ID: 1008030418

View in Genome Browser
Species Human (GRCh38)
Location 6:46688207-46688229
Sequence GTGATCCCGGTGCAGCTGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030411_1008030418 11 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030405_1008030418 28 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030412_1008030418 0 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030408_1008030418 21 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
1008030410_1008030418 12 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030418 Original CRISPR GTGATCCCGGTGCAGCTGTG GGG Exonic
900245995 1:1636310-1636332 GTGAGCCCAGTGCAGCCGGGTGG - Intronic
900257220 1:1703453-1703475 GTGAGCCCAGTGCAGCCGGGTGG - Intronic
904195410 1:28781790-28781812 GGGATCCCTCTGCTGCTGTGTGG - Intergenic
905232126 1:36521164-36521186 GTGTTCCCTGGGGAGCTGTGTGG + Intergenic
911580129 1:99624671-99624693 GTGATGGAGGTGCAGCAGTGAGG - Intergenic
912437354 1:109671156-109671178 GTGACCCAGTTCCAGCTGTGGGG + Intronic
913663843 1:121029773-121029795 ATCATCCCTGGGCAGCTGTGGGG + Intergenic
914015238 1:143813052-143813074 ATCATCCCTGGGCAGCTGTGGGG + Intergenic
914162580 1:145148173-145148195 ATCATCCCTGGGCAGCTGTGGGG - Intergenic
914402602 1:147337277-147337299 GTGATCCCGGAGAAGGGGTGGGG + Intergenic
914653855 1:149721593-149721615 ATCATCCCTGGGCAGCTGTGGGG + Intergenic
916988220 1:170214358-170214380 GTGCTCCCGCTGCTGCTGTGCGG - Intergenic
922455485 1:225770638-225770660 GTGATCCTGGAACAGCTGAGAGG - Intergenic
1067238386 10:44470398-44470420 AGGATCCCGGTGCATCTGTGGGG + Intergenic
1070567551 10:77615258-77615280 GTGATCCTGGGGCTGCTCTGGGG - Intronic
1073337510 10:102720883-102720905 GTAATCTAGGTGCTGCTGTGAGG + Intronic
1073469048 10:103711533-103711555 GCCCTCCCGGTGCAGCTCTGAGG - Intronic
1075262589 10:120976094-120976116 CTGAGCACAGTGCAGCTGTGAGG - Intergenic
1075639639 10:124055666-124055688 GCGAGCCTGGCGCAGCTGTGGGG + Intronic
1079058546 11:17228277-17228299 GTGACGCCGGTGCAGTTGGGGGG + Intronic
1089938035 11:122385650-122385672 CTGAGCCAGGTGCAGATGTGGGG - Intergenic
1091563366 12:1630536-1630558 GTGTCCCCGGTGCAGCTGCTGGG + Intronic
1095190409 12:39251404-39251426 GTTATCCCGAAGCAGCTGTCTGG + Intergenic
1100030062 12:90175865-90175887 GTAATCCCAGTGCTGCTTTGGGG - Intergenic
1103380650 12:120491604-120491626 GTGATCCTGGGGCAGTAGTGAGG + Intronic
1104418414 12:128614974-128614996 GTTCTCCTGGGGCAGCTGTGGGG - Intronic
1105657663 13:22458084-22458106 AAGATCTCGCTGCAGCTGTGTGG - Intergenic
1105998865 13:25700148-25700170 GGAAACCTGGTGCAGCTGTGGGG + Intronic
