ID: 1008030423

View in Genome Browser
Species Human (GRCh38)
Location 6:46688215-46688237
Sequence GGTGCAGCTGTGGGGGCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1218
Summary {0: 1, 1: 0, 2: 11, 3: 117, 4: 1089}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030410_1008030423 20 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030408_1008030423 29 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030415_1008030423 -10 Left 1008030415 6:46688202-46688224 CCGATGTGATCCCGGTGCAGCTG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030411_1008030423 19 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030414_1008030423 -9 Left 1008030414 6:46688201-46688223 CCCGATGTGATCCCGGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089
1008030412_1008030423 8 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG 0: 1
1: 0
2: 11
3: 117
4: 1089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030423 Original CRISPR GGTGCAGCTGTGGGGGCTGG TGG Exonic
900002114 1:20280-20302 GATGGAGCTATGGGGGTTGGAGG + Intergenic
900021835 1:190803-190825 GATGGAGCTATGGGGGTTGGAGG + Intergenic
900158757 1:1213632-1213654 GGTGGGGCTGTGGGGCCAGGTGG + Intronic
900172457 1:1275604-1275626 GGTCCAACCCTGGGGGCTGGAGG - Intergenic
900187699 1:1340016-1340038 GGTGTGTCTGTGGGGGCTGCGGG - Exonic
900302460 1:1984894-1984916 GCTGCAGCTCCCGGGGCTGGGGG + Intronic
900311682 1:2036403-2036425 GGTGCAGCAATGGGGGCAGCCGG - Intergenic
900360162 1:2284519-2284541 GATGCAGCTGAGGTGCCTGGGGG + Intronic
900376427 1:2356904-2356926 GGGGCAGAGTTGGGGGCTGGGGG + Intronic
900384295 1:2402534-2402556 AGCGCAGCTGTGGGAGCGGGCGG + Intronic
900539886 1:3197344-3197366 GGGGCCGCTGTGATGGCTGGGGG - Intronic
900748537 1:4378097-4378119 GATGCAGCTCTGGGGCCAGGAGG - Intergenic
900999259 1:6140021-6140043 GCTACAGCCTTGGGGGCTGGTGG - Intronic
901029937 1:6301144-6301166 GGTTTAGCTGTGGGGGAAGGAGG + Intronic
901211045 1:7526307-7526329 GGTGCAGTGGTGGGCGGTGGGGG - Intronic
901422899 1:9162784-9162806 GGTACAGCTGGAGGGGCAGGTGG + Intergenic
901640253 1:10689398-10689420 TCTGGGGCTGTGGGGGCTGGGGG + Intronic
901771205 1:11531261-11531283 GGTGCATGTGTGTGGGATGGGGG + Intronic
902073633 1:13764659-13764681 TCTGCAGCTGTGGAGGCTGCAGG - Intronic
902315883 1:15617888-15617910 GGTGAAGAATTGGGGGCTGGGGG + Intronic
902706921 1:18212043-18212065 GGAGCAGCTGATGGGGGTGGAGG + Intronic
902889358 1:19430710-19430732 GGTGCAGGTGCGGGTGCGGGTGG - Intronic
903071153 1:20727522-20727544 GCAGCAGCTGTGGGCGCTGAAGG - Exonic
903540732 1:24094810-24094832 GGGCCAGCTCTGGAGGCTGGGGG + Intronic
903554025 1:24180443-24180465 GATGTAGCTGTGGGGGCCAGAGG - Intronic
903566052 1:24266626-24266648 GGTGGGGCAGTGGGCGCTGGTGG - Intergenic
903888497 1:26554958-26554980 GGAGCAGCGGTGGGGGCGCGAGG - Intronic
903950627 1:26994057-26994079 GGCGCGGCTGCGGGGGCGGGGGG + Exonic
904042502 1:27592796-27592818 GGTTAACCTGTGAGGGCTGGGGG + Intronic
904287440 1:29461505-29461527 GGTGGAGCAGAGGGGGCTGGTGG - Intergenic
904328885 1:29745234-29745256 GGTGGAGCAGAGAGGGCTGGTGG - Intergenic
904418271 1:30375780-30375802 GGTGAAGTTGGGGAGGCTGGAGG - Intergenic
904463759 1:30695805-30695827 TCTGCATCTGTAGGGGCTGGAGG + Intergenic
904829978 1:33300051-33300073 GGTGTGTCTGTGGGGGCTGGGGG - Exonic
905238250 1:36565239-36565261 GGGGCAGCTCTGGGAACTGGCGG + Intergenic
905321372 1:37119779-37119801 GAGGCTGCTGGGGGGGCTGGAGG - Intergenic
905694128 1:39962562-39962584 GGTGCAGCGGGGGGGCCTGGAGG + Intronic
905891643 1:41521921-41521943 GGTGGCCCTGTGGTGGCTGGGGG - Intronic
906153050 1:43598913-43598935 GGTGCAGCATTGGGTGGTGGTGG + Exonic
906460917 1:46034723-46034745 GGTGAAGCTGTTGGGGGTGGGGG - Exonic
906727490 1:48054722-48054744 GGAAAAGCTGTGGGAGCTGGGGG + Intergenic
906753945 1:48291401-48291423 GCAGCTGCTGTGGGGGATGGGGG + Intergenic
906910525 1:49944017-49944039 GTTGCTGCTGTGGGGGATGGGGG - Intronic
906976267 1:50576638-50576660 GGTGCAGGGGTGGTGGCGGGGGG - Intronic
907241507 1:53083761-53083783 GGTGCAGATAGGAGGGCTGGTGG + Intronic
907242109 1:53086548-53086570 GATACAGCTCTGGGGTCTGGAGG - Intergenic
907401175 1:54225882-54225904 GGAGCAGCTGTGGGGGGTGGGGG - Intronic
907768649 1:57437682-57437704 AGTGCACTTGTGGGGGCTGGGGG - Intronic
908283094 1:62563257-62563279 GTTGTAGCAGTGGGGGCTGGAGG - Intronic
909207426 1:72777075-72777097 GGAGCAGGTTTGGGGGGTGGGGG - Intergenic
909443222 1:75720852-75720874 GGTGGAGCTGGGGGGGTAGGCGG + Intergenic
909649365 1:77956598-77956620 GGTGCACCTGCAGGGGCTGCTGG + Exonic
910670017 1:89763159-89763181 AGGGCAGCTCTGAGGGCTGGAGG + Intronic
911589427 1:99729540-99729562 GGTGGAACTGTGGGGGTTGGAGG + Intronic
912390187 1:109297452-109297474 CGTGCAGCTGGGTGGGCTGGAGG - Exonic
913173781 1:116255810-116255832 GGAGCACCTGGGGAGGCTGGGGG - Intergenic
913215647 1:116617890-116617912 GCTGCAGCTGTGGGAGGAGGTGG - Intronic
914407299 1:147389200-147389222 GGTGGAGCAGTGGAGGCTGGAGG - Intergenic
914455550 1:147833327-147833349 GCGGCCGCTGTGGGGGATGGGGG + Intergenic
914915361 1:151816087-151816109 GGTGGAGCTGGGGGGGCATGAGG - Intronic
915068396 1:153245064-153245086 GGTGCAGCTGGTGGAGGTGGTGG + Intergenic
915473593 1:156139683-156139705 GGGGCAGGGGTGGGGACTGGGGG - Exonic
915507871 1:156368924-156368946 GGCACAGCTGTGGGACCTGGGGG - Intergenic
915637867 1:157199036-157199058 GGTGCAGGTGGGCAGGCTGGAGG + Intergenic
916184413 1:162116823-162116845 GATGCAGCTGTTGGGAGTGGGGG - Intronic
916395293 1:164380325-164380347 GATGCAGTGGTGGGGGCTTGTGG + Intergenic
916419758 1:164626047-164626069 GGTGGTGGTGTGTGGGCTGGGGG - Intronic
917611191 1:176690494-176690516 GGTGGAGGTGTGGGAGCTGATGG + Intronic
918158357 1:181872732-181872754 GTGGCTGCTGTGGGGGGTGGGGG - Intergenic
918194201 1:182206638-182206660 GGCCCAGCTGAGGGGCCTGGAGG - Intergenic
918353105 1:183678082-183678104 GGTGGAACTTTGGGGGTTGGAGG + Intronic
918819743 1:189237092-189237114 GCAGCTGCTGTGGGGGATGGAGG + Intergenic
919750491 1:201034737-201034759 GCTGGGGCTGTGGGGGCTGGGGG - Intergenic
919763512 1:201112480-201112502 GGGGCAGGAGTGGGGGCAGGAGG + Exonic
920294503 1:204947560-204947582 GGCACAGCAGTGGGAGCTGGAGG - Intronic
920375627 1:205506297-205506319 TGTGCAGCTGAGGAGGCTGTGGG + Intronic
920795304 1:209131107-209131129 GGGGCAGCGGTGGTGGCGGGCGG + Intergenic
921378311 1:214497110-214497132 GGGGCAGCGGTGGGGGGTCGGGG + Intronic
921409815 1:214823554-214823576 GTGGCTGCTGTGGGGGATGGTGG + Intergenic
921627315 1:217391083-217391105 TGTGCATGTGTGGGGGCAGGAGG + Intergenic
922130637 1:222773709-222773731 TGTGCACCTGTTGGGGCAGGAGG + Intergenic
922135806 1:222825155-222825177 GGGGCAGTGGTGGGGGATGGTGG + Intergenic
922414060 1:225403980-225404002 GGGAGAGCTGTGGGAGCTGGAGG - Intronic
922798515 1:228353301-228353323 GCAGCACCTGTGTGGGCTGGTGG + Intronic
923013688 1:230109285-230109307 GCTGCAGCAGTGGTGGTTGGGGG + Intronic
923095096 1:230769065-230769087 GGGGCAGCAGAAGGGGCTGGAGG + Intronic
923299740 1:232630156-232630178 GGTGCCGCTGGGCGGGCGGGCGG - Intergenic
923394005 1:233542996-233543018 GGAGAAACTGTGGAGGCTGGGGG - Intergenic
924421600 1:243915023-243915045 GAAGCTGCTGTGGGGGCTGAGGG - Intergenic
924436799 1:244049223-244049245 GCTGCAGCTGCGGGGTCGGGCGG + Intronic
924567398 1:245210184-245210206 GCTGCAGCTGCGGGGCCTTGGGG - Intronic
924745722 1:246831780-246831802 GGAACAACGGTGGGGGCTGGGGG + Intergenic
924939770 1:248804923-248804945 GGGGCAGCAGTGAAGGCTGGAGG - Intergenic
1062886381 10:1019651-1019673 GGAGGAGCTGTGGGAGCTGCTGG - Exonic
1062921838 10:1286075-1286097 GGTGGGGCAGTGGGGGCGGGTGG + Intronic
1066010170 10:31187791-31187813 GAAGCAGCTGTGGGGGCACGCGG - Intergenic
1067314719 10:45150992-45151014 GGGGCTGCCGTGGGGGCTGCTGG - Intergenic
1067513951 10:46920702-46920724 GAGGCCACTGTGGGGGCTGGGGG + Intronic
1067525992 10:47038951-47038973 GGTGTGGCTGTGGGGCCTGGCGG - Intergenic
1067648303 10:48131130-48131152 GAGGCCACTGTGGGGGCTGGGGG - Intergenic
1067800273 10:49353805-49353827 GCTGCAGTGGAGGGGGCTGGAGG - Intergenic
1067932461 10:50576414-50576436 GTGGCAGCTGTGGTGGCTGCTGG - Intronic
1068538654 10:58267977-58267999 GCGGCAGCTGAGGGGACTGGAGG - Intergenic
1068717113 10:60200610-60200632 GCTGCAGATGTGGGGGGTGTGGG - Intronic
1069242723 10:66162884-66162906 GCAGCTGCTGTGGGGGGTGGGGG + Intronic
