ID: 1008030417

View in Genome Browser
Species Human (GRCh38)
Location 6:46688206-46688228
Sequence TGTGATCCCGGTGCAGCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030411_1008030417 10 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030405_1008030417 27 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030412_1008030417 -1 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030408_1008030417 20 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1008030410_1008030417 11 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030417 Original CRISPR TGTGATCCCGGTGCAGCTGT GGG Exonic
901258069 1:7848995-7849017 GGTGCTCCCGGTGCTGCTGGCGG + Intronic
903070348 1:20724095-20724117 TGAGACCCAGCTGCAGCTGTCGG - Exonic
905948008 1:41919983-41920005 TGTGATGCTGGAGCGGCTGTAGG - Intronic
906613124 1:47217121-47217143 TGTGATCCCAGTGCTTCTGGAGG + Exonic
909490467 1:76220693-76220715 TGTTAACCTGGTGGAGCTGTTGG + Intronic
910107240 1:83644799-83644821 TGTGGTCCTAGGGCAGCTGTTGG + Intergenic
912183754 1:107249889-107249911 TGTAAGCCCAGTGCATCTGTTGG - Intronic
913324632 1:117616000-117616022 GGTGATCCCAGTGCACATGTGGG + Intronic
915453335 1:156022168-156022190 TTTGTTCCTGGTGCTGCTGTAGG + Intergenic
918559502 1:185847691-185847713 TGTAATCCCAGTGCTGCTTTGGG + Intronic
922598105 1:226829229-226829251 TGGAATCTTGGTGCAGCTGTCGG - Intergenic
922599862 1:226842310-226842332 TGTGGTCCAGGTGCAGAGGTAGG - Intergenic
922874783 1:228931919-228931941 TGAGATCCAGGGGCTGCTGTGGG + Intergenic
923733953 1:236583133-236583155 AGGGATCCCAGTGGAGCTGTGGG - Exonic
1067238385 10:44470397-44470419 CAGGATCCCGGTGCATCTGTGGG + Intergenic
1076310368 10:129501988-129502010 TGTGATACTGGGACAGCTGTGGG + Intronic
1076767497 10:132644541-132644563 TGTGAGCCAGGTGGAGCTGTGGG - Intronic
1087410093 11:97780649-97780671 AGTGATCCAGGTACAGCTTTTGG + Intergenic
1091237908 11:134034005-134034027 TGTGAATCCGGTTCAGCTTTAGG - Intergenic
1091385986 12:94928-94950 TGGGACCCCGGAGCAGCTGGAGG + Intronic
1091563365 12:1630535-1630557 AGTGTCCCCGGTGCAGCTGCTGG + Intronic
1094006274 12:25755328-25755350 TGTGATCCCACTGCATCTCTGGG + Intergenic
1100030063 12:90175866-90175888 TGTAATCCCAGTGCTGCTTTGGG - Intergenic
1103929121 12:124439967-124439989 TGGGGTCTCGGTGCAGCAGTGGG - Intronic
1109636766 13:65129775-65129797 TTTTTTCCCGCTGCAGCTGTAGG + Intergenic
1112422636 13:99266951-99266973 TGTGTTGCTGGTGCAGCTGCTGG - Intronic
1121367207 14:93324620-93324642 TGTGATCCCAAGACAGCTGTCGG + Intronic
1123946039 15:25239367-25239389 TGTGGTCCTGGTGCAGCCCTGGG + Intergenic
1124192534 15:27593034-27593056 GGTGCCCCCGGTGCAGTTGTGGG + Intergenic
1125215543 15:37269363-37269385 TGAGATCCGGGTGCACCAGTGGG - Intergenic