1108154875 13:47575064-47575086 ATGATCTCGGGGGAGCTGTGTGG - Intergenic
1112427117 13:99312764-99312786 GTGTTCAGGGAGCAGCTGTGTGG + Intronic
1113596934 13:111540070-111540092 GTGCTCCCCCTGCAGCTGTGAGG - Intergenic
1118801188 14:69191551-69191573 GTGAGCCCGCTGCAGGTGTGCGG + Intronic
1118898329 14:69965485-69965507 GTGATCCTGGGTCAGCTCTGTGG - Intronic
1121909577 14:97776821-97776843 GTGATCCTGCTTCAACTGTGAGG - Intergenic
1123939392 15:25209504-25209526 GTGATCTCTGTGCAGCCCTGGGG + Intergenic
1123946040 15:25239368-25239390 GTGGTCCTGGTGCAGCCCTGGGG + Intergenic
1125615107 15:41004169-41004191 GTTACCCTCGTGCAGCTGTGTGG - Intronic
1125921235 15:43527062-43527084 GGGATTCCGGGGCAGGTGTGGGG - Exonic
1128113875 15:65093534-65093556 GTGCTCCAGGTGCAGGTGTACGG - Intronic
1128758500 15:70198961-70198983 GTGATGCCGATGCAGCTGATTGG + Intergenic
1132007390 15:98241161-98241183 GTTAACCCTGTGGAGCTGTGTGG - Intergenic
1132667656 16:1089467-1089489 GGGACCCCAGAGCAGCTGTGAGG - Intergenic
1133961018 16:10493454-10493476 GTCATCCCCGAGCAGATGTGTGG + Intergenic
1137249357 16:46730977-46730999 GTGATCCTAGTGGATCTGTGTGG + Intronic
1137592635 16:49703142-49703164 CTGGTCCTGGTGCACCTGTGGGG - Intronic
1139421389 16:66851455-66851477 GTGAACCAGATGCAGCTATGGGG - Exonic
1141967034 16:87452628-87452650 GTCATCCCTGTGCAGCTGGTGGG - Intronic
1142157218 16:88538058-88538080 GTGATGCCTGTGCAGGTGAGGGG - Intergenic
1145815817 17:27794172-27794194 GTGGTCCTGGGGCTGCTGTGTGG - Intronic
1148851423 17:50557335-50557357 GAGGTCCAGGCGCAGCTGTGGGG + Intergenic
1148894282 17:50831054-50831076 GTGATCCATCTGCATCTGTGTGG - Intergenic
1152223263 17:79080968-79080990 GACCTGCCGGTGCAGCTGTGTGG - Exonic
1155517698 18:26639864-26639886 GTGATCCCCAAGCAGCAGTGTGG - Intronic
1158650012 18:59275849-59275871 GTGATCAGAGGGCAGCTGTGGGG + Intronic
1159873625 18:73786488-73786510 GTGAACCCAGTGCAGCTGGTTGG - Intergenic
1160054880 18:75469642-75469664 GGGCTCTAGGTGCAGCTGTGAGG - Intergenic
1160226415 18:77014765-77014787 GTGATCACAGAGCAGCTGTGAGG - Exonic
1160445634 18:78925100-78925122 GTGGCTCAGGTGCAGCTGTGGGG - Intergenic
1161014840 19:1978461-1978483 GTACTCCAGGTGCAGCTGCGGGG - Exonic
1161069714 19:2253946-2253968 GGCATCCCCGTGCAGCTGCGGGG - Intronic
1162500072 19:11048093-11048115 CTCAGCCTGGTGCAGCTGTGTGG - Intronic
1162915194 19:13870948-13870970 CTGACCCCAGTGCAGCTGGGAGG - Intronic
1164712311 19:30365984-30366006 GTGATCTCTGTGCAACTTTGGGG + Intronic
1164927601 19:32142375-32142397 GTGGTCCCCGTGAAGGTGTGAGG - Intergenic
1165228399 19:34370273-34370295 GTGATGCCGGTGTGCCTGTGTGG + Intronic