1069703229 10:70441271-70441293 GGTGCAGCGTTGGTGGCTGGGGG - Intronic
1069735186 10:70649332-70649354 GGTGCAGGTGGGGTGCCTGGAGG + Intergenic
1069916278 10:71789175-71789197 GGTGCAGCTCCGGGAGATGGTGG + Intronic
1069994788 10:72335612-72335634 CGAGCAGCTGTGGGGCCTGCTGG - Exonic
1070060878 10:72981639-72981661 GGTGTATCTGTGGGGATTGGGGG + Intergenic
1070397315 10:76022680-76022702 GGTGGAGCAGTGAGGCCTGGTGG - Intronic
1070684615 10:78471545-78471567 GGTGGAGGTGTGGGGGCCAGAGG + Intergenic
1070728905 10:78811501-78811523 GGTGCTGCTTTGGGTGGTGGAGG - Intergenic
1070829177 10:79408168-79408190 GCTACAGATGTGGAGGCTGGTGG + Intronic
1070920488 10:80182210-80182232 GGTGCAAGTGTGGGGGCAGGGGG + Intronic
1070935703 10:80293117-80293139 GGTGCAGAGGTGGGGGGTGCAGG + Intergenic
1071104555 10:82079410-82079432 GGTGCATGTGTGGGGGCAGTAGG - Intronic
1071484726 10:86091452-86091474 GTGGCTGCTGTGGGGGATGGGGG - Intronic
1071562377 10:86654603-86654625 GGAGCTGCTCTTGGGGCTGGCGG - Exonic
1072210955 10:93246680-93246702 GGGGCAGAGGTGGGGGTTGGGGG + Intergenic
1072221828 10:93333496-93333518 GGTGCAGGGGTGGTGGCAGGGGG + Intronic
1073096588 10:100983835-100983857 GGTGATGATGAGGGGGCTGGGGG + Exonic
1073321487 10:102618853-102618875 GGAGCTGCTGAGGAGGCTGGAGG + Intronic
1073412132 10:103350954-103350976 GGTGCAGGGGTGAGGGCGGGCGG + Exonic
1073488872 10:103839589-103839611 GGTGGGGCTGTGTGGGCTTGGGG - Intronic
1073514920 10:104067661-104067683 GCTGCAGGTGTGGGGGCGGCAGG + Intronic
1073570419 10:104576608-104576630 GGTGCAGAAGTGGGGATTGGAGG - Intergenic
1073986621 10:109216876-109216898 AGTGCAGCTATGGGGTTTGGGGG + Intergenic
1074151603 10:110764300-110764322 GTTGCTGCTGTGGGTGGTGGTGG - Intronic
1074289534 10:112128027-112128049 GGTGTATCTGTGGGAGCTGAGGG - Intergenic
1074765491 10:116696981-116697003 GGGGTAACTGTGGGTGCTGGGGG - Intronic
1075483662 10:122802516-122802538 GTTGCAGGGGTGGGGGGTGGCGG + Intergenic
1075632097 10:124006616-124006638 GGTGCATCTTTGAGGGCTGAGGG - Intergenic
1075660084 10:124187411-124187433 GGAGCACCTGTGTGGCCTGGGGG - Intergenic
1075725776 10:124610352-124610374 GGTGCGGGTGAGGGTGCTGGTGG + Intronic
1075725786 10:124610385-124610407 GGTGCGGGTGAGGGTGCTGGTGG + Intronic
1075725831 10:124610550-124610572 GGTGCGGGTGAGGGTGCTGGTGG + Intronic
1075725841 10:124610589-124610611 GGTGCAGGTGAGGGTGCTGATGG + Intronic
1075725860 10:124610655-124610677 GGTGCGGGTGAGGGTGCTGGTGG + Intronic
1075725870 10:124610694-124610716 GGTGCAGGTGAGGGTGCTGATGG + Intronic
1075725945 10:124610964-124610986 GGTGCGGGTGAGGGTGCTGGTGG + Intronic
1075748219 10:124743123-124743145 GGTGGAGAGCTGGGGGCTGGGGG + Intronic
1075874835 10:125797635-125797657 GGTGGAGCTGGAGGGGCAGGTGG + Intronic
1076003658 10:126931336-126931358 TGTGCAGCTGTGAGGTTTGGAGG + Intronic
1076169596 10:128308296-128308318 GCTGGAGCAGCGGGGGCTGGAGG - Intergenic
1076461468 10:130650127-130650149 GCTGCAGGTGAGGGGGCTGGGGG + Intergenic
1076514632 10:131036998-131037020 GACACTGCTGTGGGGGCTGGAGG - Intergenic
1076591611 10:131587441-131587463 GCTGCAGTGGAGGGGGCTGGTGG - Intergenic
1076605627 10:131687593-131687615 TGTGCACCTGTGTGTGCTGGCGG - Intergenic
1076753653 10:132556402-132556424 TGGGCACCTGTTGGGGCTGGTGG + Intronic
1076782169 10:132730359-132730381 AGTGCAGCCGGGTGGGCTGGTGG + Intronic
1076810283 10:132882814-132882836 GGAGCAGCTGTGGAGGCCGATGG + Intronic
1076836917 10:133025792-133025814 GGAGCAAGTGTGGGAGCTGGAGG + Intergenic
1076841581 10:133048550-133048572 GGTGCAGCTCTGTGGCCCGGAGG + Intergenic
1076871529 10:133197268-133197290 GGTGCATCTGGGGGTGCAGGGGG + Intronic
1076996115 11:298340-298362 GGTGCCCATGTTGGGGCTGGAGG + Exonic
1077035037 11:490374-490396 GGGGCTGGTGTGGGGGCAGGTGG + Intronic
1077038602 11:507379-507401 GGCGCAGCGGCGGGGCCTGGTGG + Intergenic
1077081111 11:725125-725147 AGTGCAGATGTGGGGGCTCCTGG - Intronic
1077093102 11:788401-788423 GGTGCCGTGGTGGGGGCTGCTGG + Exonic
1077228845 11:1449811-1449833 GGGGCTGCTGAGTGGGCTGGTGG - Exonic
1077235095 11:1478157-1478179 GTGGCGGCTGTGGGGCCTGGCGG - Intronic
1077235098 11:1478166-1478188 GGTGGGGCTGTGGCGGCTGTGGG - Intronic
1077339388 11:2019218-2019240 GCTGCACCTGGGGAGGCTGGGGG + Intergenic
1077453022 11:2662372-2662394 GGGGCAGGGGAGGGGGCTGGGGG - Intronic
1077460803 11:2708461-2708483 GGTGGGGCTGAGGAGGCTGGAGG + Intronic
1077485149 11:2835075-2835097 GGTGCAGGCCCGGGGGCTGGGGG + Intronic
1077506535 11:2932203-2932225 GTTGCCAATGTGGGGGCTGGAGG + Intergenic
1077864307 11:6210480-6210502 GGTGCTGATGTGGGGGCCAGAGG - Exonic
1078087425 11:8242619-8242641 TGCACAGCTGTGGGGACTGGTGG + Intronic
1078267492 11:9765965-9765987 ATTGCAGCTGTGGGAGCTGTAGG + Intergenic
1078288587 11:9983396-9983418 GTAGCTGCTGTGGGGGATGGGGG - Intronic
1078315298 11:10289282-10289304 GCTGCAGCTGTGTGGGGTGGGGG + Intronic
1078318062 11:10308116-10308138 GGTGCAGGTCTGGGGGGTGTAGG - Intergenic
1078656644 11:13246921-13246943 GGTGGGGCTGGGGGGACTGGAGG - Intergenic
1078855436 11:15202817-15202839 TGTGCAGCTGGGATGGCTGGAGG + Intronic
1079058549 11:17228285-17228307 GGTGCAGTTGGGGGGCCCGGAGG + Intronic
1079076727 11:17389152-17389174 GGTGCAGCGGCGGCGGCGGGCGG - Intronic
1079125102 11:17713453-17713475 CCTGGAGCTGTAGGGGCTGGGGG - Intergenic
1079317448 11:19421173-19421195 GATGCAGCTGAGAGGGCTGGAGG - Intronic
1079364788 11:19799778-19799800 AGGGCAGGTGTGGGGGGTGGTGG - Intronic
1079453108 11:20614463-20614485 GGTGCAGTTGTGGGGACTGGGGG + Intronic
1080026884 11:27624445-27624467 GGTGAAACTGTTGGGGATGGAGG + Intergenic
1080566788 11:33517090-33517112 GATGCAGCTGTAATGGCTGGTGG + Intergenic
1080609802 11:33894014-33894036 GGTGAGGCTGTGAAGGCTGGTGG + Intergenic
1080733868 11:34990055-34990077 GATGCCACTGTGGGGGCTGTAGG + Intronic
1080885346 11:36362847-36362869 GCTGCATGGGTGGGGGCTGGGGG + Intronic
1081195260 11:40152757-40152779 GTGGCTGCTGTGGGGGATGGGGG - Intronic
1081638470 11:44736648-44736670 GATTTAGCTGTGGAGGCTGGAGG + Intronic
1082790833 11:57345870-57345892 GTTGAAGGTGGGGGGGCTGGGGG - Intronic
1083061318 11:59875553-59875575 AGTGCTGCTGTAGGAGCTGGGGG - Intergenic
1083104763 11:60347106-60347128 AGTGCAGCTGGAGGAGCTGGTGG + Intronic
1083361129 11:62108965-62108987 GGTGCAGCTGTCGTGGCTTCTGG - Intergenic
1083399797 11:62415604-62415626 GGGGCAGCTGTGATGGCTGCAGG - Intronic
1083659368 11:64245188-64245210 GGTCAAGGTGAGGGGGCTGGGGG - Exonic
1083680983 11:64351810-64351832 GGTGTAGATGTGGGGGCTGGCGG - Intronic
1083683063 11:64360093-64360115 GGTGCAGGCTTGGGGGGTGGGGG - Intronic
1083822766 11:65182118-65182140 GGAGCAGGGGTGGGGGCTGGCGG + Intronic
1084088563 11:66865867-66865889 GGGGCTCCTGTGGGAGCTGGAGG + Intronic
1084270422 11:68026576-68026598 GGGGCTGCTCTGGGGGGTGGAGG - Intronic
1084492986 11:69488450-69488472 GGAGCAGCTGGGGTGGCGGGAGG - Intergenic
1084546387 11:69817137-69817159 AGTGCTGTGGTGGGGGCTGGGGG + Intronic
1084665321 11:70573264-70573286 ACTGCAGCGGTGGGGGCGGGGGG + Intronic
1084708442 11:70829503-70829525 GGTGCAGGGGTGGGGGTGGGCGG - Intronic
1085282532 11:75340545-75340567 GGAGAGGCTGTGGGGGCTGGGGG + Intronic
1085948713 11:81303920-81303942 GGGGCAGGTGAGGGAGCTGGGGG + Intergenic
1086300682 11:85423603-85423625 GCAGCTGCTGTGGGGGATGGGGG + Intronic
1088179466 11:107092703-107092725 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
1088814852 11:113413838-113413860 AGAGCAGCTGCGGGGACTGGTGG - Intronic
1088900229 11:114110097-114110119 GGTGCAAATGTGTGTGCTGGGGG + Intronic
1089080634 11:115773593-115773615 GGTGCAGGTGACGGTGCTGGGGG + Intergenic
1089576393 11:119447421-119447443 GGTGGAGCTGGGGGGTCTTGGGG + Intergenic
1089938032 11:122385642-122385664 GGTGCAGATGTGGGGTCTTTGGG - Intergenic
1090136496 11:124204476-124204498 GCTGCAGCTGCTGGGGGTGGGGG + Intergenic
1090400457 11:126445348-126445370 GGCGCAGCCCTGTGGGCTGGGGG + Intronic
1090778273 11:129984161-129984183 GGTGCTGATGTGGGAGCTGAGGG - Intronic
1091076542 11:132623310-132623332 GGTGCAACTGTGGGCGATGAAGG - Intronic
1202822373 11_KI270721v1_random:74407-74429 GCTGCACCTGGGGAGGCTGGGGG + Intergenic
1091375179 12:20315-20337 GATGGAGCTATGGGGGTTGGAGG + Intergenic
1091822099 12:3483130-3483152 GGGGCTGCTGTGGGGATTGGTGG + Intronic
1091903505 12:4164691-4164713 GGTGCCGCTTTGGGAACTGGGGG - Intergenic
