ID: 1008030421

View in Genome Browser
Species Human (GRCh38)
Location 6:46688212-46688234
Sequence CCCGGTGCAGCTGTGGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030410_1008030421 17 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383
1008030412_1008030421 5 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383
1008030411_1008030421 16 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383
1008030408_1008030421 26 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030421 Original CRISPR CCCGGTGCAGCTGTGGGGGC TGG Exonic
900598274 1:3492354-3492376 ACCCTTGCAGCTGTTGGGGCTGG + Intronic
900712401 1:4122650-4122672 CCCGGGCCAGCTGGGGAGGCGGG + Intergenic
901500796 1:9651777-9651799 CCCGGCGCAGCTGGCAGGGCTGG - Exonic
901757392 1:11449590-11449612 CCCCGTGGTGCTTTGGGGGCAGG - Intergenic
901874370 1:12158566-12158588 CCCGCTGCAGATGTGGGGATTGG + Intergenic
902291815 1:15440366-15440388 CCAGGGCCAGCTGTGGGGCCGGG - Exonic
902394823 1:16126882-16126904 CCCTGGGCAGGGGTGGGGGCGGG - Intronic
902561547 1:17280660-17280682 GTCGATGCAGCTCTGGGGGCAGG - Exonic
902823465 1:18956955-18956977 CCTGGTGCAGCTCTGCGGTCCGG - Intergenic
903448770 1:23438703-23438725 CCCTGAGCAGCTGTGGGTGGGGG + Intronic
903479825 1:23645091-23645113 CATGGAGGAGCTGTGGGGGCAGG - Intergenic
906104039 1:43281085-43281107 CCCAGTTTAGCTATGGGGGCAGG + Intergenic
906537237 1:46558234-46558256 ACCGCTGTAGCTGTGGCGGCTGG - Exonic
906726014 1:48044775-48044797 CCTGATGCAGCTGTGGGGGGTGG - Intergenic
907498038 1:54858162-54858184 CCCTGTGCAGCTGGGGGAACGGG - Intronic
909490471 1:76220699-76220721 CCTGGTGGAGCTGTTGGGGCAGG + Intronic
910827881 1:91428548-91428570 CCCTGGGCAGCTGTTTGGGCAGG - Intergenic
912390188 1:109297455-109297477 CCGCGTGCAGCTGGGTGGGCTGG - Exonic
912774551 1:112497214-112497236 CCTAGTGGAGTTGTGGGGGCAGG - Intronic
913347764 1:117825398-117825420 CCTGGGGCAGCTCTGGGGCCAGG + Intergenic
914858494 1:151369003-151369025 CCTTGTGCAGCTTTGGGGCCCGG + Exonic
915226989 1:154418778-154418800 CACGCTGCGGCTGTGGGGGAAGG + Intronic
915603792 1:156938501-156938523 GTCGGTGCAGCTGAGGTGGCAGG - Exonic
915722823 1:157996496-157996518 CCAGGGGGAGCTCTGGGGGCTGG - Intronic
916398022 1:164412950-164412972 ACCAGTGGAGCTGTGGGGGCTGG + Intergenic
917969236 1:180196624-180196646 CCTGGTGCAGCTCTGAGGCCAGG - Exonic
917978029 1:180252511-180252533 CCCTGTTCAGAGGTGGGGGCAGG + Intronic
919822460 1:201481894-201481916 CCAGGTGGTGCTGTGGGGTCAGG - Intergenic
920814494 1:209318750-209318772 CCCGGGGCGGCTGAGGGGGGTGG - Intergenic
922718286 1:227887874-227887896 CGCGGTGCAGCCCCGGGGGCAGG - Intergenic
922994302 1:229943895-229943917 CCCAGAGCAGCTGTGGGAGGAGG + Intergenic
924436797 1:244049220-244049242 GCCGCTGCAGCTGCGGGGTCGGG + Intronic
924503006 1:244653701-244653723 CCCGGGGCAGCCCCGGGGGCCGG - Intronic
1064016171 10:11774051-11774073 CCCGGGGCAGCTGTCGGAGCAGG - Intergenic
1065527424 10:26637639-26637661 GGCAGGGCAGCTGTGGGGGCGGG + Intergenic
1065881427 10:30040721-30040743 CGCTGTGCAGCTATGGGGCCTGG - Intronic
1065968180 10:30785323-30785345 CCAGGAGCAGCTGCGGAGGCCGG - Intergenic
1067039190 10:42939994-42940016 CCCTGTGCATCTGTGAGGGATGG + Intergenic
1067709201 10:48635219-48635241 CCCAGTGCAGAAGTGGGGGTGGG - Intronic
1068360076 10:55966464-55966486 CCTAGTGGAGCTGTGTGGGCAGG + Intergenic
1069071983 10:63998599-63998621 GCTGGTGCATCTGTGTGGGCAGG + Intergenic
1069749109 10:70734445-70734467 TCCCGGGCAGCTCTGGGGGCTGG - Intronic
1069750815 10:70744007-70744029 CCCGGGGTGGCGGTGGGGGCAGG + Intronic
1070750286 10:78960014-78960036 CCCACAGCAGCTCTGGGGGCTGG + Intergenic
1070959604 10:80489461-80489483 CCAGTTGCAGCTGTGGGGATGGG + Intronic
1071116183 10:82223216-82223238 CCAGCTGCAGCTGCTGGGGCTGG - Intronic
1071502074 10:86211406-86211428 CAGGGTGCAGGTGGGGGGGCTGG - Intronic
1073986617 10:109216873-109216895 CCCAGTGCAGCTATGGGGTTTGG + Intergenic