1166331521 19:42080546-42080568 GTGCTCCCGGAGCCGCAGTGAGG - Exonic
1167472948 19:49685590-49685612 GTGAGCCGGGTGAAGCTGGGTGG + Intronic
925275103 2:2643193-2643215 GCGATCAAGGTGCAGCTGCGTGG - Intergenic
925367008 2:3317534-3317556 GTGACCTCGCAGCAGCTGTGAGG + Intronic
926701089 2:15804062-15804084 GTGAGCCCGATGCGGGTGTGCGG + Intergenic
926747494 2:16170990-16171012 GGCCTCCCGGAGCAGCTGTGAGG - Intergenic
927830537 2:26346251-26346273 GTGAGCCCGGAGCAGCTGGCTGG + Exonic
931470918 2:62536990-62537012 CTGATGCCAGTGCAGCTGTGGGG - Intergenic
934018912 2:87922869-87922891 CTGATCCCAATGCATCTGTGGGG + Intergenic
946747548 2:222861148-222861170 GGGATCCTGGCGCAGCTGTCGGG - Exonic
946904384 2:224401994-224402016 GTGACCCCGCTGCTGCTGTGTGG - Exonic
948801927 2:240436924-240436946 GTGGTCCCGGAGGAGCTTTGGGG + Intronic
1169267093 20:4173358-4173380 GTGATTGAGGTGCATCTGTGTGG + Intronic
1169437924 20:5610426-5610448 GTGAGCCGGGGGCCGCTGTGGGG + Intronic
1173570122 20:44070614-44070636 GAGCTCCTGGTGCAGCTGTGAGG - Intergenic
1178389541 21:32187066-32187088 CTGACACCGGTGCAGCTGGGAGG + Intergenic
1178826929 21:36024971-36024993 TAGATCCCAGTGCAGCAGTGTGG - Intergenic
1180105032 21:45612922-45612944 GTGAGACCGGTCCAGCTGGGTGG + Intergenic
1180105080 21:45613158-45613180 GTGAGACCGGTCCAGCTGGGTGG + Intergenic
1182145158 22:27992960-27992982 GTGGCCCCGATGAAGCTGTGCGG - Intronic
1184583147 22:45430478-45430500 GTGATCTGCGTTCAGCTGTGGGG + Intronic
1185172701 22:49303073-49303095 GTGATCCCCGCGCATCTGAGAGG + Intergenic
950172089 3:10845708-10845730 GTGGTCCCTCTGCATCTGTGTGG - Intronic
950210486 3:11119445-11119467 GTGATGTGGGTGCAGCAGTGGGG - Intergenic
950628423 3:14265367-14265389 GTGATGTCTATGCAGCTGTGGGG + Intergenic
952423747 3:33153773-33153795 GTGATCCTGGTGAATCTGCGGGG + Exonic
953927281 3:46988901-46988923 GTCAGCCTGGTGCAGCTGTTCGG - Exonic
954945919 3:54424281-54424303 GGGGTGCAGGTGCAGCTGTGAGG + Intronic
963897183 3:150699444-150699466 ATGATCCCTGTGCAGATGGGTGG - Intronic
966438916 3:179921830-179921852 GTGATTCCAATCCAGCTGTGTGG - Intronic
966658369 3:182385466-182385488 GGGATCCAAGGGCAGCTGTGGGG - Intergenic
970333115 4:15004081-15004103 CTGAGCCCAGTGCAGCCGTGCGG - Exonic
972763740 4:42132257-42132279 GTGCTGCAGGTGTAGCTGTGTGG + Intronic
976107989 4:81639838-81639860 GGGATCCCTGGGCACCTGTGAGG + Intronic
976686749 4:87822402-87822424 GTGGTCCCCGGGCAGCAGTGTGG + Intronic
984731262 4:183070055-183070077 GTGGTCCCTGTGCAGCAGAGAGG + Intergenic
997662919 5:135603313-135603335 GCAATCCCACTGCAGCTGTGAGG - Intergenic