1092183502 12:6462191-6462213 GGAGTAGCTGTGGGGGCTTGGGG - Exonic
1092230386 12:6772774-6772796 GGGGCAGTGGTGGGGGGTGGGGG - Exonic
1093029892 12:14278777-14278799 TGTGCAGGTGTGGGGGCAGTAGG - Intergenic
1093991413 12:25593038-25593060 GCAGCTGCTGTGGGGGGTGGGGG - Intronic
1093994947 12:25631120-25631142 GGTCTTGCTGTGGGGGATGGGGG - Intronic
1095132767 12:38563733-38563755 GATCCAGATGTGGGGGTTGGAGG - Intergenic
1095180585 12:39143466-39143488 GGTGGAGGTTTGGGGGCGGGGGG - Intergenic
1095349220 12:41188980-41189002 GGCGCAGCTCTGGGCGCTGCAGG + Exonic
1095932072 12:47637157-47637179 GCTGCTGCTGTGGGGGCTGGAGG - Intergenic
1095964636 12:47858582-47858604 GGGGCAGCTGTGGGGGTGGAGGG + Intronic
1096071194 12:48776394-48776416 GGTCCAGGTGGGGGGGATGGGGG - Intronic
1096099043 12:48957636-48957658 GGGGCAGGTGTGGGGGCTGTGGG + Intergenic
1096231855 12:49901162-49901184 GGCACCGCTGTGGGGGCTGGGGG + Exonic
1096590054 12:52652048-52652070 GGCTCAGCTGTGGTGTCTGGTGG - Exonic
1096621952 12:52870709-52870731 GGTGCCGCCCTGGGAGCTGGGGG - Intergenic
1096888606 12:54743664-54743686 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1097184031 12:57187114-57187136 GGTGCAGCAGAGAGGGCTCGGGG - Intronic
1097279988 12:57839163-57839185 GGTGAAGCTGAGGGGTGTGGGGG - Intronic
1097760540 12:63459495-63459517 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1098041045 12:66354280-66354302 GGTGAAGGAGTGAGGGCTGGTGG - Intronic
1098095158 12:66946786-66946808 GGGGGGGGTGTGGGGGCTGGGGG + Intergenic
1098288474 12:68933094-68933116 GGCGCAGCTGTGGCAGCTGCCGG - Intronic
1099909376 12:88810997-88811019 GGTGAAGCGGTGGAGGCTGAGGG - Intergenic
1100214872 12:92437087-92437109 GTTGCAGCTGTGTGGGATGAAGG - Intergenic
1100603148 12:96129627-96129649 GGTGAAGCTCTGAAGGCTGGTGG - Intergenic
1101131843 12:101697930-101697952 GGCGCAGCTGCGGCGACTGGAGG + Exonic
1101290376 12:103361822-103361844 GCAGCTGCTGTGGGGGATGGGGG - Intronic
1101544442 12:105698166-105698188 TGTGCTGCTGTGGGGGGTGGGGG + Intergenic
1102217183 12:111169846-111169868 GGTTCTGCTGGGGTGGCTGGTGG + Intronic
1102220874 12:111193672-111193694 GCTGGAGGTGTGGGGGCTGCGGG + Intronic
1102232672 12:111274454-111274476 GCTGCTGCTGTTGGTGCTGGTGG + Intronic
1102413739 12:112742636-112742658 GGGGCTGCTGTCAGGGCTGGGGG + Intronic
1102561344 12:113764466-113764488 GGAGCAGCAGTGTGGGGTGGAGG + Intergenic
1102796857 12:115696350-115696372 GCTGCAGGGGTGGAGGCTGGGGG + Intergenic
1102877271 12:116458289-116458311 GGGGTAGCTGTGGGGGATGGGGG - Intergenic
1103119685 12:118371456-118371478 GGAGGAGCTGGAGGGGCTGGTGG - Intronic
1103565693 12:121814324-121814346 GGGGCAGCGGTGGGGGCATGGGG - Exonic
1103703468 12:122859570-122859592 TGTGGAGCTTTGGGGGCCGGAGG + Intronic
1103904238 12:124319300-124319322 GCAGCAGCTCTTGGGGCTGGTGG + Intergenic
1103933350 12:124462350-124462372 GGTGCAGGACTGGGGGCTTGGGG - Intronic
1103956928 12:124582489-124582511 GGAGCTGCTGTGGGGGCCTGGGG + Intergenic
1104494661 12:129225862-129225884 TGAGTGGCTGTGGGGGCTGGGGG - Intronic
1104504511 12:129318798-129318820 GCTGCTGCTATGGGGGATGGAGG + Intronic
1104728914 12:131094450-131094472 GGGGTAACTGTGGAGGCTGGAGG + Intronic
1104746199 12:131211945-131211967 TGTGAATCTGTGGGGTCTGGGGG - Intergenic
1104845624 12:131845340-131845362 GGTGCATCTGTGCCGGCTGCAGG - Exonic
1104888297 12:132124963-132124985 GGTGCATTTGTGGGGGCCGAGGG + Intronic
1105009182 12:132744104-132744126 GGTGCAGCTGTGGGAGCTCCAGG - Intronic
1105014898 12:132780586-132780608 AGTGCAGCTGTGAGGGCCTGGGG - Intronic
1105240920 13:18609315-18609337 GGAGGAGCTGGGGGAGCTGGCGG + Intergenic
1105578758 13:21675022-21675044 GGGGGGGATGTGGGGGCTGGGGG + Intronic
1105665715 13:22553450-22553472 GGTGAAGCTGTGTGGGCTTCTGG - Intergenic
1105719719 13:23101524-23101546 GCTCCAGGTGTGGAGGCTGGCGG - Intergenic
1105719727 13:23101565-23101587 GCTCCAGGTGTGGAGGCTGGCGG - Intergenic
1105719735 13:23101606-23101628 GTTCCAGGTGTGGAGGCTGGCGG - Intergenic
1105719743 13:23101647-23101669 GCTCCAGGTGTGGAGGCTGGCGG - Intergenic
1105719751 13:23101688-23101710 GCTCCAGGTGTGGAGGCTGGCGG - Intergenic
1105908247 13:24835141-24835163 GAGGCTGCTGTGGGGGATGGGGG - Intronic
1106242863 13:27924483-27924505 GGGACAGCTGTCGGGGGTGGCGG + Exonic
1106275080 13:28197016-28197038 GGTGCAGGGGTGGGAGGTGGTGG + Intronic
1106481515 13:30140556-30140578 GATGCAGCTGTGGGAGGAGGTGG - Intergenic
1106720158 13:32428022-32428044 GCTGCTGCTGCTGGGGCTGGAGG + Exonic
1106726870 13:32495425-32495447 GGTACAACTTTGGGGGCTGGGGG - Intronic
1107449103 13:40492494-40492516 GGTGAGCCTGTGGGGGCAGGTGG + Intergenic
1107549675 13:41463223-41463245 GGTGTAGCTTTGGGGCCTTGAGG + Intronic
1107877179 13:44801065-44801087 GATGCAGTCGTGGGTGCTGGTGG - Intergenic
1108817092 13:54305370-54305392 GGGGCTGCTGTGGGGGATGGGGG - Intergenic
1110340915 13:74388911-74388933 GTGGCTGCTGTGGGGGTTGGGGG + Intergenic
1111748235 13:92296426-92296448 GCTGCTGCTGTGGGGGATGGGGG + Intronic
1112092045 13:96091758-96091780 CGGGAAGCGGTGGGGGCTGGGGG - Intronic
1112111999 13:96311404-96311426 TGGGAAGTTGTGGGGGCTGGTGG + Intronic
1112337877 13:98529338-98529360 GCTGCTGCTGTGGGGGAGGGAGG - Intronic
1112461235 13:99605643-99605665 GGAGCAGGCGTGGGAGCTGGGGG + Intergenic
1113037765 13:106070088-106070110 GGAGGAGATGTGGGGGCAGGAGG - Intergenic
1113523291 13:110955311-110955333 GCTGCAGCTGGGTGTGCTGGGGG - Intergenic
1113593935 13:111518273-111518295 GGGGCAGGTGAGGGAGCTGGAGG - Intergenic
1113767651 13:112891002-112891024 TGTGCAGATTTGGGGGCTGGAGG + Intergenic
1113889834 13:113730121-113730143 GGTGCAGCCGCGGGGACTGGGGG - Intronic
1113889851 13:113730172-113730194 GGTGCAGCCGCGGGGACTGGGGG - Intronic
1113889886 13:113730274-113730296 GGTGCAGCCGCAGGGACTGGGGG - Intronic
1113889901 13:113730323-113730345 GGCTCAGCTGCGGGGACTGGGGG - Intronic
1113928070 13:113952217-113952239 GGTGTAGCTGGCGTGGCTGGAGG + Intergenic
1113955875 13:114099683-114099705 GGGGCTGCTGTGGGGGCTGTGGG - Intronic
1113955885 13:114099706-114099728 GGGGCTGCTGTGGGGGCTGTGGG - Intronic
1115393227 14:32877402-32877424 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1115738692 14:36363987-36364009 TGTGCTGCTGTGGGGGCTGTAGG + Intergenic
1116186365 14:41605630-41605652 GGTGCAGGTGTGCGCGCTTGGGG + Intergenic
1116346701 14:43803257-43803279 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1116828271 14:49693112-49693134 CGTGGAGCAGTCGGGGCTGGAGG + Exonic
1117157850 14:52958454-52958476 GGTGCAGCAGGGTGGGGTGGGGG - Intergenic
1117680626 14:58199874-58199896 GGTGCGGCTTTGGGGCGTGGTGG + Intronic
1118162320 14:63302393-63302415 GCTGCTGCTGTGGGGGATGGGGG - Intergenic
1118379939 14:65209267-65209289 GGTGAAGCTGAGGGGCCAGGAGG + Intergenic
1118392054 14:65303935-65303957 GCTGCAGCTGGCTGGGCTGGGGG - Intergenic
1118532210 14:66718880-66718902 GCAGCTGCTGTGGGGGATGGGGG + Intronic
1118689273 14:68322679-68322701 AGTGCATCTGTGAGGCCTGGAGG - Intronic
1119923779 14:78472236-78472258 GGAGGTGGTGTGGGGGCTGGAGG + Intronic
1120305705 14:82766901-82766923 GCCACAGCTGTGGGGACTGGAGG + Intergenic
1121303662 14:92891496-92891518 GGTGCAGCAGTTTGGGCTGGAGG - Intergenic
1121339784 14:93098563-93098585 GGTTTAGCTGGTGGGGCTGGTGG - Intronic
1121554902 14:94829125-94829147 GGTGAGGCTGCAGGGGCTGGGGG - Intergenic
1121634564 14:95445165-95445187 GGTGCAGTTCTAGGAGCTGGGGG - Intronic
1121674518 14:95741557-95741579 GTGGCAGGTGTGGAGGCTGGAGG - Intergenic
1121775146 14:96585337-96585359 GCTGCAGGAGTGGGGGCTGCTGG + Intergenic
1121848442 14:97196439-97196461 GCAGCTGCTGTGGGGGATGGAGG + Intergenic
1122141260 14:99664319-99664341 GGAATGGCTGTGGGGGCTGGGGG - Intronic
1122342188 14:101035637-101035659 GGTGCAGCTGTGGGAGCAGAAGG + Intergenic
1122445036 14:101761832-101761854 GCTGCTGCTGCGGGGGCAGGCGG + Exonic
1122603000 14:102930487-102930509 GGAGCTGGTGAGGGGGCTGGAGG + Exonic
1122626103 14:103086046-103086068 GGCGCTGCTGAGGGGGCTGGAGG + Intergenic
1122727006 14:103762756-103762778 GCTGCTGCTGTGGGGGCAGGTGG + Intronic
1122783452 14:104153456-104153478 GGTTCAGCTCTGGGGCCAGGAGG - Intronic
1122874656 14:104658403-104658425 GGTGCCCGAGTGGGGGCTGGAGG - Intergenic
1122971183 14:105152882-105152904 GGTGCAGCTGGGGGTGCAGCTGG - Intronic