1074516398 10:114174225-114174247 CCGGTTACAGCTGAGGGGGCGGG + Intergenic
1076732890 10:132447114-132447136 CCGGGAGCAGCTGCTGGGGCGGG + Intronic
1076765478 10:132630770-132630792 CCCTGTGCGGTGGTGGGGGCCGG + Intronic
1076765576 10:132631209-132631231 CACGGAGCAGCTGTGTGGGCAGG - Intronic
1076782167 10:132730356-132730378 CCCAGTGCAGCCGGGTGGGCTGG + Intronic
1077355744 11:2115945-2115967 CCAGGTACAGCTCTGGGTGCAGG - Intergenic
1079058547 11:17228282-17228304 GCCGGTGCAGTTGGGGGGCCCGG + Intronic
1079453105 11:20614460-20614482 CAAGGTGCAGTTGTGGGGACTGG + Intronic
1079454171 11:20622864-20622886 CCCCGTGCTGTTTTGGGGGCAGG + Intronic
1080336516 11:31203669-31203691 CCCTGTGAAACTGTTGGGGCAGG - Intronic
1080385848 11:31810710-31810732 CCCGGCGTAGCAGTGGGGGAGGG + Intronic
1080457124 11:32427991-32428013 GCCGGTGCAGCTGTCGGTGGGGG + Exonic
1081858954 11:46321033-46321055 TTGGGTGCAGGTGTGGGGGCAGG - Exonic
1083589167 11:63882869-63882891 ACCAGTGCAGCTGAGGTGGCTGG - Intronic
1083822765 11:65182115-65182137 CCTGGAGCAGGGGTGGGGGCTGG + Intronic
1084154687 11:67307038-67307060 CAGGGTGCAGCTGGGGGAGCTGG - Exonic
1089579181 11:119470862-119470884 CCCGGCCCAGCTGTGGGCACAGG - Intergenic
1090401577 11:126452749-126452771 ACCGGAGCCGCTGTCGGGGCTGG + Intronic
1091227475 11:133966213-133966235 CCTGGGGCAGTGGTGGGGGCGGG + Intergenic
1091387073 12:102427-102449 CCCGGAGCTGGAGTGGGGGCCGG - Intronic
1091563369 12:1630541-1630563 CCCGGTGCAGCTGCTGGGCAAGG + Intronic
1092231727 12:6779417-6779439 CCAGCTGCAGCTGTGGGAGTCGG + Intergenic
1093012851 12:14126990-14127012 TCTAGTGAAGCTGTGGGGGCAGG - Intergenic
1093306566 12:17527852-17527874 CCCAGTGGAGATGTGGGAGCAGG + Intergenic
1094472764 12:30818776-30818798 CCCAGTGCTGCTGTGAGGGAAGG - Intergenic
1095932073 12:47637160-47637182 GCTGCTGCTGCTGTGGGGGCTGG - Intergenic
1097077637 12:56407281-56407303 GCAGGTGAAGCTGTGGGGGAAGG + Intergenic
1097077982 12:56409299-56409321 GCAGGTGAAGCTGTGGGGGCAGG + Intergenic
1097174621 12:57135662-57135684 CCCGGTGCTGCTGTGGGATAGGG + Intronic
1100453950 12:94733743-94733765 CACTGAGCATCTGTGGGGGCAGG - Intergenic
1103516237 12:121510030-121510052 CTCGGGGCATCTGTGGGGGCAGG + Exonic
1103703466 12:122859567-122859589 TCCTGTGGAGCTTTGGGGGCCGG + Intronic
1103736114 12:123061878-123061900 GCCGGAGCAGCTATGAGGGCTGG + Intronic
1103899541 12:124296010-124296032 CCCGGAGCAGCAGAGGGGCCGGG - Intronic
1103929117 12:124439961-124439983 CTCGGTGCAGCAGTGGGTGGGGG - Intronic
1103988162 12:124780867-124780889 CAGGGTGCAGGGGTGGGGGCTGG - Intronic
1104352279 12:128055450-128055472 CCCGGTGTGGCTGTGCAGGCCGG - Intergenic
1104935834 12:132363994-132364016 CCTCGTGGACCTGTGGGGGCTGG - Intergenic
1105424866 13:20285358-20285380 GCAGGTGAAGCTGTGGGGCCAGG - Intergenic
1107346991 13:39472529-39472551 CCGGGTTCAGCTGTGAGAGCAGG + Intronic
1107449102 13:40492491-40492513 CCGGGTGAGCCTGTGGGGGCAGG + Intergenic
1107604031 13:42040813-42040835 CCCGGCGCAGCGGCGGCGGCGGG + Intronic
1113037766 13:106070091-106070113 CCTGGAGGAGATGTGGGGGCAGG - Intergenic
1113956530 13:114102481-114102503 CCTGGTGCAGCTGCGTGGGACGG + Intronic
1114155535 14:20099296-20099318 CCCGGGGCGGCGGTGCGGGCTGG - Intergenic
1114429132 14:22645523-22645545 CCTGGGGCAGCTGTGTGGGCAGG - Intergenic
1114485893 14:23061499-23061521 CCCGGGGGTGCTGTGGTGGCTGG + Exonic
1115028017 14:28765922-28765944 CCGGGTGCTGCTGCGGCGGCCGG - Intergenic
1116393638 14:44422611-44422633 CCTGGTGCAGCTGTGAGGAGAGG - Intergenic
1118990095 14:70790164-70790186 CCCTGAGCAGCAGTGGGGGAAGG + Intronic
1119419793 14:74501684-74501706 CCCTGTGGAACTGTGGGGGTGGG + Intronic
1120993527 14:90398026-90398048 CCCAGTGCAGCAGTGCGGGCGGG + Intronic
1121241122 14:92430732-92430754 CCCAGGGCAGGGGTGGGGGCTGG + Intronic
1121667872 14:95686350-95686372 CCCGGGCCGGCAGTGGGGGCGGG - Intergenic
1122202261 14:100129737-100129759 CTCTGTGCAGCGCTGGGGGCGGG - Intronic
1122271494 14:100570315-100570337 CCTGGTGGAGCAGTGGGGGCTGG + Intronic