998601889 5:143592902-143592924 GTGCTCGGTGTGCAGCTGTGTGG + Intergenic
999393947 5:151214672-151214694 GTGTCCCCGGTGCAGCGGAGTGG - Intronic
1003308390 6:4948234-4948256 GTGGTGTCGGTGCAGATGTGGGG + Intronic
1004374594 6:15080436-15080458 GTGGTCCCGGTGAACCTGCGAGG + Intergenic
1006953593 6:37846325-37846347 TTGAGCCAGGTGCAGCTGTTTGG + Intronic
1008030418 6:46688207-46688229 GTGATCCCGGTGCAGCTGTGGGG + Exonic
1010066662 6:71690047-71690069 GTGATGACTGTGTAGCTGTGTGG + Intergenic
1018173852 6:161162572-161162594 GGAATCCAGGTGCAGCTGAGCGG - Intronic
1018738412 6:166707614-166707636 CTGATCCAGGTGCACCTGTCTGG - Intronic
1018880787 6:167877894-167877916 GTGATGCCTGATCAGCTGTGAGG - Intronic
1019192747 6:170262732-170262754 GTGATTCTCCTGCAGCTGTGGGG + Intergenic
1019600773 7:1882654-1882676 TTGCTCCCTGTGCAGGTGTGTGG - Intronic
1020643076 7:10779939-10779961 GTGAACGCGGCGGAGCTGTGAGG - Intergenic
1020789401 7:12607334-12607356 GTGATGCTGCTGCAGCTGAGGGG + Intronic
1022388410 7:29923143-29923165 GTGATGGCTGTGCTGCTGTGTGG + Intronic
1024959219 7:54957309-54957331 CTGATCCCTGTGCACTTGTGAGG - Intergenic
1026387041 7:69860505-69860527 GTGATTCCGGTGCAGGGGTGTGG - Intronic
1026963259 7:74423307-74423329 GTGATCCCAGGACACCTGTGAGG + Intergenic
1032703638 7:134403783-134403805 GTCATACAGGTGCAGCAGTGAGG + Intergenic
1034281850 7:149860111-149860133 ATGATCCCAGGGTAGCTGTGTGG + Intronic
1038533635 8:28338400-28338422 GTGATCCAGTTCCAGGTGTGGGG - Intronic
1039618438 8:38975105-38975127 GTGGTTCACGTGCAGCTGTGGGG + Exonic
1045808394 8:106192302-106192324 GTTGTCCCAGTGCATCTGTGTGG - Intergenic
1047971401 8:130087604-130087626 GTGATGCCAGTGCTGCTGTATGG + Intronic
1048446058 8:134494173-134494195 GTGATCCCTGCACAGCTGTGCGG + Intronic
1049773034 8:144392483-144392505 GTGCGCCTGGGGCAGCTGTGGGG + Exonic
1051357689 9:16254801-16254823 GAGATCCCAGGGCAGCTGGGTGG - Intronic
1056519255 9:87385001-87385023 GAGAGCCATGTGCAGCTGTGTGG - Intergenic
1060668944 9:125451475-125451497 GTGATCCTGAAGCAGCTATGTGG + Intronic
1061289993 9:129645231-129645253 GGGGTCCCGGTGGAGCTGGGTGG + Intergenic
1061967952 9:134026461-134026483 CTCTTCCGGGTGCAGCTGTGTGG - Intergenic
1188154326 X:26722642-26722664 GTGGACCCAGTGCTGCTGTGGGG + Intergenic
1190633424 X:52411367-52411389 GTGAACTCTGTGGAGCTGTGAGG - Intergenic
1193508785 X:82373523-82373545 GTGATCCTGGTTCAGCCATGTGG - Intergenic
1193633253 X:83916364-83916386 GTTATCCTGGTGCCTCTGTGGGG - Intergenic
1195394581 X:104397400-104397422 CTAAGCCCAGTGCAGCTGTGGGG - Intergenic
1199125616 X:144116271-144116293 CTGATCCCAATGCATCTGTGGGG - Intergenic