1123068087 14:105628183-105628205 GGGGCAGGTGGGGGGGCAGGAGG - Intergenic
1123072425 14:105648245-105648267 GGTGCAGCCGTGGGCGCTCCTGG - Intergenic
1123411762 15:20066653-20066675 TGTGCAGCTGTGTGAGCAGGAGG - Intergenic
1123490438 15:20775824-20775846 GGAGGAGCTGGGGGAGCTGGCGG - Intergenic
1123521106 15:21073772-21073794 TGTGCAGCTGTGTGAGCAGGAGG - Intergenic
1123546939 15:21344911-21344933 GGAGGAGCTGGGGGAGCTGGCGG - Intergenic
1123681645 15:22768353-22768375 GGAGCAGATGTGGGAGCAGGAGG - Intergenic
1123727235 15:23115157-23115179 GGTGGGGCTTTGGGGGCAGGGGG + Intergenic
1123761878 15:23439863-23439885 GGAGAAGATGTGGGGGCAGGAGG - Exonic
1123761884 15:23439884-23439906 GGAGAAGATGTGGGGGCAGGAGG - Exonic
1124067120 15:26354791-26354813 GGTGAAGTTGTGGAGTCTGGTGG - Intergenic
1124484144 15:30100882-30100904 GGCTCAGCCATGGGGGCTGGGGG + Intergenic
1124519438 15:30396342-30396364 GGCTCAGCCATGGGGGCTGGGGG - Intergenic
1124539217 15:30569879-30569901 GGCTCAGCCATGGGGGCTGGGGG + Intergenic
1124557126 15:30736422-30736444 GAGGCTGCTGTGGGGGATGGGGG - Intronic
1124622307 15:31280653-31280675 GGTGCAAGTGTGGGGGCAGGGGG - Intergenic
1124674137 15:31669323-31669345 GAGGCTGCTGTGGGGGATGGGGG + Intronic
1124759433 15:32437693-32437715 GGCTCAGCCATGGGGGCTGGGGG - Intergenic
1124933527 15:34147609-34147631 TGAGCAACTGTGGGGGTTGGGGG + Intronic
1124956987 15:34366481-34366503 GGTGCTGCAGTGCGGGGTGGAGG + Intronic
1125381455 15:39091620-39091642 TGTGGAGCAGTGGGGGGTGGGGG + Intergenic
1125502418 15:40247931-40247953 TCTGCAGCTGTGAGGGCTGAGGG + Intronic
1125757031 15:42071162-42071184 GGTGCAGCTGGAGGCCCTGGAGG + Exonic
1126577495 15:50210952-50210974 GTGGCTGCTGTGGGGGATGGGGG - Intronic
1126953654 15:53910679-53910701 GTTGCAGGTGTGGGGGCAGCAGG + Intergenic
1127008222 15:54594501-54594523 GTGGCTGCTGTGGGGGATGGGGG + Intronic
1127194463 15:56568860-56568882 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1128330895 15:66754871-66754893 GGGGAGGCTGTGTGGGCTGGGGG + Intronic
1128520782 15:68373365-68373387 GGAGCAACTGTGGGGGCTTTTGG + Intronic
1128967933 15:72079191-72079213 GGGGAAACTGTGGGGGCAGGAGG + Intronic
1129252915 15:74318614-74318636 GGGGCAGCCTTGGGGGCTGGAGG - Intronic
1129391857 15:75224719-75224741 GGTCTAGCTGTGTGTGCTGGGGG + Intergenic
1130108206 15:80944867-80944889 GGTGCTGCTGCTCGGGCTGGTGG - Intronic
1130388556 15:83434550-83434572 AGTGGAGATGAGGGGGCTGGAGG + Intergenic
1131260368 15:90884566-90884588 GGAGGAGCGGTGGGAGCTGGGGG + Intronic
1131442163 15:92467377-92467399 AGGGCAGTTGTGGGTGCTGGAGG - Exonic
1131898230 15:97057717-97057739 GGTGTGGCTCTGTGGGCTGGAGG + Intergenic
1132451397 15:101970659-101970681 GATGGAGCTATGGGGGTTGGAGG - Intergenic
1202955270 15_KI270727v1_random:72127-72149 GGAGGAGCTGGGGGAGCTGGCGG - Intergenic
1132463866 16:68651-68673 GGACCAGCTGGGGGGGCTGCGGG + Intronic
1132516512 16:368545-368567 GGTGCAGCTGGGGGTCCTGCCGG + Exonic
1132583130 16:694364-694386 GGTGCAGCTGCAGGAGCTGGAGG - Exonic
1132701227 16:1222945-1222967 GGGCCAGCTGCGGAGGCTGGAGG + Intronic
1132838062 16:1964588-1964610 GGTGCAGCGGGGGGGCCCGGGGG - Exonic
1132977682 16:2718862-2718884 AGTGTGGCTGTGGGGGCTGATGG + Intronic
1133069445 16:3235664-3235686 GGTGGCGCCGTGGGGGGTGGCGG - Intronic
1133209832 16:4257448-4257470 GAGGCAGAGGTGGGGGCTGGGGG + Exonic
1133222132 16:4323312-4323334 TGGGCAGGTGTGGGGGCTGCGGG + Intronic
1133464640 16:6018544-6018566 GGCCCAGCTGTGCGGGGTGGGGG + Intergenic
1134330896 16:13250286-13250308 GGTGGAGGAGTGGGGGCAGGAGG + Intergenic
1134402645 16:13924207-13924229 GGTGAAGAAGTTGGGGCTGGGGG - Intronic
1134840770 16:17399794-17399816 CGTGCAGCTGTGGGTGGTGGTGG - Intronic
1135314714 16:21434780-21434802 GGAGCAGCCGTGAGGGCTGCTGG - Intronic
1135367637 16:21867060-21867082 GGAGCAGCCGTGAGGGCTGCTGG - Intronic
1135391846 16:22100337-22100359 ACTGCAGCTGTGGGGGGTGCGGG - Intronic
1135444177 16:22504102-22504124 GGAGCAGCCGTGAGGGCTGCTGG + Intronic
1135479953 16:22814217-22814239 GGCGCGGCTGTGCGGGCTGGCGG - Exonic
1135957756 16:26970568-26970590 GCTGGAGCTTTGGGGGCTTGTGG - Intergenic
1135990536 16:27216220-27216242 GGAGCAGCTGTCGGAGCGGGTGG + Intronic
1136220473 16:28824446-28824468 GGGGCCGCTGGCGGGGCTGGGGG - Intronic
1136324826 16:29515255-29515277 GGAGCAGCCGTGAGGGCTGCTGG - Intergenic
1136439511 16:30255240-30255262 GGAGCAGCCGTGAGGGCTGCTGG - Intergenic
1136514141 16:30757580-30757602 GGAGCAGCTCCAGGGGCTGGTGG - Exonic
1138428407 16:56951625-56951647 GTTGCAGCCGTGGGGCCTAGAGG + Intergenic
1138458190 16:57133168-57133190 GCTCCAGGTTTGGGGGCTGGAGG - Intronic
1138514547 16:57528934-57528956 GCTGCGGCTGCGGGAGCTGGAGG - Exonic
1138625747 16:58250083-58250105 TATCCAGCTGTGCGGGCTGGTGG + Exonic
1139291973 16:65867592-65867614 GGTGTGGGGGTGGGGGCTGGAGG - Intergenic
1139573232 16:67826145-67826167 CATGCAGATGTGGTGGCTGGGGG + Exonic
1139826024 16:69757847-69757869 GCTGCAGCTGTTGCTGCTGGTGG + Intergenic
1139949943 16:70663874-70663896 GGAGAAGCTGGGGGAGCTGGTGG - Exonic
1139954739 16:70687723-70687745 GGTGCAGCTGACAGCGCTGGAGG + Exonic
1140110294 16:71998351-71998373 GGTGCAGCTGAGGGGCTTTGGGG + Exonic
1140839191 16:78823265-78823287 TCTGCAGCTGGGGCGGCTGGCGG + Intronic
1141997862 16:87646700-87646722 GAAGCAGTTTTGGGGGCTGGGGG + Intronic
1142116096 16:88356967-88356989 GGTGCAGCTGTGGTGGCACATGG + Intergenic
1142185300 16:88692067-88692089 GGGGCAGGGGTGGGGGCCGGGGG - Intergenic
1142304119 16:89276016-89276038 GGTCCACCTGTGGGGAGTGGTGG - Intronic
1142356273 16:89603583-89603605 GGGGAAGCCCTGGGGGCTGGAGG + Intergenic
1142356326 16:89603706-89603728 GGGGAAGCCCTGGGGGCTGGAGG + Intergenic
1142356345 16:89603745-89603767 GGGGAAGCCCTGGGGGCTGGAGG + Intergenic
1142356476 16:89604106-89604128 GGGGAAGCCCTGGGGGCTGGAGG + Intergenic
1142356519 16:89604209-89604231 GGGGGAGCCCTGGGGGCTGGAGG + Intergenic
1142356538 16:89604250-89604272 GGGGAAGCCCTGGGGGCTGGAGG + Intergenic
1142356656 16:89604593-89604615 AGGGGAGCAGTGGGGGCTGGAGG + Intergenic
1142359947 16:89621251-89621273 GGTGCAGATGTGGGCTGTGGGGG + Intronic
1142623389 17:1178848-1178870 GGTGCGGTGGTGGGGGCGGGGGG + Intronic
1142725063 17:1807422-1807444 GTTGCCGGTGTGGGGGCCGGGGG - Intronic
1143022958 17:3926115-3926137 GGGTCAGCCCTGGGGGCTGGGGG - Intronic
1143116394 17:4584157-4584179 GCGGCAGCTGTGGGAGCTGTAGG + Intronic
1143164167 17:4889688-4889710 GGAGCAGCAGCGGCGGCTGGAGG + Exonic
1143521158 17:7445148-7445170 GATGCTGCTGGGGGCGCTGGGGG + Exonic
1144139689 17:12336563-12336585 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1144637590 17:16920159-16920181 GGGGCAGCTTTTAGGGCTGGAGG + Intergenic
1144833290 17:18143598-18143620 GGCGCTGCTGTGGGAGCAGGAGG + Exonic
1145023042 17:19446815-19446837 GGTGCAGCGGGGGGGCCCGGAGG - Intergenic
1145772607 17:27504457-27504479 GGTGCAGCTGTGGGGTTTGAGGG + Intronic
1145885825 17:28381825-28381847 GGTGCAGATGTGGGGTTGGGTGG + Intronic
1145911567 17:28546374-28546396 GGGGAAGGTGTGGGGGGTGGGGG - Intronic
1146532438 17:33620875-33620897 GGAGAGGCTGTGGGGGCTGGGGG - Intronic
1146654397 17:34626663-34626685 GGTGGCGCAGCGGGGGCTGGGGG - Intronic
1146794187 17:35769752-35769774 GCGGGAGCTGCGGGGGCTGGGGG + Intronic
1146947618 17:36884671-36884693 GGAGGAGCAGTGGGGGCTGCAGG + Intergenic
1147514404 17:41102078-41102100 AGAGCAGCTGTGGGAGCAGGAGG + Exonic
1147540168 17:41350678-41350700 GGTGCAGCCGTGGCAGCTGGGGG + Exonic
1147542183 17:41369661-41369683 GGTGTAGCCGTGGCAGCTGGGGG + Exonic
1147543719 17:41382157-41382179 GGTGTAGCCGTGGCAGCTGGGGG + Exonic
1147545397 17:41397450-41397472 GGTGCAGCTGTGGCAGCTGGGGG + Exonic
1147572928 17:41582504-41582526 GGTGCGGATTTGGCGGCTGGAGG + Exonic
1147879291 17:43643568-43643590 GGAGCAGCTGCGAGAGCTGGAGG - Exonic
1147989456 17:44324258-44324280 GGTGCTGGAGTGGGGGCTGTGGG - Intronic
1148051812 17:44773234-44773256 GGAGAAGATGAGGGGGCTGGAGG - Intronic
1148219391 17:45851152-45851174 TGTGCAGGTGTGGGGTGTGGGGG - Intergenic
1149218743 17:54389663-54389685 AGTGCAGTTGTGGTGGCTGTGGG + Intergenic
1149609453 17:57949492-57949514 GGTGGAGCTGGGGGGGTTGTGGG - Intronic
1150238312 17:63611153-63611175 GCAGCAGCTGTGGGTGCAGGAGG - Intergenic
1150292712 17:63990800-63990822 GGAGCTGCTGTGGGGACGGGGGG - Intergenic