1122626102 14:103086043-103086065 CCAGGCGCTGCTGAGGGGGCTGG + Intergenic
1122727005 14:103762753-103762775 GGCGCTGCTGCTGTGGGGGCAGG + Intronic
1122836399 14:104432977-104432999 CCAGGTGCTGCTGGGAGGGCTGG - Intergenic
1122984062 14:105204095-105204117 CCCGCTGCATCTGTGGGGAGTGG + Intergenic
1202929240 14_KI270725v1_random:23788-23810 CACTGTGCGGCTGTGGGGGGTGG + Intergenic
1123411764 15:20066656-20066678 CCCTGTGCAGCTGTGTGAGCAGG - Intergenic
1123423058 15:20147432-20147454 CACTGTGCGGCTGTGGGGGGTGG - Intergenic
1123521108 15:21073775-21073797 CCCTGTGCAGCTGTGTGAGCAGG - Intergenic
1123532283 15:21153971-21153993 CACTGTGCGGCTGTGGGGGGTGG - Intergenic
1123762058 15:23440887-23440909 CCAGGAGGAGATGTGGGGGCAGG - Exonic
1124619367 15:31265195-31265217 CCGAGTGCAGAGGTGGGGGCGGG - Intergenic
1124851401 15:33342127-33342149 CCCACTACAGCTGTGGGGGCAGG - Intronic
1125186675 15:36938946-36938968 CCCGCTGCAGCTCTGTGGACAGG + Intronic
1125387772 15:39156418-39156440 CTCAGTGCAGCTGAGAGGGCAGG + Intergenic
1126664817 15:51066763-51066785 CCCTAAGTAGCTGTGGGGGCAGG + Intronic
1126902153 15:53325561-53325583 TCCGTGGCAGCTGTGGGGGATGG - Intergenic
1129252916 15:74318617-74318639 CCTGGGGCAGCCTTGGGGGCTGG - Intronic
1132399527 15:101496875-101496897 CCCGGCGCAGGTGTGGGTGGAGG - Intronic
1132546762 16:536797-536819 CCGAGTGCAGCTGTGGGTCCTGG - Intronic
1132558321 16:582429-582451 CCCAGTGGAGCTGAGGGGGAAGG + Intronic
1132576784 16:668049-668071 GCTGGTGCGGCTGTGCGGGCGGG + Intronic
1132583131 16:694367-694389 CCTGGTGCAGCTGCAGGAGCTGG - Exonic
1132608430 16:803140-803162 CCGGGTCCAGCTGTAGGGCCGGG - Intergenic
1132734802 16:1379932-1379954 CCCGGAGCAGCTGCAGGTGCAGG - Intronic
1132779248 16:1614047-1614069 CCAGGGCCAGCTCTGGGGGCCGG + Intronic
1132838066 16:1964591-1964613 GCCGGTGCAGCGGGGGGGCCCGG - Exonic
1132930192 16:2455134-2455156 CCCGGCTCAGCTGTGGGGCGTGG - Intronic
1135540340 16:23325000-23325022 CCCGGTGCAGCTGAGTGCTCTGG + Intronic
1136541607 16:30930399-30930421 GCCGCTCCAGCTGTGGAGGCCGG - Exonic
1137718057 16:50611043-50611065 TCCTGCCCAGCTGTGGGGGCAGG - Intronic
1138223364 16:55271905-55271927 GCCTGTGCATGTGTGGGGGCAGG + Intergenic
1141180599 16:81750814-81750836 CCAGGTGCAGGTGTGGTGGCAGG - Intronic
1141598665 16:85112439-85112461 CTGGGTGCAGCTGTGTGGCCTGG + Exonic
1142001729 16:87668161-87668183 CCCGGAGCGGCTGGAGGGGCAGG - Intronic
1142006837 16:87693236-87693258 CCTGGTGCTGCTGTGGCTGCAGG + Intronic
1142089711 16:88203413-88203435 CCCTGGGCTGCTGTGGGAGCAGG - Intergenic
1142259272 16:89034984-89035006 CCGGGTGAAGCAGAGGGGGCCGG - Intergenic
1142943128 17:3399932-3399954 CCAGGTGAGGCTGTGGAGGCAGG - Intergenic
1143096336 17:4480488-4480510 GCCAGGGAAGCTGTGGGGGCAGG - Intronic
1143560278 17:7689650-7689672 CATGGTACAGCTCTGGGGGCAGG - Exonic
1145023044 17:19446818-19446840 GCCGGTGCAGCGGGGGGGCCCGG - Intergenic
1145041317 17:19579992-19580014 CCCGGAGCCGCTATGGGGGCCGG - Intergenic
1145239266 17:21230474-21230496 GGCTGTGCAGCTGTGGGGCCTGG + Intergenic
1145777589 17:27540218-27540240 GCTGGTGCAGCAGTGGGTGCAGG - Intronic
1145912189 17:28549258-28549280 CCAGGGGCAGCTGTGGGGTGAGG - Intronic
1146341243 17:32021333-32021355 CCCGGGGCTGCTGGGGGAGCAGG - Exonic
1146508024 17:33422340-33422362 CAGGGTGGAGCTGTGGGGACGGG - Intronic
1147132122 17:38415681-38415703 CCTGGTGCAGCTGAGGCTGCAGG - Intergenic
1147514403 17:41102075-41102097 CACAGAGCAGCTGTGGGAGCAGG + Exonic
1147545394 17:41397447-41397469 CAGGGTGCAGCTGTGGCAGCTGG + Exonic
1147586908 17:41658135-41658157 GCTGGTGCACCTGTGTGGGCAGG - Intergenic
1147678760 17:42225529-42225551 CCCTTGGCATCTGTGGGGGCTGG + Intronic
1148085007 17:44988566-44988588 CCCTGGACAGCTGTGGGGACGGG - Intergenic
1148334544 17:46832610-46832632 CTCGGTGCAGCGGCAGGGGCGGG - Intronic
1148851427 17:50557340-50557362 CCAGGCGCAGCTGTGGGGGAGGG + Intergenic
1151359499 17:73580188-73580210 CCCACTGCAGGTGAGGGGGCAGG - Intronic
