ID: 1008030419

View in Genome Browser
Species Human (GRCh38)
Location 6:46688208-46688230
Sequence TGATCCCGGTGCAGCTGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030412_1008030419 1 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030408_1008030419 22 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030410_1008030419 13 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030405_1008030419 29 Left 1008030405 6:46688156-46688178 CCGGGGGCCTCGCTGGCCCTGCG 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147
1008030411_1008030419 12 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030419 Original CRISPR TGATCCCGGTGCAGCTGTGG GGG Exonic
900487455 1:2930085-2930107 TGATCTGGGAGGAGCTGTGGTGG + Intergenic
900580517 1:3406346-3406368 TGAGCCCTGGGCACCTGTGGAGG + Intronic
900611967 1:3548069-3548091 CGATCCCCATGCAGCTGGGGAGG - Intronic
900638542 1:3677146-3677168 GGGTCCCGGGGAAGCTGTGGGGG + Intronic
901145168 1:7059995-7060017 TGGTCTAGGGGCAGCTGTGGCGG - Intronic
901938808 1:12646144-12646166 TGATTCCAGGGCAGCTGTGGAGG + Intronic
904041834 1:27589925-27589947 TGAGCCTGGTGCAGCAGAGGAGG - Intronic
904971249 1:34420997-34421019 TGAGCCCTGAGCAGCTGTCGTGG - Intergenic
905416671 1:37808586-37808608 TCCTCCCGGGGCGGCTGTGGGGG - Exonic
907238905 1:53069895-53069917 GGTCCCAGGTGCAGCTGTGGCGG - Exonic
915603793 1:156938505-156938527 TGGTGTCGGTGCAGCTGAGGTGG - Exonic
1065872412 10:29966832-29966854 TCAGCCGGGTGCAGCGGTGGAGG - Intergenic
1068463056 10:57351694-57351716 TGCTCCTGGTTCAGCTCTGGAGG - Intergenic
1069901472 10:71708929-71708951 TGATGCGGGTGCAGCTTGGGTGG - Intronic
1078688258 11:13552867-13552889 TGATCCCAGAGAAGCCGTGGAGG + Intergenic
1078896653 11:15602850-15602872 TGATCCCTGTCCAGCTGGAGGGG + Intergenic
1079514961 11:21256700-21256722 TGCTCTGGGTGCAACTGTGGAGG + Intronic
1083208999 11:61170984-61171006 TGATCCCCGTGCAGGCCTGGAGG + Intergenic
1085446084 11:76601998-76602020 TGATCTGGGTGTTGCTGTGGAGG - Intergenic
1088952386 11:114584844-114584866 TGAGCCCAGGGCAGCTGTGCTGG + Intronic
1090237489 11:125160159-125160181 GGATCCAGGTGGGGCTGTGGTGG - Intergenic
1090305118 11:125684538-125684560 TGATTGCTGTGCAGCTGGGGTGG + Intergenic
1092153691 12:6268549-6268571 TGACCCCTGGTCAGCTGTGGTGG + Intergenic
1093143277 12:15535206-15535228 ATATCCCGGTGCAGATGTGAAGG + Intronic
1096446520 12:51697930-51697952 TGAACCCGGTGCGGGGGTGGAGG - Intronic
1096758395 12:53818870-53818892 TGCTACCTGTCCAGCTGTGGAGG - Intergenic
1098569510 12:71972993-71973015 TGATCCAGGAGCTGCTGTGCTGG + Intronic
1100030061 12:90175864-90175886 TAATCCCAGTGCTGCTTTGGGGG - Intergenic
1102599444 12:114018026-114018048 TGATTCCCCTGCAGCTGTAGAGG - Intergenic
1103338828 12:120210366-120210388 TGATCCAGCTGCATCTGGGGTGG + Intergenic
1103726465 12:122999706-122999728 TGAGCCCCCTGCAGCTGTAGAGG + Intronic
1104628187 12:130377078-130377100 TGATACCAGTGAAGCTGGGGAGG - Intergenic