1150676050 17:67246107-67246129 GCTGCAGCTCGGGAGGCTGGAGG + Intergenic
1150760851 17:67959652-67959674 GGTGAAGGTGGAGGGGCTGGAGG - Exonic
1151013704 17:70530979-70531001 GGTGGAGGTGTGGAGGGTGGGGG + Intergenic
1151173804 17:72270368-72270390 GGTGGAGCTGTTGGGGAGGGTGG + Intergenic
1151314125 17:73311542-73311564 GGTGCCGCTGAGGGGGTTGGGGG - Intronic
1151325804 17:73379277-73379299 GGTGCTGCTGTGGGCACTGGAGG + Exonic
1151379063 17:73712286-73712308 CGTGCACATGTGGGGGCCGGAGG + Intergenic
1151455815 17:74225259-74225281 GGAGCAGATGAGGGGGTTGGGGG + Intronic
1151508202 17:74542950-74542972 CATGGAGCTCTGGGGGCTGGAGG + Exonic
1151565130 17:74893448-74893470 GGCGCTGCTGCGGGAGCTGGAGG - Exonic
1151637880 17:75364703-75364725 TCTGCAGCTGTAGGGGATGGAGG + Intronic
1151883599 17:76910249-76910271 TGTGCAGCAGTGGGTGCAGGCGG - Intronic
1152222190 17:79074995-79075017 GCGGCAGCTGCAGGGGCTGGCGG + Exonic
1152270767 17:79323587-79323609 GGTCCAGCTGGGTGGGCAGGTGG - Intronic
1152330508 17:79669959-79669981 GGAGAAGCTGTGGGGACTGCAGG + Intergenic
1152471482 17:80492235-80492257 GGTGCAGGTGGCGGGGCAGGTGG + Intergenic
1152471557 17:80492477-80492499 GGTGCAGGTGGCGGGGCAGGTGG + Intergenic
1152471568 17:80492513-80492535 GGTGCAGGTGGTGGGGCAGGTGG + Intergenic
1152484132 17:80578687-80578709 GGTGCTGCTGCTAGGGCTGGGGG + Intronic
1152571466 17:81123042-81123064 GGTGCAGAGGTGGCGGGTGGAGG + Intronic
1152623444 17:81377649-81377671 GGGGGAGTTGGGGGGGCTGGGGG + Intergenic
1152624568 17:81382323-81382345 GGTGAGGATGTGGGCGCTGGTGG - Intergenic
1152628723 17:81400069-81400091 GACGCAGCTTGGGGGGCTGGCGG - Intronic
1152783990 17:82238637-82238659 GGTGGAGCCGTGGGCCCTGGGGG + Intronic
1152814683 17:82400267-82400289 GGGGCATCTGTGAGGCCTGGAGG - Intronic
1152859765 17:82689367-82689389 GGGTCAGCTCTGGGGGCTGGAGG - Intronic
1152924772 17:83081723-83081745 AGGGCAGCTGTGGGGGCTGCTGG + Intronic
1153342411 18:3989028-3989050 AGTGCAGCAGTGGAGGCAGGAGG - Intronic
1154208073 18:12354775-12354797 AGAGGAGCTGTGGGGGGTGGTGG - Intronic
1154448050 18:14450593-14450615 GGAGGAGCTGGGGGAGCTGGCGG - Intergenic
1154492579 18:14933181-14933203 GGTGCATCTGTGGGGAGTGGGGG + Intergenic
1155060424 18:22223504-22223526 GGTGGGGCTGTGCGTGCTGGGGG + Intergenic
1155155745 18:23156092-23156114 GGGCCAGCAGCGGGGGCTGGAGG + Intronic
1155987442 18:32245234-32245256 CGCGCAGTTCTGGGGGCTGGGGG + Intronic
1156155925 18:34301505-34301527 TGTGCACATGTGGGGCCTGGGGG + Intergenic
1156911885 18:42420835-42420857 AGTGGGGGTGTGGGGGCTGGGGG - Intergenic
1157196802 18:45626360-45626382 GGTGCAGGTGTCGGGGCTAGTGG - Intronic
1157610479 18:48952099-48952121 GGCGCGGCTGCGGCGGCTGGGGG - Intergenic
1157701004 18:49761618-49761640 GGTGCGTGTGTGGGGGGTGGGGG - Intergenic
1157872602 18:51244384-51244406 GGTGGAATTGTGGGGTCTGGCGG + Intergenic
1158560122 18:58506464-58506486 GAGGCAGATGTGGGGGGTGGGGG - Intronic
1159497372 18:69223550-69223572 GCTGCAGATATGGGGGCAGGTGG - Intergenic
1159906549 18:74097577-74097599 GTGGCTGCTGTGGGGGATGGAGG - Intronic
1160113201 18:76053402-76053424 CGTGCAGATGCGGGGGCAGGGGG + Intergenic
1160394918 18:78564073-78564095 TGTGCAGATGTGGGGTGTGGGGG - Intergenic
1160463521 18:79057117-79057139 TGCACAACTGTGGGGGCTGGGGG + Intergenic
1160469250 18:79113662-79113684 GATGCAGCTGTTGGGAATGGGGG + Intronic
1160633867 19:61888-61910 GATGGAGCTATGGGGGTTGGAGG + Intergenic
1160682445 19:418010-418032 GGTGCAGCTGTGGGGCTGGAGGG - Intronic
1160717341 19:582335-582357 GTTCCAGCTGTGGGGGTCGGGGG + Intronic
1160867219 19:1261277-1261299 GGTGCAGGGGTGGGGGCAGCAGG - Intronic
1160871270 19:1278958-1278980 GGTCCAGCGGTGGGTGCAGGTGG - Exonic
1160892888 19:1388461-1388483 AGTGCGGCTGGGGGAGCTGGAGG + Intronic
1160912641 19:1481948-1481970 GGGGCGGCTGTCGGGGGTGGTGG + Exonic
1160928021 19:1556238-1556260 GGAGCCGCTGTAGGGGCTGGCGG + Exonic
1160967891 19:1754514-1754536 GGCGCCGCTGGGCGGGCTGGCGG + Exonic
1160982222 19:1821667-1821689 TTGGCACCTGTGGGGGCTGGCGG + Exonic
1160990591 19:1858854-1858876 GGGTGAGCTGTGGGGGCGGGGGG - Intronic
1161153032 19:2719575-2719597 GGGGCAGCGGTGGGGGGTGGGGG + Intronic
1161207937 19:3051477-3051499 GGTGAGGCGGTGGGGGTTGGGGG + Intergenic
1161221561 19:3120382-3120404 GGGGCTGCTCTGGGGACTGGTGG - Intronic
1161389079 19:4011865-4011887 TGTGGAGCTGTGGGGTGTGGAGG + Intronic
1161397592 19:4052679-4052701 GCTGTAGCGGTGGGGGCAGGGGG - Intronic
1161484013 19:4525109-4525131 GGGGGAGCTGGGGGAGCTGGGGG + Intronic
1161575403 19:5051937-5051959 GGTGCAGGTGTGGGAGGTGGGGG + Intronic
1161591472 19:5131140-5131162 GCGGCAGCTGTGGGGGCAGCAGG - Exonic
1161615371 19:5267199-5267221 GGTGGTGATGTGGGGGCGGGGGG + Intronic
1161704915 19:5815110-5815132 TTTGCAGCTGTGGGCGTTGGTGG + Intergenic
1161814993 19:6494520-6494542 GCTGACGCTGTGGGGGGTGGGGG + Exonic
1161826734 19:6572502-6572524 GTTGCTGCTGGGGGGGGTGGGGG + Intergenic
1161860284 19:6792739-6792761 GGGGCAGCAGTGGGGGCGAGGGG + Intronic
1162054832 19:8056273-8056295 AGTGGGGCCGTGGGGGCTGGGGG + Intronic
1162129014 19:8513993-8514015 GGCGGAGCTGCGGGGACTGGCGG - Intronic
1162164486 19:8743145-8743167 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162164551 19:8743411-8743433 GGGGCAGCTGTGCAGGGTGGTGG + Intergenic
1162165558 19:8750613-8750635 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162165623 19:8750879-8750901 GGGGCAGCTGTGCAGGGTGGTGG + Intergenic
1162166623 19:8758069-8758091 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162166688 19:8758335-8758357 GGGGCAGCTGTGCAGGGTGGTGG + Intergenic
1162167689 19:8765525-8765547 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162167754 19:8765791-8765813 GGGGCAGCTGTGCAGGGTGGTGG + Intergenic
1162168628 19:8771823-8771845 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162168693 19:8772089-8772111 GGGGCAGCTGTGCAGGGTGGTGG + Intergenic
1162170374 19:8784587-8784609 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162181435 19:8871667-8871689 GGTGCAGCTTTGGGGGATGAAGG + Intronic
1162315514 19:9936191-9936213 CCTGCAGCTGGGGGGGCTTGTGG + Intronic
1162772360 19:12956954-12956976 GGAGCAGCTGCGGGAGCTGGAGG - Exonic
1162911728 19:13851358-13851380 GGAGCAGCTGGGGGGGCTAACGG - Intergenic
1162938436 19:13993731-13993753 GGTGCCGCTGGGGGTGGTGGCGG + Exonic
1162998205 19:14349868-14349890 GGTGCAGCTGGTGGTGTTGGAGG - Intergenic
1163035618 19:14567305-14567327 GGTGCAGGTGGAGGGGCTGAGGG - Intronic
1163175839 19:15563666-15563688 GCTGGAACTGTCGGGGCTGGAGG + Intergenic
1163321537 19:16577535-16577557 GGCGGCGCTGCGGGGGCTGGCGG - Exonic
1163403411 19:17108089-17108111 TGTGCAGGCGTGGAGGCTGGAGG - Intronic
1163450949 19:17377223-17377245 GGGGCAGCTCTCGGGGCTGCTGG - Exonic
1163520384 19:17788254-17788276 GGTGCAGCTGTGAGGGGGAGGGG - Exonic
1163773660 19:19205567-19205589 GCAGCAGGGGTGGGGGCTGGCGG + Intergenic
1163943685 19:20517088-20517110 GGTGGAGGTGTGGGTGCTGTGGG + Intergenic
1164794621 19:31015720-31015742 GGTGGAGCTGTGTGGGCAGAAGG + Intergenic
1165154539 19:33779131-33779153 GGTGAAGCCATGGGGGCTGAGGG - Intergenic
1165349587 19:35268766-35268788 CGGGCAGCTGGGTGGGCTGGGGG + Intergenic
1165432542 19:35780904-35780926 GGCACAGCTGTGGGGGCAAGGGG - Exonic
1166105240 19:40594918-40594940 GGAGCAGGAGTGGGGGGTGGGGG + Intronic
1166374588 19:42320445-42320467 TGGGCATCTGTGGGGGGTGGAGG + Intronic
1166384958 19:42375822-42375844 GGTGGAGGTGGTGGGGCTGGGGG - Exonic
1166524335 19:43501781-43501803 GGAGCAGCTGCGGGAGCTGCTGG - Exonic
1166670254 19:44705574-44705596 GGGCCAACTGTGGGGGCAGGAGG - Exonic
1166679887 19:44759605-44759627 GAGGCAGCTGAGGGGGATGGGGG + Exonic
1166876677 19:45901920-45901942 GGGGCAGGAGTGGGGGCGGGGGG + Intronic
1166898069 19:46036438-46036460 GCTGCAGCTGCAGGGGCAGGAGG - Intergenic
1166944891 19:46390560-46390582 GGTGGAGCAGCTGGGGCTGGGGG + Exonic
1167000188 19:46741257-46741279 GGTCTATCTGTGGGGGCAGGAGG + Intronic
1167527606 19:49994702-49994724 TGTGCAGCGGAGGGGGGTGGGGG + Intronic
1167609591 19:50500805-50500827 GGAGGAGCTGGGGGCGCTGGGGG - Intergenic
1167618267 19:50548065-50548087 GGTGTTGCTGTGAGGGCTGATGG - Intronic
1167906884 19:52668544-52668566 GGGGCAGCTGTAGGAGGTGGAGG - Intronic
1168311770 19:55464366-55464388 TCTGCAGGTGAGGGGGCTGGTGG - Intergenic
