGGGCAGCTGTGG - Intergenic
945750111 2:213771103-213771125 ATCAGATCCTGGTGAAGCTGTGG - Intronic
947526245 2:230878385-230878407 TTGGGCTGCCGGTGCAGCTGTGG - Exonic
948246313 2:236489201-236489223 ATGAGCTCCGGGTGCAGGTGAGG + Intronic
948246384 2:236489459-236489481 GTGGGCTCCGGGTGCAGCTGAGG + Intronic
948476723 2:238225372-238225394 CTGAGAGCCGGGTGCAGCTGTGG + Exonic
1168964274 20:1889739-1889761 CTCTGATGCCTGTGCAGCTGTGG + Intergenic
1169573531 20:6932177-6932199 ATGTGGTGCCGGTGCACCTATGG + Intergenic
1174412854 20:50347073-50347095 ATGTCAGCCTGGAGCAGCTGAGG + Intergenic
1175171032 20:57081693-57081715 ATGTGTGCCAGGTGCTGCTGAGG - Intergenic
1176202487 20:63868393-63868415 ATGTGATCTGGGTGTAGTTGAGG + Intronic
1181348440 22:22238042-22238064 ATGTGATCTATGTGCAGCAGTGG + Intergenic
1184515517 22:44959629-44959651 AGGTGGTCCCGGTGCTGCAGAGG + Intronic
953141241 3:40231194-40231216 AGGTGTTCCAGGTGAAGCTGTGG + Intronic
953435709 3:42875598-42875620 ATGTGTTCACAGTGCAGCTAGGG - Exonic
954290958 3:49649840-49649862 ATTTGATCCCAGTCCAGCTCTGG + Intronic
958615179 3:96484398-96484420 ATTTGATCACTGTGGAGCTGAGG - Intergenic
959596460 3:108134240-108134262 ATGTCATCACTGTGGAGCTGAGG - Intergenic
960026941 3:113020188-113020210 ATGTGATCTCGGTTTTGCTGTGG - Intergenic
960609398 3:119541580-119541602 AGGTGATGCCTGTGCTGCTGTGG - Intronic
961348036 3:126277485-126277507 TTGTGATCCTGGTGGAGATGTGG + Intergenic
961352204 3:126311181-126311203 ATGAGATTCCAGAGCAGCTGTGG - Intergenic
962478510 3:135778606-135778628 AGGTGATCACGCTCCAGCTGAGG - Intergenic
966099152 3:176244875-176244897 CTGTGATCTGGCTGCAGCTGGGG - Intergenic
966971911 3:185052058-185052080 AGATGATCCCGAGGCAGCTGGGG + Exonic
974083904 4:57239449-57239471 ATGTGGCCCCCCTGCAGCTGTGG + Intergenic
982143334 4:152352840-152352862 ATCTGATCCCTCTGCTGCTGAGG - Intronic
985551492 5:535566-535588 ATGTGCTCCGGGGGCACCTGCGG + Intergenic
997471026 5:134116918-134116940 ATGTAAGCCCAGTGCAGGTGGGG + Intronic
1000265570 5:159633036-159633058 AAGTGCTCCCGGTGGAGCTCTGG - Intergenic
1003520827 6:6857069-6857091 CTGTCTTCCCGGTACAGCTGTGG + Intergenic
1003598165 6:7493490-7493512 ATGTGATTGAGGTTCAGCTGAGG + Intergenic
1006042334 6:31266867-31266889 AGGTGATCCTGGTGCACATGGGG + Intergenic
1006051920 6:31351954-31351976 AGGTGATCCTGGTGCACATGGGG + Intronic
1008030416 6:46688205-46688227 ATGTGATCCCGGTGCAGCTGTGG + Exonic
1018652828 6:166005890-166005912 ATGTGATCCCCCTGCCCCTGTGG - Intergenic
1019540862 7:1550430-1550452 ATGGGGTCCCGGTGCAGCTCAGG - Intronic
1020789399 7:12607332-12607354 AAGTGATGCTGCTGCAGCTGAGG + Intronic
1025017454 7:55450290-55450312 ATGGCATCCAGGTGCTGCTGGGG - Intronic
1026830228 7:73606037-73606059 GTGTGGTCCCCGTGCTGCTGGGG - Exonic
1040580425 8:48694396-48694418 ATGTGTCCCTGGTGCAGGTGTGG - Intergenic
1040972090 8:53146356-53146378 ATGAGAGCCCCGTGCAACTGAGG - Intergenic
1041046721 8:53894600-53894622 ATGTGGCCCATGTGCAGCTGTGG + Intronic
1041255294 8:55975101-55975123 ATCTGAGCCGGGTGCCGCTGTGG + Intronic
1052727906 9:32251805-32251827 ATTTGATCCCTGTGCATCAGAGG + Intergenic
1052969752 9:34370260-34370282 ATTTGGTCCCAGTCCAGCTGGGG - Exonic
1054870874 9:70046126-70046148 AGGTGATTCTGATGCAGCTGAGG - Intronic
1057725398 9:97564722-97564744 ATGTGATCCCGGGGCAGGGGAGG + Intronic
1057900525 9:98944436-98944458 ATGGGATCCCTGGGCAGCTGGGG + Intronic
1062204597 9:135329118-135329140 ATGGGAGCCCGGTGGGGCTGGGG - Intergenic
1188113950 X:26222052-26222074 ACGTGAACCCAGAGCAGCTGAGG + Intergenic
1199125618 X:144116273-144116295 ATCTGATCCCAATGCATCTGTGG - Intergenic
1199534292 X:148884753-148884775 CTGTGATCCAGCTGGAGCTGAGG + Intronic