1105657662 13:22458083-22458105 AGATCTCGCTGCAGCTGTGTGGG - Intergenic
1105998866 13:25700149-25700171 GAAACCTGGTGCAGCTGTGGGGG + Intronic
1106406514 13:29479575-29479597 TGATCTCAGAGCAGGTGTGGGGG - Intronic
1108154874 13:47575063-47575085 TGATCTCGGGGGAGCTGTGTGGG - Intergenic
1108526216 13:51288099-51288121 TGAACTGGCTGCAGCTGTGGAGG + Intergenic
1109636768 13:65129777-65129799 TTTTCCCGCTGCAGCTGTAGGGG + Intergenic
1113596933 13:111540069-111540091 TGCTCCCCCTGCAGCTGTGAGGG - Intergenic
1116486481 14:45455210-45455232 TGGTTCAAGTGCAGCTGTGGAGG + Intergenic
1117873995 14:60231887-60231909 AGATGCTGGTGCGGCTGTGGAGG + Intergenic
1119491272 14:75035755-75035777 TGAGCCCTGAGCAGCAGTGGAGG - Intronic
1121299475 14:92859174-92859196 TGATCCCAGCTCAGCTGGGGTGG - Intergenic
1125921234 15:43527061-43527083 GGATTCCGGGGCAGGTGTGGGGG - Exonic
1128091252 15:64920304-64920326 GGAGCACGGTGCAGATGTGGAGG + Intronic
1130311812 15:82762787-82762809 TGTTCCCAGTGCAACAGTGGAGG - Intronic
1131631095 15:94177510-94177532 TGATCCCAGTGCAGAAGTGTTGG + Intergenic
1132594759 16:743657-743679 TGCTCCGGGTGGAGCTGGGGCGG + Intronic
1132769194 16:1551546-1551568 AGATCAGGGTGCAGCGGTGGAGG + Intronic
1133809513 16:9150176-9150198 TGATCCCAGGCCAGGTGTGGTGG - Intergenic
1135532727 16:23268291-23268313 TGATCACTGTCCAGGTGTGGTGG + Intergenic
1136233641 16:28902222-28902244 TGATCCCGGTGCAGCTGCTATGG + Exonic
1138625458 16:58248175-58248197 GGATCCTGGTGCAAATGTGGTGG + Intronic
1138654407 16:58482450-58482472 TTCTCACTGTGCAGCTGTGGGGG + Intronic
1141180601 16:81750818-81750840 TTAGCCAGGTGCAGGTGTGGTGG - Intronic
1143025015 17:3936409-3936431 TGATCCCTGTGCAGCTGCTCTGG - Exonic
1145749669 17:27346329-27346351 TGGTCCCTGTGCAGCTGGGTAGG + Intergenic
1147464960 17:40603771-40603793 TGATCCCAGGCCAGGTGTGGTGG + Intergenic
1147658879 17:42106477-42106499 TGTTCTTGGTGCTGCTGTGGGGG - Intronic
1148851424 17:50557336-50557358 AGGTCCAGGCGCAGCTGTGGGGG + Intergenic
1152275562 17:79354666-79354688 TGCCTCTGGTGCAGCTGTGGGGG + Intronic
1153166945 18:2272912-2272934 TGAGCCAGGTGAAGATGTGGTGG + Intergenic
1157166654 18:45363761-45363783 TGCTCCTCGGGCAGCTGTGGAGG + Intronic
1158260450 18:55600597-55600619 TGGTCCAGGTGTAGCTGAGGTGG - Intronic
1160391933 18:78540498-78540520 TGATTCCCTTGCAGCTCTGGGGG - Intergenic
1161054371 19:2182631-2182653 GGATCTCGGTGCAGCAGGGGTGG + Intronic
1162500071 19:11048092-11048114 TCAGCCTGGTGCAGCTGTGTGGG - Intronic
1162915193 19:13870947-13870969 TGACCCCAGTGCAGCTGGGAGGG - Intronic
1163304768 19:16471409-16471431 TGCGCCCGGTGCAGGGGTGGCGG + Intronic
1165631280 19:37304329-37304351 CCATCCCGGGGCAACTGTGGCGG + Intergenic
925242634 2:2345780-2345802 TGATCCAGGTGAATTTGTGGAGG - Intergenic
929465154 2:42137490-42137512 TGATCCAGGTGCAGGTGGGGAGG + Intergenic
934527201 2:95059323-95059345 TTCTCCCGGTGCTGCTGTGCCGG - Intergenic
942190334 2:173463186-173463208 TGACCCATGTGCAGCAGTGGTGG - Intergenic