1168649743 19:58085567-58085589 GCTGCAGATGTGGGACCTGGAGG + Intronic
924998049 2:382086-382108 GCTGCAGCTGTGAGGGCCGGCGG - Intergenic
925147664 2:1591849-1591871 GGGGCAGGTGGAGGGGCTGGAGG + Intergenic
925160061 2:1677504-1677526 GGGGCAGCTGTGGAGGAGGGAGG - Intronic
925203521 2:1988110-1988132 GGTGCAGCTGGGCTGGCGGGAGG - Intronic
925203535 2:1988163-1988185 GGTGCAGCTGGGCTGGCGGGAGG - Intronic
925203549 2:1988216-1988238 GGTGCAGCTGGGCTGGCAGGAGG - Intronic
925208266 2:2025792-2025814 TGTGCAGGTTTGGGAGCTGGGGG - Intronic
925329150 2:3044818-3044840 GAGCCAGCTGTGGGGGCAGGTGG + Intergenic
925370501 2:3341536-3341558 GGTGCAGCTGTGTGTGGAGGGGG + Intronic
925394008 2:3519382-3519404 GGAGCAGCTGCGGCGGCTCGGGG - Exonic
925713883 2:6767606-6767628 GGAGCAACTGTGGGGCCAGGGGG + Intergenic
925742803 2:7020330-7020352 GGTGCTTCGGTTGGGGCTGGTGG + Intronic
925929296 2:8694175-8694197 GGGGCAGGGGAGGGGGCTGGGGG + Intergenic
925999515 2:9319104-9319126 GGGGCAGCAGACGGGGCTGGAGG + Intronic
926060293 2:9800882-9800904 GGTGCAGCTGGTGGGGGTGGAGG + Intergenic
926195821 2:10763018-10763040 GGCGCTGCTGTTGGGGTTGGAGG + Intronic
926916010 2:17893101-17893123 GTGGCTGCTGTGGGGGATGGAGG + Intronic
927036719 2:19185141-19185163 GCCGCTGCTGTGGGGGATGGGGG + Intergenic
927044515 2:19263351-19263373 GCTGCAACTGTGGGTGATGGGGG - Intergenic
927205901 2:20610121-20610143 TGTGCATGTGTGGGGGCAGGAGG - Intronic
927476068 2:23415035-23415057 AGGGCAGCTGTGGGGCCTTGTGG - Intronic
927668633 2:25050268-25050290 GGGGCAGCTGTGCAGGGTGGTGG + Intronic
928356642 2:30622222-30622244 GTGGCTGCTGTGGGGGATGGGGG - Intronic
929722922 2:44389181-44389203 GTAGCTGCTGTGGGGGATGGGGG + Intronic
929806004 2:45145506-45145528 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
931547866 2:63408865-63408887 GTGGCTGCTGTGGGGGATGGGGG - Intronic
931739346 2:65228025-65228047 GGTGCAGCCCTGGGGGCCGAGGG - Intronic
931834630 2:66085711-66085733 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
932100663 2:68896615-68896637 GCAGCTGCTGTGGGGGTTGGGGG + Intergenic
933587463 2:84194982-84195004 GAGGCAGATGTGGGAGCTGGAGG - Intergenic
934746186 2:96761080-96761102 GGTGCTGCTGTGGGCGCTGGGGG + Exonic
934754750 2:96817096-96817118 GGGGCAGCTGCTGGAGCTGGCGG + Exonic
934854913 2:97723739-97723761 GGTACAGGTGTGGGTGCTTGGGG + Intronic
935218360 2:100991821-100991843 AGTGCAGATGGTGGGGCTGGAGG + Intronic
935274355 2:101463433-101463455 GGTGCAGCTGTGGGTTCAGCCGG + Intronic
935968071 2:108501451-108501473 GGTGCAGTTGGGTGGGATGGTGG + Intronic
936039991 2:109142457-109142479 GGTGCCTGTGTGGGTGCTGGGGG - Intronic
936066328 2:109335216-109335238 GGAGCAGCTGTGGGGACTGTGGG + Intronic
936567610 2:113593127-113593149 GATGGAGCTATGGGGGTTGGAGG - Intergenic
937069260 2:119050320-119050342 GGAGTTGCTGTGGGGGATGGGGG + Intergenic
937085318 2:119167858-119167880 GGTAGAGTGGTGGGGGCTGGAGG - Intergenic
937220300 2:120339297-120339319 GGTGCAGCTGGAGGGGGTGTGGG + Intergenic
937473854 2:122196760-122196782 GGTGCCGTGATGGGGGCTGGAGG - Intergenic
937767626 2:125680166-125680188 GCGGCTGCTGTGGGGGATGGGGG + Intergenic
937831490 2:126429337-126429359 AGTGAGGCTGTGGGGGCTGGGGG - Intergenic
937835832 2:126469547-126469569 GCTGGATCTGAGGGGGCTGGAGG - Intergenic
938081577 2:128373111-128373133 GGTAAGGCTGTGGGGACTGGGGG + Intergenic
938564249 2:132503771-132503793 GTGGCTGCTGTGGGGGATGGGGG + Intronic
938578840 2:132628107-132628129 GGTGCATGTTTGGGGGCTGGGGG - Intronic
939952198 2:148488646-148488668 GGTGCGGGGGTGGGGGGTGGGGG + Intronic
940034718 2:149301736-149301758 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
940370355 2:152894528-152894550 GATGCAGCAGTGGGAGCTGGTGG + Intergenic
940431338 2:153593396-153593418 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
940709391 2:157143993-157144015 GCAGCTGCTGTGGGGGATGGAGG + Intergenic
941402204 2:165044875-165044897 GTGGCAGCTGTGGGGGATGGGGG + Intergenic
941627430 2:167845060-167845082 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
941638007 2:167956731-167956753 GGTGGATCTGAGGGGGCGGGGGG - Intronic
941738355 2:169005370-169005392 GCAGCTGCTGTGGGGGATGGGGG + Intronic
942231849 2:173867558-173867580 GATGCAGCAGTGGGAGCTAGAGG - Intergenic
942413813 2:175737678-175737700 GGTGTGGATGTGGGGGGTGGGGG - Intergenic
943891249 2:193289897-193289919 GGGGCTGCTGTGGGGGATGGTGG + Intergenic
944485379 2:200199879-200199901 GCAGCTGCTGTAGGGGCTGGGGG - Intergenic
944513086 2:200483835-200483857 GGTGCAGCTGTGGCCACTGGAGG + Intergenic
945204279 2:207315144-207315166 GAAGAAGCAGTGGGGGCTGGTGG + Intergenic
945482582 2:210360843-210360865 GTGGCTGCTGTGGGGGATGGAGG + Intergenic
946164035 2:217853062-217853084 TGTGCCGGAGTGGGGGCTGGGGG - Intronic
946208140 2:218125725-218125747 AGAGCAGCTGTGGTGGCTGAAGG + Intronic
946833619 2:223749686-223749708 GGTGCAGAGGTGGGGGCTGTGGG + Intergenic
947457082 2:230265140-230265162 GCAGCTGCTGTGGGGGATGGGGG + Intronic
947492728 2:230609968-230609990 TGTTGAGGTGTGGGGGCTGGGGG + Intergenic
947534353 2:230931644-230931666 GGTGCAGCGGTCGGGGCCTGTGG - Intronic
947733148 2:232441982-232442004 GGTCCAGCTCGGGGAGCTGGTGG - Intergenic
947792438 2:232876053-232876075 GGCGCGACGGTGGGGGCTGGGGG - Exonic
947834818 2:233167588-233167610 GGTGCAGTGGAGAGGGCTGGAGG + Intronic
948083341 2:235225837-235225859 GGTGGTGCTGTGTGAGCTGGTGG + Intergenic
948139287 2:235660938-235660960 AGTGCAACTGTGGAGACTGGAGG + Intronic
948304360 2:236935657-236935679 AGTGCAGCTTTGGGGACTTGAGG + Intergenic
948487243 2:238288721-238288743 CGTGCAGCTGTGGGCGGCGGCGG - Intronic
948596331 2:239082033-239082055 GGAGCCGCTGTGGGGGCACGGGG - Intronic
948713976 2:239847101-239847123 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
948805842 2:240453243-240453265 GGTGCAGCTGGGGCGACGGGTGG - Intronic
948813522 2:240498276-240498298 GGGGCAGGTGTTGGGGGTGGGGG + Intronic
948976853 2:241468706-241468728 AGTGCACTTGTGGGGGCTGTGGG - Intronic
1168827213 20:821994-822016 GGTGCTGCAGTAGGGGATGGGGG - Intergenic
1168961682 20:1874445-1874467 TTTGCTGCTGTGGGGGCTGCAGG - Intergenic
1169336201 20:4759496-4759518 GTGGCTGCTGTGGGGGATGGAGG + Intergenic
1169465631 20:5835630-5835652 CTTTCAGCAGTGGGGGCTGGTGG + Intronic
1169517468 20:6333197-6333219 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1169674392 20:8137114-8137136 GTTTTAGCTGTGGGGGTTGGAGG - Intronic
1172020174 20:31908500-31908522 GGTGCTGCCGAGGGGGCTTGAGG - Intronic
1172095899 20:32460401-32460423 GGGGCAGCTGTGTGGGGTGGGGG - Intronic
1172518701 20:35553665-35553687 GGGGCCAGTGTGGGGGCTGGAGG + Intronic
1172870427 20:38132249-38132271 GATGCAGGTGTGTGGGGTGGGGG + Intronic
1173001546 20:39109422-39109444 TGTACAGGTGAGGGGGCTGGAGG + Intergenic
1173546172 20:43899805-43899827 GTGGCAGCTCTGGGGCCTGGAGG - Intergenic
1173578970 20:44132836-44132858 GCTGCAGGTGTGGGGGGCGGTGG - Intronic
1173579032 20:44133026-44133048 GTTGCAGCTGTGGAGGGGGGTGG - Intronic
1173645648 20:44631632-44631654 GGTGGAGTTCTGGGGGCTGGAGG - Intronic
1173709109 20:45138978-45139000 GCTGTGGCTCTGGGGGCTGGAGG + Intergenic
1173846078 20:46189485-46189507 GGTGGGGGTGTGTGGGCTGGAGG + Intronic
1175176446 20:57115190-57115212 GGGGGAGCAGTGGGGGCAGGAGG + Intergenic
1175736110 20:61388387-61388409 AGTGCAGCTGTAGGGGCTGTAGG - Intronic
1175865299 20:62172829-62172851 GGGGCAGGGGTGGGCGCTGGGGG - Intronic
1175865331 20:62172946-62172968 GGGGCAGGGGTGGGCGCTGGGGG - Intronic
1175906369 20:62381525-62381547 GGGGCAGGAGTGGGGGCTGGTGG + Intergenic
1175934764 20:62509622-62509644 GGTGGAGGTGTGGAGGATGGAGG - Intergenic
1175934784 20:62509676-62509698 GGTGGAGGTGTGGAGGATGGAGG - Intergenic
1175934849 20:62509859-62509881 GGTGGAGCAGTGGAGGATGGAGG - Intergenic
1175990341 20:62785483-62785505 GCTCCAGCTGTGGGCACTGGGGG - Intergenic
1176025145 20:62981930-62981952 GGTGCAGGTGTGGGGCCTCAGGG + Intergenic
1176073792 20:63239428-63239450 GGCGCAGCTGCGGCGGCTGCAGG + Exonic
1176087753 20:63305777-63305799 GGCGCATCTGTGGGTGCTGAGGG - Intronic
1176147172 20:63570762-63570784 TGTGGAGCTGCGGGGGCAGGCGG - Exonic
1176302842 21:5106991-5107013 GGTGCTGCGGTGGGGGCGAGGGG - Intergenic
1176304117 21:5114445-5114467 GGAGCAGCTGGGAGTGCTGGGGG + Intergenic