1151597019 17:75084479-75084501 CCCTGAGCTGCGGTGGGGGCAGG - Intergenic
1152223261 17:79080963-79080985 GCCGGTGCAGCTGTGTGGTGAGG - Exonic
1152396325 17:80035795-80035817 CCGGGTCCCGCTGCGGGGGCCGG + Exonic
1152559427 17:81070600-81070622 CCCGCTGCAGCTGTGGGAGCTGG + Intronic
1152719730 17:81917686-81917708 CCCGGAGGAGCTGCGGGGGAAGG - Exonic
1152756852 17:82090602-82090624 GCAGGTGCAGCTGTTGGGGGCGG + Intronic
1152821808 17:82441316-82441338 GCGGGTGCAGGTGAGGGGGCAGG + Intronic
1154064946 18:11098578-11098600 CCCGGTGCAGCAGTGTTGGGAGG + Intronic
1154416307 18:14177772-14177794 CCCGCAGCAGCGGTGGGGGCGGG + Intergenic
1154492576 18:14933178-14933200 CCAGGTGCATCTGTGGGGAGTGG + Intergenic
1155284883 18:24277397-24277419 AGCGTTGCTGCTGTGGGGGCTGG + Intronic
1157595765 18:48862732-48862754 GCCGGGGCAGCTGTAGGGGCGGG + Intronic
1160130973 18:76224597-76224619 CCAGGCCCAGCTGTGTGGGCTGG + Intergenic
1160406030 18:78646936-78646958 CCCAGTGGAGGTGTGGGGGCAGG - Intergenic
1160764880 19:803130-803152 CCGTGTGCTGCTGGGGGGGCTGG + Intronic
1160808602 19:1003291-1003313 CCAGGACCAGCTGTGGGGGCCGG - Exonic
1160884782 19:1340797-1340819 CCCCGTGCTGGTGTGGGGGCTGG - Intergenic
1160927945 19:1555992-1556014 CCCGGCGCAGCAGTGGGGCCGGG - Exonic
1160928019 19:1556235-1556257 GCCGGAGCCGCTGTAGGGGCTGG + Exonic
1161014838 19:1978456-1978478 CCAGGTGCAGCTGCGGGGCCCGG - Exonic
1161454204 19:4362038-4362060 CCCGGTGCTGCTGCGGTGACAGG + Intronic
1161525505 19:4752519-4752541 CCCTGAGCAGGTGTGGGGCCTGG - Intergenic
1161575399 19:5051934-5051956 TCCGGTGCAGGTGTGGGAGGTGG + Intronic
1161615367 19:5267196-5267218 ACCGGTGGTGATGTGGGGGCGGG + Intronic
1161849339 19:6730710-6730732 CCCAGGGCCGCTCTGGGGGCGGG - Intronic
1162294646 19:9804893-9804915 CTCAGTGAAGCTGTAGGGGCTGG + Intergenic
1162555071 19:11381596-11381618 CCCGGTGCCGCTTTCAGGGCCGG - Intronic
1162772362 19:12956957-12956979 GCCGGAGCAGCTGCGGGAGCTGG - Exonic
1164463193 19:28465589-28465611 CCAGGTGCAGCTGAGGGGAAGGG + Intergenic
1164763590 19:30746124-30746146 CCAGCGGCAGCAGTGGGGGCTGG - Intergenic
1165095740 19:33409050-33409072 CCAGCTGCAGCTGTAGAGGCAGG - Intronic
1165357680 19:35313742-35313764 CCAGGGCCAGGTGTGGGGGCAGG - Exonic
1166332751 19:42088309-42088331 CCCTGTGCAGCCGGGGGTGCTGG - Intronic
1166876674 19:45901917-45901939 CCGGGGGCAGGAGTGGGGGCGGG + Intronic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1167423482 19:49417246-49417268 ACCTGAGCCGCTGTGGGGGCAGG - Exonic
1168314124 19:55476703-55476725 GGCGGTGCAGCTGTGGGGACCGG - Exonic
1168353791 19:55690215-55690237 CCCCATTCAGCTGTGGCGGCCGG - Intronic
925009060 2:468284-468306 TCCGGTGCAGCTGAGGGACCAGG - Intergenic
925183616 2:1832463-1832485 ACCCGTGCAGCTGCTGGGGCTGG + Intronic
925889542 2:8422332-8422354 CCCTGTGCAGCAGTGGGAGGTGG + Intergenic
927647250 2:24885848-24885870 CCTCAGGCAGCTGTGGGGGCGGG - Intronic
927911900 2:26905591-26905613 TCCGGCCTAGCTGTGGGGGCTGG + Intronic
927945776 2:27134388-27134410 CCCGGTACAGCTCTGGCGCCCGG + Exonic
928094191 2:28393835-28393857 CCCGGTGCACCTGGCGGCGCGGG + Intronic
928220898 2:29401991-29402013 GCCGGGGCAGCTCTGAGGGCCGG + Intronic
929044747 2:37778467-37778489 CCCAGGGCAGCAGTGGGGTCTGG + Intergenic
929699655 2:44150988-44151010 CCTAGTGGAGCTGTGGGAGCAGG + Intergenic
930170538 2:48246955-48246977 CCTAGTGGAGCTGTGGGGTCAGG + Intergenic
931291931 2:60881360-60881382 CCCGGCGCTGCTGCGGCGGCTGG - Intergenic
932054607 2:68431907-68431929 CCAGGTGCTGGTGTGGGTGCTGG + Intergenic
932504534 2:72215955-72215977 CCCAGTGCAGCTGTGGTGAATGG + Intronic
932564683 2:72898437-72898459 CCCGGAGCAGCTGTGGGCTGAGG - Intergenic
932574359 2:72954644-72954666 CTCCCTGCAGCTGTGGGGGCTGG - Intronic
934746183 2:96761077-96761099 GCTGGTGCTGCTGTGGGCGCTGG + Exonic
934761961 2:96861349-96861371 CCCGCTGGACCTTTGGGGGCCGG - Exonic
934856189 2:97731880-97731902 CCCGTGGAAGCTGTGGAGGCCGG - Intronic