1125921236 15:43527063-43527085 TGGGATTCCGGGGCAGGTGTGGG - Exonic
1127342783 15:58065394-58065416 TGTCATCCCGGCGCAGCAGAGGG - Intronic
1133923636 16:10177403-10177425 TGTGATTCTGGTGGAACTGTAGG - Intronic
1137592636 16:49703143-49703165 TCTGGTCCTGGTGCACCTGTGGG - Intronic
1139437158 16:66942925-66942947 TCTAATCCTGGTGCAGCTTTTGG - Intronic
1139605543 16:68015640-68015662 TGTCAGCCAGGTGAAGCTGTGGG + Intronic
1140681500 16:77389589-77389611 TGTGATGTCGGTGCAGCTAGAGG - Intronic
1141826579 16:86484931-86484953 TGTCATCTCAGTGCAGCTGCAGG + Intergenic
1141967035 16:87452629-87452651 TGTCATCCCTGTGCAGCTGGTGG - Intronic
1143151696 17:4810892-4810914 TGTCATGCCGGTGCAGCTGTAGG - Exonic
1143344728 17:6241373-6241395 TGTGATCCGGGGGCAGCAGTGGG - Intergenic
1149579759 17:57741437-57741459 GGTGATCCAGGTGAGGCTGTGGG - Intergenic
1152135699 17:78501945-78501967 GGTGTTCCCTATGCAGCTGTGGG - Intronic
1153514600 18:5891868-5891890 TGGGATCCTGGTGCTGCTGGTGG - Exonic
1155357290 18:24965551-24965573 TGTGATCCAGGTACTGCTCTAGG - Intergenic
1159495663 18:69200343-69200365 TATGTTCCAGGTGTAGCTGTTGG + Intergenic
1160445635 18:78925101-78925123 TGTGGCTCAGGTGCAGCTGTGGG - Intergenic
1160951107 19:1667788-1667810 TGGGGTCCCGGGGCAGCTGGTGG + Intergenic
1162523089 19:11193428-11193450 TGTGCTCCAGGTGAAGCTCTCGG - Exonic
1163313143 19:16525886-16525908 TGAGATGCGGGTGCAGCGGTTGG - Intronic
1165658015 19:37550540-37550562 TGTGATCCCGGTGTGGGTGCTGG + Intergenic
1165685706 19:37817776-37817798 TGTGACGTGGGTGCAGCTGTGGG + Intergenic
928341606 2:30447547-30447569 TGGGGTCCCGGTGCAGGTGGCGG + Intronic
931470919 2:62536991-62537013 TCTGATGCCAGTGCAGCTGTGGG - Intergenic
934018911 2:87922868-87922890 TCTGATCCCAATGCATCTGTGGG + Intergenic
935703952 2:105839907-105839929 TGTGATCTCCGCGCAGCTGGTGG + Intronic
942366737 2:175236084-175236106 TGTGATCCCTCTGCAGCAGAAGG + Intergenic
945202520 2:207296819-207296841 TGTGATCCAGGTTCTGGTGTTGG - Intergenic
946747549 2:222861149-222861171 GGGGATCCTGGCGCAGCTGTCGG - Exonic
947526244 2:230878384-230878406 TGGGCTGCCGGTGCAGCTGTGGG - Exonic
948801926 2:240436923-240436945 TGTGGTCCCGGAGGAGCTTTGGG + Intronic
1171858805 20:30376376-30376398 GGTGATCCCTCTGCAGCGGTGGG - Intergenic
1183040495 22:35174247-35174269 TGTGATCCAGGAGCAGGTGGAGG + Intergenic
1183831827 22:40422249-40422271 TGTGCTCCTGGCCCAGCTGTTGG - Intronic
1185106152 22:48871107-48871129 TGTGCTCCCGCTGCTGCTGGAGG - Intergenic
1185191179 22:49437552-49437574 TGGGATCCTCGTGCAGCTCTGGG - Intronic
1185384338 22:50525016-50525038 TGTGAGCCCGGAGGAGCTGCTGG - Intronic
950628422 3:14265366-14265388 TGTGATGTCTATGCAGCTGTGGG + Intergenic