1177847410 21:26306448-26306470 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1178372479 21:32037825-32037847 TGTGCACCTGTGTGGGCTTGGGG - Intronic
1178401702 21:32291828-32291850 TATGCAGGTGTGTGGGCTGGAGG + Exonic
1178407156 21:32334312-32334334 GGTGCTGCTGTGGGGCCCAGCGG - Exonic
1178418047 21:32419799-32419821 GGAGCGGGGGTGGGGGCTGGGGG + Intronic
1178552734 21:33555086-33555108 GGTGCGGCTGCGGCGGCTTGGGG - Exonic
1178552740 21:33555107-33555129 GGTGCGGCTGCGGCGGCTGGGGG - Exonic
1178552747 21:33555128-33555150 GGTGCGGCTGCGGCGGCTGGGGG - Exonic
1178552754 21:33555149-33555171 GGTGCGGCTGCGGCGGCTGGGGG - Exonic
1178552762 21:33555170-33555192 GGTGCGGCTCCGGCGGCTGGGGG - Exonic
1178615198 21:34126943-34126965 TGTGCAGTGGTGGGGGTTGGGGG + Intronic
1178664140 21:34532000-34532022 GGTCTTGCAGTGGGGGCTGGGGG + Intronic
1178818671 21:35955073-35955095 GATGCAGATGTCGGGGCTGCTGG - Intronic
1179084203 21:38203155-38203177 GTGGCTGCTGTGGGGGATGGGGG + Intronic
1179467843 21:41589605-41589627 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1179494091 21:41760747-41760769 GGAGCAGCTGGGGGGTGTGGGGG + Intronic
1179635157 21:42704043-42704065 CGTGCTGCCGTGAGGGCTGGCGG - Intronic
1179852939 21:44147585-44147607 GGAGCAGCTGGGAGTGCTGGGGG - Intergenic
1179854182 21:44154932-44154954 GGTGCTGCGGTGGGGGCGAGGGG + Intergenic
1180041637 21:45283243-45283265 GGTGCTGCAGGGGGGGCGGGGGG + Intronic
1180048687 21:45321396-45321418 AGTGCAGATGTGGGTTCTGGAGG - Intergenic
1180062157 21:45390988-45391010 GATGCAGGTGAAGGGGCTGGGGG - Intergenic
1180072391 21:45442911-45442933 GGTGCTGGTGTGGGCGGTGGTGG + Intronic
1180072414 21:45443004-45443026 GGTGCTGATGTGGGTGGTGGTGG + Intronic
1180072424 21:45443043-45443065 GGTGCTGGTGTGGGCGGTGGTGG + Intronic
1180072430 21:45443064-45443086 GGTGCTGGTGTGGGTGGTGGTGG + Intronic
1180082123 21:45491727-45491749 GGTGCAGCTGAGAGGCCTGATGG - Intronic
1180082443 21:45493097-45493119 GGAGCAGCCGTCGGGGATGGGGG + Intronic
1180108637 21:45637238-45637260 GGTGCAGCAGTGGAGCCTGCTGG + Intergenic
1180175022 21:46083142-46083164 CGTGCAGATGTGGTGGCAGGCGG - Intergenic
1180181390 21:46120117-46120139 GGTGCCTCAGTGGGGGCCGGGGG - Intronic
1180199932 21:46218096-46218118 GGTGCGGGGGTGGGGGGTGGGGG - Intronic
1180559685 22:16605597-16605619 GGTGTGGGTGTGGGGGATGGGGG + Intergenic
1180713098 22:17853296-17853318 GCTGCAGCAGAGTGGGCTGGGGG - Intronic
1180780575 22:18517333-18517355 GGTGGAGGTCTGGGGGGTGGGGG - Intronic
1180957353 22:19746933-19746955 TGGGCAGCTGTGGGGGCCGGTGG + Intergenic
1181022902 22:20112842-20112864 GGGGCTCCTGTGGGAGCTGGGGG + Intronic
1181086426 22:20441674-20441696 GGTGGGGCTGTGGGGGCAGCTGG - Exonic
1181164162 22:20974518-20974540 GCTGCAGCTGTAGGGCCTGTGGG - Exonic
1181311518 22:21947268-21947290 GGCCCAGGTGTGGGGCCTGGAGG - Intronic
1181356121 22:22297409-22297431 TGTGCGGCTGTGGGCGGTGGGGG - Intergenic
1181518810 22:23433720-23433742 AGTGCAGCCGTGGGGGCGGGCGG + Intergenic
1181645103 22:24226657-24226679 GGGGCAGAGGTGGAGGCTGGGGG - Exonic
1182050916 22:27311896-27311918 GGTGGGGCTGTGGGGCCTGCAGG - Intergenic
1182060197 22:27391740-27391762 TGTGCTGCTCTGGGGGCGGGGGG + Intergenic
1182269368 22:29143962-29143984 GCTGCAGCTGTAGTGGCTGCTGG + Intronic
1182285700 22:29245560-29245582 CATGAAGCTTTGGGGGCTGGGGG + Intronic
1182351348 22:29701788-29701810 GGTGCAGGTGGAGGGGATGGAGG - Intergenic
1182518341 22:30871486-30871508 GGTGCAGTTGTAGGAGCTTGGGG + Intronic
1182675658 22:32037104-32037126 TTTGCCTCTGTGGGGGCTGGTGG - Intergenic
1182769636 22:32785164-32785186 GGTGCAGCTCTGGGGTCAGTCGG + Intronic
1183184506 22:36284387-36284409 GGACCAGGTGTGGGCGCTGGTGG - Exonic
1183309385 22:37101214-37101236 GATGCAGCTGGGAGGGCAGGTGG + Intronic
1183329669 22:37212502-37212524 AGAGCAGGTGTGGGGGGTGGGGG + Intergenic
1183409085 22:37644583-37644605 GGTGAGGCTGTGGGGTCTAGAGG - Intronic
1183674205 22:39290753-39290775 GGCTCAGCTGGGTGGGCTGGTGG - Intergenic
1184369858 22:44075437-44075459 GGTGCATCTGTGGTACCTGGTGG + Intronic
1184479593 22:44738695-44738717 GGTGTAGGGGTGGGGGCAGGGGG + Intronic
1184561011 22:45262946-45262968 GGTGCAGCTATGTGGGATGTGGG + Intergenic
1184692524 22:46123734-46123756 GGTCCAGCTGGGAGAGCTGGTGG - Intergenic
1184730562 22:46368996-46369018 GTTGCACCTGCAGGGGCTGGGGG - Intronic
1185003654 22:48262658-48262680 GGTGGAGCTGTGGGGCCCTGAGG - Intergenic
1185022333 22:48384613-48384635 TGTGCATGTGTGGGGGCAGGGGG + Intergenic
1185181421 22:49365638-49365660 GGTGCAGCCTGGAGGGCTGGTGG + Intergenic
1185251243 22:49802712-49802734 CGGGAAGCTCTGGGGGCTGGAGG - Intronic
1185283003 22:49983653-49983675 GGAGCAGCTGCGGGGGCGGGAGG - Intergenic
1185322991 22:50210411-50210433 GGGGGAGCCGAGGGGGCTGGGGG + Intronic
1185372597 22:50467980-50468002 GGTGCAGATGCTGGGGCGGGTGG - Intronic
1185400049 22:50610942-50610964 GGCGCAGCTGTTGGGGCTGCGGG + Exonic
949120069 3:374065-374087 AGTGGGGCGGTGGGGGCTGGGGG - Intronic
949709942 3:6861454-6861476 GGTGCTCCTGTGCGCGCTGGCGG + Exonic
949945096 3:9183857-9183879 GGTACAGCTGTGGGGGCTGAGGG - Intronic
950015028 3:9749427-9749449 GCAGCAGCTGTGGCGGCCGGCGG + Intergenic
950046606 3:9952027-9952049 GGAGAGGCTGTGGGGGGTGGCGG + Intronic
950308985 3:11939522-11939544 GGTGAATATGTGGGGGTTGGTGG + Intergenic
950443119 3:13021357-13021379 TGGACAGCTGTGGGGGGTGGTGG - Intronic
950541159 3:13614134-13614156 GGTGCAGCTGCGGGCTCTGGAGG - Exonic
950626232 3:14249161-14249183 CATGCAGCTGCTGGGGCTGGTGG - Intergenic
950645402 3:14373951-14373973 TGTGGAGGTGTGGGGGCAGGTGG - Intergenic
950668363 3:14510864-14510886 GGTGCAGCTGGTGCAGCTGGTGG - Intronic
950881096 3:16323186-16323208 GGGACAGCTGAGGGGACTGGAGG - Intronic
951269611 3:20608333-20608355 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
951302678 3:21017609-21017631 GCGGCTGCTGTGGGGGATGGGGG + Intergenic
951464801 3:22990318-22990340 GGTGCCCCTGTGGGGACTGCAGG + Intergenic
951941286 3:28081639-28081661 TGTGCAGCTGTCTGGGCTGAGGG - Intergenic
952149102 3:30567183-30567205 GCTGCTGCTGTGGGGGATAGGGG - Intergenic
952858780 3:37795006-37795028 AGTGCAGGTGTGGGGGAGGGAGG - Intronic
953069581 3:39505957-39505979 GATGAACGTGTGGGGGCTGGTGG - Intronic
953298583 3:41748955-41748977 GGTGGGGCTTTGGGGGCAGGGGG - Intronic
953407713 3:42667682-42667704 AGGGCAGCGGTGGGGGATGGGGG + Intergenic
954147135 3:48640065-48640087 GGGGCAGAGGTGGGGGCTGTGGG + Exonic
954301906 3:49704756-49704778 GGTGCCGCAGTGGGGGCAGGCGG + Exonic
954314320 3:49792926-49792948 GGTGCTGAGGTGGGGGGTGGAGG + Exonic
954406486 3:50348137-50348159 GCTGCAGCTGCTGGGGGTGGCGG + Exonic
954903144 3:54037160-54037182 GCTGCAGCTGTGTGTCCTGGAGG + Intergenic
955072866 3:55586120-55586142 GGTGCACCTGAGGTGACTGGCGG + Intronic
955461626 3:59189671-59189693 GGTGTTGCTGTGGCGGCTGTGGG + Intergenic
955461630 3:59189680-59189702 GTGGCGGCTGTGGGGGATGGAGG + Intergenic
956097783 3:65735639-65735661 GGTGCTGCTGTGGGGCCTGGGGG - Intronic
956122377 3:65979097-65979119 TGAGTAGCTGTGGGGGGTGGCGG - Intronic
957215727 3:77317660-77317682 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215755 3:77317729-77317751 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215784 3:77317798-77317820 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215809 3:77317854-77317876 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957427900 3:80063931-80063953 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
958013799 3:87914661-87914683 GGGGCTGCTGTGGAGGATGGGGG - Intergenic
958957215 3:100477515-100477537 GGGGCAGCTGTCCGGGCAGGGGG + Intergenic
959300383 3:104591935-104591957 TATGCAAGTGTGGGGGCTGGGGG + Intergenic
959706110 3:109340168-109340190 GGTGTGGCTGTGGGGGAGGGAGG + Intergenic
959863775 3:111243270-111243292 GCTGCAGCTGTGGGTGGTGGGGG + Intronic
959997266 3:112693442-112693464 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
960064353 3:113354604-113354626 GTGGCTGCTGTGGGGGATGGAGG - Intronic
961264969 3:125634430-125634452 GGTGGGGAGGTGGGGGCTGGTGG + Intergenic
961404972 3:126672356-126672378 GGTGCACCCCTGGGGCCTGGGGG + Intergenic
961428591 3:126864471-126864493 GGTGCAGCTGGTGGTGATGGAGG - Intronic
961656549 3:128445600-128445622 GGTGCTGCTGGTGGTGCTGGAGG + Intergenic
961683104 3:128611966-128611988 GGTAGAGCTGCGGGTGCTGGTGG + Intergenic