943720445 2:191198604-191198626 TGATCCAGCTCCAGCTGTGGAGG + Intergenic
945923381 2:215778878-215778900 TGATCCAAGTGCAGTTGTGGTGG - Intergenic
946747547 2:222861147-222861169 GGATCCTGGCGCAGCTGTCGGGG - Exonic
948147336 2:235717329-235717351 TGATGCCGTTGCAGCTGTTGAGG + Intronic
948366185 2:237456319-237456341 TGCTCCCGCTGGAGCGGTGGTGG - Intergenic
948786151 2:240354028-240354050 TGACCACGGTGCAGCAGAGGAGG - Intergenic
1170617842 20:17968583-17968605 TGCTCCCGGGGCAGCTGGGATGG - Intronic
1170667653 20:18400609-18400631 TGTTTTCAGTGCAGCTGTGGTGG - Intronic
1171178346 20:23072438-23072460 TGATCCCTGTGGTGCTTTGGTGG + Intergenic
1173570121 20:44070613-44070635 AGCTCCTGGTGCAGCTGTGAGGG - Intergenic
1173807764 20:45937202-45937224 GGATCCCTGTGCAGCCGTGCAGG + Intronic
1175977280 20:62717278-62717300 ACATCCCTGTGCACCTGTGGGGG + Intronic
1176660792 21:9633677-9633699 TGAGCCTGGAGCACCTGTGGGGG + Intergenic
1177835141 21:26179446-26179468 TGAACCCGGGGCAGCGGGGGAGG - Intergenic
1178389542 21:32187067-32187089 TGACACCGGTGCAGCTGGGAGGG + Intergenic
1178878644 21:36431515-36431537 TGAAAGTGGTGCAGCTGTGGAGG - Intergenic
1179904316 21:44414346-44414368 TGCTCACGGTGCTGCTGCGGAGG + Intronic
1179983962 21:44910922-44910944 TGGGCCCAGTGCAGCTGTGCTGG - Intronic
1184520901 22:44993406-44993428 TGGAGCCGGTGCCGCTGTGGTGG - Intronic
1185294183 22:50045318-50045340 TGCTCCTGCTGCAGCTCTGGTGG + Exonic
950002720 3:9669442-9669464 TGATGCCTGGGCAGATGTGGAGG + Exonic
950211166 3:11124599-11124621 TGGTCCCTGTGCAGCCCTGGTGG - Intergenic
950628424 3:14265368-14265390 TGATGTCTATGCAGCTGTGGGGG + Intergenic
953449952 3:42997583-42997605 TATTCCAGGTGCAGCTGAGGAGG - Intronic
954080300 3:48209641-48209663 AGGTCATGGTGCAGCTGTGGTGG - Intergenic
954303570 3:49713975-49713997 GGATCCTGGTGCGGCTCTGGAGG + Exonic
960609397 3:119541577-119541599 TGATGCCTGTGCTGCTGTGGAGG - Intronic
961325350 3:126106125-126106147 TGATCCAGGAGCCCCTGTGGTGG - Intronic
961352203 3:126311178-126311200 AGATTCCAGAGCAGCTGTGGTGG - Intergenic
963897182 3:150699443-150699465 TGATCCCTGTGCAGATGGGTGGG - Intronic
965083639 3:164066682-164066704 TATTCCCAGTGGAGCTGTGGTGG - Intergenic
966658368 3:182385465-182385487 GGATCCAAGGGCAGCTGTGGGGG - Intergenic
971429062 4:26544457-26544479 AGATGCTGGTGCAGCTGTAGAGG - Intergenic
972343955 4:38177208-38177230 TCAGCCCAATGCAGCTGTGGTGG - Intergenic
974907748 4:68078161-68078183 TGATCCTGGTCCAGCTGGAGAGG + Intronic
985414571 4:189722739-189722761 TGAGCCTGGAGCACCTGTGGGGG - Intergenic
985788662 5:1913405-1913427 TCATCCAGGTGCAGCCGAGGTGG - Intergenic
985797465 5:1973654-1973676 TGATCCCGGTCCAGCTCCCGCGG + Intergenic
985800680 5:2003851-2003873 TGACCACGGCGCAGCTGAGGCGG + Intergenic
990214563 5:53515673-53515695 TAATCCAGGTGCTGCTGTGAAGG - Intergenic
995725944 5:115180253-115180275 GGATCCGGGTGCAGCGGTCGGGG + Intronic
996811234 5:127517940-127517962 TGGTCCAGGCTCAGCTGTGGCGG + Intronic