953760736 3:45684820-45684842 TGTCTTCCAGGTGCAGCTGCCGG + Exonic
953849555 3:46455394-46455416 TGTGTTCCCGGTGCAGATAAAGG - Exonic
954145859 3:48633996-48634018 TGGGCTCCCGGGGCAGCTGGAGG - Intronic
959369507 3:105505251-105505273 TGTGTTCCCTGTACAGCTGGTGG - Intronic
961348037 3:126277486-126277508 TGTGATCCTGGTGGAGATGTGGG + Intergenic
966658370 3:182385467-182385489 TGGGATCCAAGGGCAGCTGTGGG - Intergenic
968106911 3:196007775-196007797 TGAGATCAAGGTGCAGCTGGAGG - Intergenic
968526573 4:1061092-1061114 TGAAATCCCGTTGCAGCTTTGGG + Intronic
968853553 4:3101522-3101544 TGTGACCCCAGGCCAGCTGTAGG + Intronic
969611346 4:8229265-8229287 TGTGATGGCGGGGCAGCTCTTGG + Intronic
972332888 4:38080154-38080176 TGTGACCCCTGTGCTGCTGGAGG + Intronic
985549250 5:524742-524764 TGGGATGCCCGGGCAGCTGTGGG + Intergenic
995725942 5:115180251-115180273 TAGGATCCGGGTGCAGCGGTCGG + Intronic
1000265569 5:159633035-159633057 AGTGCTCCCGGTGGAGCTCTGGG - Intergenic
1003308389 6:4948233-4948255 TGTGGTGTCGGTGCAGATGTGGG + Intronic
1003603051 6:7535829-7535851 TGTGGTCCAGGTGCAGCGGGTGG + Intergenic
1008030417 6:46688206-46688228 TGTGATCCCGGTGCAGCTGTGGG + Exonic
1009819011 6:68775354-68775376 TGTGATCCCCAGGCTGCTGTGGG + Intronic
1017847766 6:158274365-158274387 AGTGATCCGGGTACAGCTGGTGG - Intronic
1019192746 6:170262731-170262753 TGTGATTCTCCTGCAGCTGTGGG + Intergenic
1019540861 7:1550429-1550451 TGGGGTCCCGGTGCAGCTCAGGG - Intronic
1019628030 7:2031208-2031230 TGTGTGCCTGGTGCAGCTGCAGG - Intronic
1021455946 7:20829872-20829894 GGAGATCCCGCTGCAGCTGCAGG - Intergenic
1026830227 7:73606036-73606058 TGTGGTCCCCGTGCTGCTGGGGG - Exonic
1029622345 7:101698054-101698076 TGGGATCCCGGAGCAGCAGACGG + Intergenic
1030605177 7:111632918-111632940 TGTGTTCCCAGGGCAACTGTTGG + Intergenic
1035072548 7:156155985-156156007 TGTGGACACGGTGCAGGTGTAGG + Intergenic
1038533636 8:28338401-28338423 TGTGATCCAGTTCCAGGTGTGGG - Intronic
1040580424 8:48694395-48694417 TGTGTCCCTGGTGCAGGTGTGGG - Intergenic
1044474123 8:92606221-92606243 AGTGATCTGGGTGCACCTGTTGG + Intergenic
1056488702 9:87084429-87084451 GCAGATCCCGGTGCAGCTGAAGG - Intergenic
1057266762 9:93622458-93622480 TGTGATGACGCTGCAGCTGCTGG - Intronic
1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG + Intronic
1060539860 9:124421988-124422010 TGTCCTCCCTGTGAAGCTGTGGG - Intergenic
1190036252 X:47027807-47027829 TGTGAGCCCAGTGCAGGAGTGGG - Intronic
1193633254 X:83916365-83916387 TGTTATCCTGGTGCCTCTGTGGG - Intergenic
1198593024 X:138205239-138205261 TGTGATACCAGTGAAGATGTAGG - Intergenic
1199125617 X:144116272-144116294 TCTGATCCCAATGCATCTGTGGG - Intergenic
1199534293 X:148884754-148884776 TGTGATCCAGCTGGAGCTGAGGG + Intronic