934913626 2:98280465-98280487 CCCGGTGCTGCCCTGGGGTCAGG + Intronic
937263069 2:120598653-120598675 CACGGTGCAGCTGCCGTGGCAGG + Intergenic
937841209 2:126526476-126526498 CCCAGTGGAGCTGTGAGAGCAGG - Intergenic
937951077 2:127388187-127388209 CCCGGGGCAGGGGCGGGGGCGGG - Intronic
937989313 2:127653606-127653628 GCAGGTGCAGCTGTGGGGGCGGG + Intronic
937993291 2:127675595-127675617 CCCGGCGGGGCTGTGGGGGTGGG - Intronic
938069378 2:128300419-128300441 CCAGGTGCAGGGCTGGGGGCAGG - Intronic
941164941 2:162074300-162074322 CCCGGAGGAGCCGTGGGGGAGGG + Exonic
941517272 2:166494573-166494595 CGCGGTGCAGCTGAGGGGGAAGG + Intergenic
941820587 2:169840568-169840590 CCCAGTAGAGCTATGGGGGCAGG - Intronic
943185308 2:184598892-184598914 CGCGCTGCGGCTGTGGGCGCGGG + Exonic
945425385 2:209694409-209694431 TCCAGTGCAGGTGTGGTGGCTGG - Exonic
946239368 2:218344587-218344609 CCAGGAGGAGCTGTGTGGGCAGG + Intronic
946322973 2:218964234-218964256 ACAGGAGCAGCTGTGAGGGCAGG + Intergenic
946370610 2:219279392-219279414 CCCGGCCCAGCTGTGCGCGCAGG - Exonic
946373994 2:219297293-219297315 CGGGGTGCTGCTGTGGGAGCTGG + Exonic
947526243 2:230878378-230878400 GCCGGTGCAGCTGTGGGCCCAGG - Exonic
947641615 2:231710415-231710437 CCCCGGGGAGCAGTGGGGGCAGG - Intronic
947732059 2:232436758-232436780 CGCGGGGCAGCTGCAGGGGCAGG + Intergenic
947748862 2:232522734-232522756 CCTGGTGCAGCTGTGGACGCCGG + Exonic
947795403 2:232891058-232891080 CCAGTTGCAGCGATGGGGGCGGG - Intronic
948199218 2:236117908-236117930 TCCGCTGCATTTGTGGGGGCCGG + Intronic
948983465 2:241506938-241506960 CCATGTGCAGCTGTTGGGCCAGG - Intronic
1169278859 20:4250393-4250415 CCGGGTGCAGATGTGGGAGAGGG + Intergenic
1170538624 20:17366011-17366033 CCCAGTGGAGCTGTGGGGGTGGG - Intronic
1170590201 20:17765799-17765821 CCCTGTGCAGCCCTGGGGGCAGG + Intergenic
1172587071 20:36092556-36092578 CCCGCTGCTGCTTGGGGGGCCGG + Intronic
1172604929 20:36207800-36207822 CGGGGAGCAGCGGTGGGGGCGGG - Intronic
1172618737 20:36306503-36306525 CCCGGCGCAGGTGAGGGCGCGGG + Exonic
1172671960 20:36640872-36640894 GACAGTGCAGCTCTGGGGGCTGG + Intronic
1173570118 20:44070609-44070631 CCTGGTGCAGCTGTGAGGGGTGG - Intergenic
1174399037 20:50265959-50265981 CACAGAGCAGCTGAGGGGGCAGG + Intergenic
1174776399 20:53346851-53346873 CTCTGTGTATCTGTGGGGGCAGG - Intronic
1175725905 20:61318125-61318147 CCCTGTGCTGTTGTGGTGGCAGG + Intronic
1175919772 20:62445381-62445403 CGCGGTGAAGCTGGGGGCGCTGG - Intergenic
1175940494 20:62535492-62535514 CCCGGGGCAGCTGTGGGGCCAGG + Intergenic
1175987446 20:62771063-62771085 CCCAGGGCAGGTGTGGGGACAGG - Intergenic
1176063047 20:63180540-63180562 CCAGGTGCACCACTGGGGGCAGG - Intergenic
1176217314 20:63954327-63954349 CACGGGCCAGCTCTGGGGGCAGG + Intronic
1176409136 21:6438283-6438305 CCAGGTGCAGGTGGGAGGGCTGG - Intergenic
1178521142 21:33289373-33289395 CCAGCAGCAGCGGTGGGGGCTGG - Intronic
1179560567 21:42213506-42213528 CCCAGTGGAGGTGTGGGGGCAGG + Intronic
1179562119 21:42222091-42222113 CCCGGTGCGGGGGTGGGGGAAGG + Intronic
1179684629 21:43046605-43046627 CCAGGTGCAGGTGGGAGGGCTGG - Intergenic
1180065607 21:45410729-45410751 CCAGGAGCAGCTGTGCTGGCAGG - Intronic
1180098814 21:45574801-45574823 CTGGCTGCAGCTGTGTGGGCCGG + Intergenic
1180167690 21:46038503-46038525 CTGGGTGCAGCCGTGGGGCCTGG - Intergenic
1180184009 21:46130602-46130624 GACGGGGAAGCTGTGGGGGCCGG - Intronic
1180649891 22:17369330-17369352 GGCGGTGCAGCTGTCCGGGCGGG + Intronic
1180945532 22:19690465-19690487 CCGGGTGCAGCGGTGGTGCCAGG - Intergenic
1182942401 22:34289298-34289320 CCCTGTGCAACTGTGGAGGCAGG - Intergenic
1183302264 22:37064176-37064198 GCCGGAGCAGCTGGGTGGGCAGG - Intergenic
1183352359 22:37341362-37341384 TCCTGTGCAGCTGTGGAGGACGG + Intergenic
1183401790 22:37609085-37609107 CGCGGTCCAGCGGTGGGAGCGGG + Intronic
1183472585 22:38017387-38017409 CCTGGTCCAGATGCGGGGGCAGG + Intronic
1184130240 22:42513126-42513148 CCCAGCTCTGCTGTGGGGGCAGG + Intronic