998643673 5:144039699-144039721 TAATCCAGGTACAGCTGTGAAGG - Intergenic
1003520828 6:6857072-6857094 TCTTCCCGGTACAGCTGTGGAGG + Intergenic
1004135624 6:12963303-12963325 CGGTAACGGTGCAGCTGTGGAGG - Intronic
1008030419 6:46688208-46688230 TGATCCCGGTGCAGCTGTGGGGG + Exonic
1008615147 6:53219217-53219239 TGATCCTGGTGCATCTTTGCAGG - Intergenic
1012063542 6:94517057-94517079 AGATGCTGGTGAAGCTGTGGAGG + Intergenic
1017940238 6:159046417-159046439 TGTTCCCAGGGCAGCTGTAGAGG + Intergenic
1018762544 6:166904410-166904432 TGATCGCGCAGCAGCCGTGGGGG - Intronic
1019010817 6:168842226-168842248 TGGTCCCTGTGCAGCTGTCCTGG - Intergenic
1020254753 7:6496962-6496984 TGAGACCGGGGCAGGTGTGGGGG - Intergenic
1024398536 7:48896393-48896415 GGAGCCAGGTACAGCTGTGGTGG - Intergenic
1024959218 7:54957308-54957330 TGATCCCTGTGCACTTGTGAGGG - Intergenic
1025610682 7:63073369-63073391 TCATCCAGGCTCAGCTGTGGTGG + Intergenic
1025933531 7:66015380-66015402 CAATCCTGGTGCAGCTGTGGTGG + Intergenic
1025950320 7:66140208-66140230 CAATCCTGGTGCAGCTGCGGTGG - Intronic
1026030598 7:66789799-66789821 TCATCCTGGGGCAGCCGTGGTGG + Intronic
1026387040 7:69860504-69860526 TGATTCCGGTGCAGGGGTGTGGG - Intronic
1029601014 7:101563521-101563543 TCATCTCTGTCCAGCTGTGGAGG + Intergenic
1032700588 7:134375149-134375171 TGATTTCAGTGCAGCTGTGCTGG - Intergenic
1036601783 8:10267681-10267703 TGATCCCCCAGCAGGTGTGGGGG - Intronic
1036638051 8:10564940-10564962 TGATGCCGGTGGGGCGGTGGCGG + Intergenic
1039751862 8:40486181-40486203 TGATCCCGGAGTAGTTGGGGTGG - Intergenic
1043531546 8:81156726-81156748 TGATTTCTGAGCAGCTGTGGTGG + Intergenic
1045296591 8:100876667-100876689 TAATCCCGGTGCAGTGGTGTCGG - Intergenic
1046675717 8:117105775-117105797 TAATCTAGGTGCAGCTGTGAAGG - Intronic
1049738552 8:144222894-144222916 AGATCCAGGTACAGATGTGGAGG + Intronic
1050058216 9:1677896-1677918 TGATGCCAGTGCAACAGTGGTGG + Intergenic
1050476812 9:6049006-6049028 TGATCCCACTGCTGCTGGGGTGG - Intergenic
1052969751 9:34370257-34370279 TGGTCCCAGTCCAGCTGGGGAGG - Exonic
1054447664 9:65385464-65385486 TGCTCCTGCTGCCGCTGTGGCGG - Intergenic
1057900526 9:98944439-98944461 GGATCCCTGGGCAGCTGGGGCGG + Intronic
1058814257 9:108668864-108668886 TGATCACTGGGCTGCTGTGGAGG - Intergenic
1059510899 9:114845560-114845582 TGACTCCGCTGCCGCTGTGGTGG - Intergenic
1061113589 9:128593198-128593220 AGGTCGCGGTGCAGCTGTGTCGG + Intronic
1061444713 9:130631314-130631336 TGATGCCAGGGCAGTTGTGGTGG + Intronic
1203638360 Un_KI270750v1:135521-135543 TGAGCCTGGAGCACCTGTGGGGG + Intergenic
1185736627 X:2500845-2500867 TGATCCTGGCGCAGCTGCTGCGG - Exonic
1193633252 X:83916363-83916385 TTATCCTGGTGCCTCTGTGGGGG - Intergenic
1196151543 X:112380437-112380459 TGATCCCGGGCCAGGTGCGGTGG - Intergenic
1197865747 X:131014858-131014880 TGGTCCCAGTGCAGCAATGGGGG + Intergenic
1201566397 Y:15369211-15369233 TAAGCCTTGTGCAGCTGTGGCGG - Intergenic