1184140416 22:42574949-42574971 CCCAGCTCTGCTGTGGGGGCAGG + Intergenic
1184453550 22:44596867-44596889 CCCTGCGCTGCTGTGGTGGCTGG - Intergenic
1184477039 22:44727582-44727604 CACGGTGCAGCTGTGTGGCCTGG - Intronic
1184477644 22:44730088-44730110 CCAGGGGCAGCCCTGGGGGCTGG - Intronic
1184697288 22:46147186-46147208 CCCCCTGGAGCTGTGGGGCCAGG + Intergenic
1184769746 22:46590144-46590166 GCTGGTGTAGATGTGGGGGCAGG - Intronic
1184921827 22:47610557-47610579 CCCCCTGCAGCTGATGGGGCCGG - Intergenic
1185205242 22:49534108-49534130 TCGGGTGCAGATGTGGTGGCTGG - Intronic
1185317792 22:50186280-50186302 CCCGGGTCAGGTTTGGGGGCCGG + Intronic
1185369936 22:50456359-50456381 CCCCCTGCAGCAGTGGGAGCTGG - Exonic
949948343 3:9208103-9208125 CCCAGTGCAACTGTGGGAGGGGG - Intronic
950259854 3:11535983-11536005 TCCAGTGCAGCTGTGGGCCCAGG + Intronic
952858782 3:37795009-37795031 GCCAGTGCAGGTGTGGGGGAGGG - Intronic
953192536 3:40701208-40701230 CTTAGTGGAGCTGTGGGGGCCGG + Intergenic
953228658 3:41044078-41044100 CCAGGTGGAGCTGTGGGGATGGG - Intergenic
953456085 3:43043341-43043363 CCAGGTCCAGCTGTGGGGGTGGG - Intronic
954301905 3:49704753-49704775 CCAGGTGCCGCAGTGGGGGCAGG + Exonic
954303801 3:49715048-49715070 CCCGTTGCAGCTGAGGGCTCCGG + Intronic
954690418 3:52392701-52392723 CCCGGGGCAGGTGGGTGGGCAGG - Intronic
955474943 3:59326946-59326968 ACAGGTGCAGGTGTGGGGTCTGG - Intergenic
958787452 3:98613229-98613251 CTTGGTGCTGTTGTGGGGGCAGG - Intergenic
959418380 3:106104388-106104410 CCTGGTGGAGCTGGGGAGGCTGG - Intergenic
961010092 3:123429893-123429915 CCCAGGGCAGCCGTTGGGGCAGG - Intronic
961352202 3:126311174-126311196 TCCAGAGCAGCTGTGGTGGCTGG - Intergenic
961406756 3:126685112-126685134 CCTGGTGGAGCTGTGGGAGCAGG + Intergenic
965083637 3:164066678-164066700 CCCAGTGGAGCTGTGGTGGCAGG - Intergenic
966861570 3:184233572-184233594 CCCGAAGCAGCTGGTGGGGCTGG - Exonic
967340370 3:188390559-188390581 CCCGGTCCAGCAGTGGCTGCAGG - Intronic
967971619 3:195003704-195003726 CTGGGTGCTGCTGCGGGGGCTGG - Intergenic
967971909 3:195005431-195005453 CCAGGTGGTGCTGTGAGGGCAGG + Intergenic
967979873 3:195059333-195059355 CCAGCTCCAGCTGAGGGGGCAGG + Intergenic
968495386 4:912406-912428 TCCGGAGGAGCTGAGGGGGCCGG + Intronic
968625066 4:1623335-1623357 CCCGGGGCTGCGGTGGGGGTGGG - Intronic
968956704 4:3723173-3723195 CCCAGTGGTGCTGTGGGGGCCGG + Intergenic
968986641 4:3879248-3879270 GCCGGGCCAGCTGAGGGGGCAGG + Intergenic
969255730 4:6000549-6000571 CCTGGTGTTGCAGTGGGGGCTGG - Intergenic
969611482 4:8229784-8229806 CCGGAGGCTGCTGTGGGGGCTGG - Intronic
970333269 4:15004617-15004639 CCCGGCGCAGCAGTGGGGACTGG + Intronic
972565482 4:40265376-40265398 CACCCTGCAGCTGTGGGAGCAGG + Intergenic
980014887 4:127637799-127637821 CCCTGTTTAGCTGAGGGGGCAGG + Intronic
982274226 4:153622994-153623016 GCCGGGGCAGCTGGGGGAGCTGG + Exonic
982281017 4:153684022-153684044 CACGGGGCAGCTGTCGGGGCAGG + Intergenic
982781198 4:159493006-159493028 CCTGGTGGAGCTATGGGGGTGGG + Intergenic
984695487 4:182775309-182775331 GCAGGTGCAGCTGGGGAGGCTGG + Intronic
984961278 4:185100590-185100612 CGCGGTGCAGCTGTATGGCCTGG - Intergenic
985593277 5:776198-776220 CCCGTTCCAGCAGTGGGGTCTGG - Intergenic
985657990 5:1142090-1142112 CCCAGTGCAGCTCTGGGGAGGGG - Intergenic
985692977 5:1323632-1323654 CCGTGTGCAGCTGCAGGGGCAGG + Intronic
986706903 5:10460117-10460139 CCAGGGTAAGCTGTGGGGGCAGG - Intronic
988180591 5:27786532-27786554 CCGGGTAGAGCTGTGGGGGCGGG - Intergenic
988310881 5:29556050-29556072 CTTGGAGCAGCTGTGGGGCCAGG + Intergenic
991321934 5:65383705-65383727 ACCAGTGGAGCTGTGGGGGTGGG - Intronic
992312038 5:75511239-75511261 TCCGGCGCAGCTGAGGGAGCGGG - Exonic
992894272 5:81233209-81233231 AAGGGTACAGCTGTGGGGGCCGG + Intergenic
993492161 5:88565530-88565552 CACAGTGCAGCAGTGAGGGCAGG + Intergenic
996822894 5:127650262-127650284 CCCAGTGCAGCAGTGGGGGCTGG + Intronic
996900817 5:128539094-128539116 CCCGGTGGGGCGGTGGGGGTAGG - Intronic
997475636 5:134140851-134140873 CCAGGGGCTGCAGTGGGGGCAGG - Intronic
998725127 5:145003948-145003970 CCTAGTGGAGCTATGGGGGCAGG + Intergenic
999309851 5:150544978-150545000 CCTGGAGCAGCTGAGGGGGCGGG + Intronic
1001014699 5:168129688-168129710 CCCAAAGCAGCTCTGGGGGCCGG - Intronic
1001289112 5:170443891-170443913 CCCAGGGCAGGGGTGGGGGCTGG + Intronic
1002440024 5:179259411-179259433 CCCGGTCCTGCTGTGCGTGCCGG + Intronic
1006288652 6:33117243-33117265 CCTGGGGCAGCCGTGGGGGCCGG + Intergenic
1006439425 6:34043813-34043835 CCCAGGGCAGCTCTGGGGGAAGG + Intronic
1006515313 6:34542173-34542195 AACGGGGCAGCTTTGGGGGCAGG + Intronic
1007833613 6:44657377-44657399 GCCGGGGCAGCTGTGGAGTCAGG + Intergenic
1007982485 6:46172950-46172972 GCAGGTGCAGATGTGGGAGCAGG - Intergenic
1008030421 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG + Exonic
1008189627 6:48438894-48438916 CCCAGTGGAGCTGTGGGAACAGG + Intergenic
1011311857 6:85988411-85988433 CCATATGCAGCTATGGGGGCTGG + Intergenic
1013009251 6:106105209-106105231 CCCAGGGCTGCTGTGAGGGCTGG - Exonic
1013618373 6:111866283-111866305 CCCTTTCCAGCTGTGTGGGCTGG - Intronic
1013793467 6:113859607-113859629 CCCGGTCCAGGGCTGGGGGCGGG + Intronic
1014116897 6:117676092-117676114 CCCGGTGCGGTGGTGGGGGGTGG + Intronic
1017842631 6:158233418-158233440 CCCGTTGCAGGTGTGGGTGTGGG + Intronic
1018579581 6:165297061-165297083 CCTGATGGAGCTTTGGGGGCTGG - Intronic
1018762543 6:166904406-166904428 CGCGCAGCAGCCGTGGGGGCAGG - Intronic
1019181060 6:170187471-170187493 CCAGGAGCATCTGTTGGGGCGGG - Intergenic
1019482452 7:1273163-1273185 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482475 7:1273230-1273252 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482498 7:1273297-1273319 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482521 7:1273364-1273386 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482544 7:1273431-1273453 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482567 7:1273498-1273520 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482590 7:1273565-1273587 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482613 7:1273632-1273654 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482636 7:1273699-1273721 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482659 7:1273766-1273788 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482681 7:1273833-1273855 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019482745 7:1274034-1274056 TCAGGTGCAGGTGTGGGGACAGG + Intergenic
1019484947 7:1285103-1285125 CTGGCTGCAGCTGTGGGGTCCGG + Intergenic
1019628066 7:2031333-2031355 CCACGTGTAGCTGTGGGGGAGGG + Intronic
1019712649 7:2524625-2524647 CCAGGGCCATCTGTGGGGGCCGG - Intronic
1020945525 7:14600942-14600964 CCTAGTGGAGCTATGGGGGCTGG - Intronic
1021950249 7:25767318-25767340 CCCATTGCAGCAGTGGGAGCTGG + Intergenic
1022255989 7:28658523-28658545 CCCAGTGCAGCTGCAGGGACTGG - Intronic
1022414081 7:30163429-30163451 CGTGGTGCAGCAGCGGGGGCAGG + Intergenic
1022504034 7:30899601-30899623 CCAGGAGCAGCTATGGGGCCTGG - Intergenic
1023038553 7:36153394-36153416 CCCGGTGCAGCCTCGGCGGCGGG + Exonic
1023795706 7:43790196-43790218 CCCAGTGCAGCGGCTGGGGCAGG - Intronic
1023885279 7:44349639-44349661 CCAGGAGCAGCTGAGGGGGCAGG - Intergenic
1024176338 7:46844635-46844657 CCCTCTGCAGATGTTGGGGCAGG + Intergenic
1025834907 7:65085395-65085417 CCAGGTGCATCTGTGGGCACGGG + Intergenic
1025904678 7:65774874-65774896 CCAGGTGCATCTGTGGGCACAGG + Intergenic
1027249997 7:76393149-76393171 CGTGGTGCAGCTGTGAGGGGCGG - Intronic
1028811425 7:95091738-95091760 CCCTTTGCAGTTGTGGGGGCAGG + Intronic
1029601015 7:101563525-101563547 CTCTGTCCAGCTGTGGAGGCTGG + Intergenic
1032159948 7:129502541-129502563 GCCGCCGCAGCTGTGGGCGCTGG - Exonic
1033218158 7:139509195-139509217 TCCGGGGCAGCTTTGGGGCCCGG + Intergenic
1034056023 7:148035697-148035719 CCTGGTGGAGCCGTGGGGGTAGG + Intronic
1034306235 7:150047517-150047539 CCGGGGGCATCTGTGGGGGGGGG - Intergenic
1034497675 7:151432105-151432127 CCGGGCGCAGCTCTGGGGACAGG - Intronic
1036201419 8:6774125-6774147 ACAGGGGCAGCTGTGGGGGTTGG - Intergenic
1038577488 8:28717439-28717461 CCCGGTGGTGCTGGGGGAGCAGG + Exonic
1041329972 8:56714047-56714069 ACTGGTGCAGCTGAGGGTGCTGG + Intergenic
1047318690 8:123758172-123758194 CCCTGGGCAGCTGAGGTGGCAGG - Intergenic
1049365262 8:142233962-142233984 CCCAGTGGAGCTGTGGGGGGCGG + Intronic
1049759920 8:144327268-144327290 CACGGTCCAGCTGTCCGGGCCGG + Intergenic
1050381974 9:5041001-5041023 CCAGGTGCAGCTGCGGGGTCCGG - Intronic
1050653597 9:7799637-7799659 CCGGGTGTAGCTGGGGGCGCAGG + Exonic
1053060697 9:35028973-35028995 CCCAGTGGAGCTGTGGAAGCAGG + Intergenic
1053077035 9:35141875-35141897 GCAGGTGAAGCTGTGGGGCCAGG - Intergenic
1053307555 9:36995131-36995153 CCCAGTGTGGCTTTGGGGGCAGG - Intronic
1053452063 9:38201786-38201808 CCCTCTGCTGCTGTGGGGGGAGG - Intergenic
1053566522 9:39258226-39258248 CCTGCTGCAGCTCTGGTGGCCGG - Intronic
1054130624 9:61360786-61360808 CCTGCTGCAGCTCTGGTGGCCGG + Intergenic
1054301898 9:63386006-63386028 CACTGTGCGGCTGTGGGGGGGGG + Intergenic
1056934928 9:90909104-90909126 CCCAGTACAGCTGGTGGGGCAGG + Intergenic
1057231401 9:93323775-93323797 CCCAGTGAGGCTGTGTGGGCCGG + Intronic
1057236694 9:93366848-93366870 CCCAGTGAAGCTGTGTGGGCTGG - Intergenic
1057566528 9:96170047-96170069 CCTGGTGCAGCCCTGTGGGCTGG - Intergenic
1057877832 9:98771387-98771409 CCCGGCGGTGCTGAGGGGGCTGG - Intronic
1058202484 9:102061701-102061723 CCTGTTGCAGGGGTGGGGGCTGG - Intergenic
1058386937 9:104447384-104447406 ACTGGTCCAGCTGTGGGGCCTGG - Intergenic
1059565432 9:115379671-115379693 CCTGGTGCACCTGAGGGTGCAGG - Intronic
1060508703 9:124216797-124216819 CCAGGGGCAGCTGTGGGTGGGGG + Intergenic
1060858749 9:126936580-126936602 CCCTGTGCAACTCTGGAGGCTGG + Intronic
1060885703 9:127150505-127150527 CCTGATGCAGCTGTGTGGGTGGG - Intronic
1061304434 9:129724277-129724299 CCTGGGGCACCAGTGGGGGCTGG + Intergenic
1061382917 9:130269041-130269063 CGCTGTGCAGCTCTGGGAGCTGG - Intergenic
1061385794 9:130288692-130288714 CCAGGTGCAGCTCTGAGTGCTGG + Intronic
1061592087 9:131604102-131604124 CCCTGGCCAGCTGTGAGGGCCGG - Intronic
1062036415 9:134384571-134384593 GCCGGTGGAGCTGTGGGTGCAGG + Intronic
1062212104 9:135370679-135370701 CCTGGTGCAGCTGGGGCAGCAGG + Intergenic
1062463611 9:136671867-136671889 CCCGGTGGAGCAGAGAGGGCGGG + Intronic
1062530633 9:136997978-136998000 GCCGGGGCAGCAGAGGGGGCTGG - Intergenic
1062538554 9:137031543-137031565 CGCTGGGCAGCTCTGGGGGCTGG + Exonic
1062547414 9:137069968-137069990 CCCGGAGCAGCTGTGCGCCCCGG - Exonic
1062700970 9:137902790-137902812 CCTGGTGCAGCTGTGCCGGCTGG + Intronic
1062732321 9:138117176-138117198 CCGGGTGGGGCTGTTGGGGCAGG + Intronic
1203441707 Un_GL000219v1:15688-15710 CCCGGTGCAGCTGGGCGGAGCGG - Intergenic
1203512517 Un_KI270741v1:134597-134619 CCCGGTGCAGCTGGGCGGAGCGG - Intergenic
1203621289 Un_KI270749v1:131151-131173 CACTGTGCGGCTGTGGGGGGTGG + Intergenic
1186481958 X:9902796-9902818 CCCCCTGGAGCTGTGGGTGCTGG + Intronic
1187154671 X:16712219-16712241 CCCGGTGCACTTGTGGGGCCGGG - Intronic
1188417741 X:29956464-29956486 CTCTGTGCAGGGGTGGGGGCGGG + Exonic
1189323438 X:40099191-40099213 CCCGGCGCGGCTCTGGGCGCGGG + Intronic
1189858856 X:45251814-45251836 TCCAGTGGAGCTGTGGGAGCAGG - Intergenic
1189990349 X:46588118-46588140 CCTGGTGCAAGTGTGTGGGCAGG + Intronic
1192491428 X:71579570-71579592 CCCGTTGCAGCATTGGGGGGAGG + Intronic
1196015844 X:110939138-110939160 CCCAGTGGAGCTGTGGGAACAGG + Intergenic
1196938451 X:120752574-120752596 CCCACTGCAGCTGTGAGGGGTGG - Intergenic
1197342427 X:125289089-125289111 CCCAGTAAAGCTGTTGGGGCAGG + Intergenic
1198194158 X:134343173-134343195 GGCGGTGCATGTGTGGGGGCAGG - Intergenic
1201303842 Y:12534032-12534054 CCATGTGCAGCTGTGGCTGCTGG + Intergenic
1201732405 Y:17218679-17218701 CCCGGTCCTGTTGTGGGGTCGGG + Intergenic