962268808 3:133963095-133963117 GGTGGGGCTGGGGGAGCTGGAGG - Intronic
962273782 3:133997174-133997196 GGGGCTGCTTTTGGGGCTGGAGG - Intronic
962401854 3:135067367-135067389 GTGGCTGCTGTGGGGGATGGGGG + Intronic
962424946 3:135261557-135261579 AGGGCATCTGTGGGGGTTGGGGG - Intergenic
963189148 3:142450084-142450106 GGTGGTGCTGGGTGGGCTGGTGG + Intronic
963598344 3:147356404-147356426 GGCCCAGATCTGGGGGCTGGGGG - Intergenic
964188993 3:153980394-153980416 GCTGCTGCTATGGGGGATGGGGG - Intergenic
964226458 3:154408650-154408672 GTAGCTGCTGTGGGGGATGGGGG - Intronic
964726636 3:159820299-159820321 GGTAGGGTTGTGGGGGCTGGAGG - Intronic
964771355 3:160226400-160226422 GGTGCAGGGCTGGGGGCTGCGGG + Exonic
964954601 3:162336880-162336902 GTTGCCGCTGTTGGCGCTGGTGG + Intergenic
965530896 3:169769213-169769235 GGTGGGGCTGGGGTGGCTGGGGG - Intronic
965771796 3:172189333-172189355 GGTGTTGCAGAGGGGGCTGGAGG - Intronic
966229924 3:177640747-177640769 GTTGCTGCTGTGGAGGATGGGGG + Intergenic
966403745 3:179573148-179573170 GGGACAGGTCTGGGGGCTGGAGG + Intronic
966882239 3:184357158-184357180 TGAGGAGCTGAGGGGGCTGGGGG - Intronic
966890193 3:184401690-184401712 GGTACAGCGGTGAGGGCTGTAGG + Intronic
967444951 3:189555310-189555332 GCTGCATCTGTGGGGGATGGGGG + Intergenic
968486727 4:866528-866550 GGGTCAGCTGTGGGGACAGGCGG + Exonic
968489358 4:881794-881816 GGTGCCGCTGCAGGCGCTGGTGG - Intronic
968501027 4:950161-950183 GGAGAAGGGGTGGGGGCTGGAGG + Intronic
968612810 4:1564732-1564754 GATGCAGCTGGCTGGGCTGGGGG + Intergenic
968905787 4:3449949-3449971 GCTGCCTCTGTGGGGGCTGAGGG + Intergenic
968956708 4:3723176-3723198 AGTGGTGCTGTGGGGGCCGGGGG + Intergenic
969222473 4:5770241-5770263 AGGGCAGCTGTGGGGGCGGAGGG - Intronic
969340077 4:6535054-6535076 GGGGCGGCAATGGGGGCTGGTGG + Intronic
969443065 4:7228634-7228656 GGTCCAGCTGTGGGAGCTGAGGG + Intronic
969457048 4:7306178-7306200 GGTGCAGCGGTGGGCACTGGGGG + Intronic
969479387 4:7439892-7439914 TGTGCACCTGTGGGGGCAGGTGG + Intronic
969488753 4:7486750-7486772 AGGGCAGCTGTAGAGGCTGGGGG - Intronic
969557776 4:7924974-7924996 GAGGCTGTTGTGGGGGCTGGAGG - Intronic
969617640 4:8262814-8262836 GGCCCAGCTGTGGGTGCTGCTGG - Intergenic
969668698 4:8577178-8577200 CGTGCAGCTCTGGGGAGTGGTGG + Intronic
969901497 4:10354617-10354639 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
971576389 4:28280466-28280488 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
971626602 4:28928319-28928341 GGTGCAGGTGTCAGGGCTGATGG + Intergenic
972197059 4:36666341-36666363 GGTCCAGCTGTGAGCACTGGTGG + Intergenic
973070824 4:45856326-45856348 GTGGCTGCTGTGGGGGATGGAGG + Intergenic
973840455 4:54855465-54855487 GGTGCAGCTGTGGGTGGAGAAGG + Intergenic
974876916 4:67712942-67712964 GGTTCAGCTCTGGGTGCTGCAGG + Intergenic
975059603 4:69980928-69980950 AGAGCAGCTGTGAGGGCTGCTGG - Intergenic
975098130 4:70481228-70481250 GGGGCAGCTGTGGTGTCTTGTGG - Exonic
975098142 4:70481297-70481319 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975098154 4:70481366-70481388 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975098168 4:70481435-70481457 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975098194 4:70481573-70481595 GGGGCAGCTGTGGTCTCTGGTGG - Exonic
975680196 4:76868345-76868367 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
976887851 4:90007859-90007881 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
978073126 4:104495049-104495071 GGAGGAGGTGTGGAGGCTGGGGG + Intergenic
978301242 4:107270936-107270958 GGAGCAGCAGTGGTGGCTGTGGG - Intronic
978465744 4:109006896-109006918 TGGGCACCTGTGGGGGCTTGGGG + Intronic
978662101 4:111138532-111138554 AGAGCATCTGTGGGTGCTGGGGG - Intergenic
978761837 4:112361535-112361557 GCAGCTGCTGTGGGGGATGGGGG - Intronic
978776943 4:112514765-112514787 AGTGCAGCTGTAGGGGGAGGTGG + Exonic
979439483 4:120734216-120734238 GGAGCCGCTGTAGGGGATGGGGG + Intronic
980087189 4:128403578-128403600 GCTGCTGCTGTTGGGGATGGAGG + Intergenic
980730986 4:136824064-136824086 GATGCAGACGTGGGGGCTGAGGG - Intergenic
981084571 4:140669754-140669776 CGTGCTTCTCTGGGGGCTGGAGG + Exonic
981121491 4:141056462-141056484 GGGGCAGGGGTGTGGGCTGGTGG + Intronic
981566116 4:146103782-146103804 GGTGGAGGTGAGGGGGTTGGGGG + Intergenic
982312160 4:153997351-153997373 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
982680155 4:158419064-158419086 GTGGCTGCTGTGGGGGATGGGGG + Intronic
982720127 4:158850618-158850640 AGAGTAGCAGTGGGGGCTGGAGG + Intronic
983814876 4:172111824-172111846 TGTGCAGCTGTAGGGGCAGCAGG - Intronic
984695488 4:182775312-182775334 GGTGCAGCTGGGGAGGCTGGAGG + Intronic
984721681 4:182978414-182978436 GCAGCTGCTGTGGGGGTTGGCGG - Intergenic
984797059 4:183671454-183671476 GGAGCAGCAGTTGGGGCTGCGGG - Intronic
985008634 4:185559934-185559956 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
985092892 4:186381937-186381959 GCGGCTGCTGTGGGGGCTGGGGG - Intergenic
985217764 4:187671910-187671932 GCGGCTGCTGTGGGGGCTGGGGG + Intergenic
985570608 5:642780-642802 GGAGCAGCCGTGCAGGCTGGTGG + Intronic
985573915 5:664976-664998 GGTGCCCCAGAGGGGGCTGGGGG - Exonic
985685650 5:1280301-1280323 GGTGCAGCTGCGGGAGCTGTCGG - Exonic
985833030 5:2249947-2249969 GGAGCTCGTGTGGGGGCTGGGGG - Intergenic
986332830 5:6730187-6730209 GGTGCCTTTGTGGGTGCTGGGGG - Intronic
986633985 5:9801849-9801871 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
988199356 5:28049630-28049652 GGTACAGCTGAAGGAGCTGGGGG - Intergenic
988401768 5:30771286-30771308 GGAGCAGCAGGGAGGGCTGGGGG + Intergenic
988737879 5:34040730-34040752 GATGCAGGGGTGGGGGTTGGGGG - Intronic
989431554 5:41361077-41361099 GTGGCTGCTGTGGGGGATGGGGG + Intronic
989623832 5:43410671-43410693 GCTGCCGCTGTGGGGACAGGTGG + Intronic
991570152 5:68045206-68045228 TGTGCAGCTGTGGGAGGTGAAGG - Intergenic
991659119 5:68932491-68932513 GGTGCAGGTGGGGCGCCTGGAGG - Intergenic
992022211 5:72635743-72635765 GGTGGAGTTGTGGGGGGAGGTGG - Intergenic
992409799 5:76493922-76493944 GGAGCATCTGTGGGGGCTCCTGG - Intronic
993144892 5:84081261-84081283 TGTGTAGCTGTGGGTGATGGAGG - Intronic
993191664 5:84690865-84690887 GGTGGAGGAGTGAGGGCTGGGGG - Intergenic
993920543 5:93795301-93795323 GGTGCTGTTGTGGGGCATGGTGG - Intronic
995394434 5:111672643-111672665 GGAGCAGCTGGGGGCGGTGGGGG - Intronic
995694605 5:114865531-114865553 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
996010751 5:118479160-118479182 GTGGCTGCTGTAGGGGCTGGGGG - Intergenic
996888851 5:128393161-128393183 GGAGCCGGTGTGGGGGCCGGGGG - Exonic
997194099 5:131966281-131966303 GGAGCACCTCTGGGGCCTGGGGG - Intronic
997214035 5:132095675-132095697 GGTGGAGAGGTGGGGGCTGCCGG - Intergenic
997257067 5:132437187-132437209 CCTGCAGGTGTAGGGGCTGGCGG + Intronic
997476746 5:134146882-134146904 GGTGTGGCAGTGGGGGATGGGGG - Exonic
997570021 5:134920044-134920066 GGTCCAGCGGTGTGGGCAGGTGG + Intronic
997711054 5:136005351-136005373 GGTGGAGGGGTGGGGACTGGGGG - Intergenic
997976849 5:138445934-138445956 GGCCCAGCTGTGGGGGTTGAGGG + Exonic
998012921 5:138709598-138709620 GGTGCTGCTGGGTGGGCTGGGGG + Intronic
998133067 5:139660783-139660805 GGAGCAGCTGCTGGGGTTGGGGG + Intronic
998530157 5:142876918-142876940 GTGGCAGCAGTGGGGGTTGGTGG + Intronic
998940863 5:147280605-147280627 GCTGCTGCTGTGGGGAATGGGGG - Intronic
999105569 5:149067985-149068007 GGTGTACCTGTGGGGCATGGAGG + Intergenic
999748182 5:154608011-154608033 GGTGGAGATGGGCGGGCTGGTGG - Intergenic
999818507 5:155200993-155201015 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
999873526 5:155776652-155776674 AGTGAAGCTGAGGGGGCTGGAGG - Intergenic
1000692722 5:164343315-164343337 TGTGAATCTGTGTGGGCTGGTGG - Intergenic
1001116160 5:168941982-168942004 GATGCAGATGTGGTGGCTGGAGG - Intronic
1001693772 5:173654082-173654104 GCAGCTGCTGTGGGGGATGGGGG + Intergenic
1001984286 5:176060901-176060923 CGAGCAGCGGTGGGGGCGGGTGG + Intronic
1002052111 5:176577079-176577101 GGTGTTGCTGTGGGGGCTGGGGG + Intronic
1002233190 5:177783164-177783186 CGAGCAGCGGTGGGGGCGGGTGG - Intronic
1002262789 5:178006617-178006639 CGAGCAGCGGTGGGGGCGGGTGG + Intronic
1002291720 5:178204940-178204962 GGCGCCGCGGCGGGGGCTGGAGG + Exonic
1002373008 5:178769645-178769667 GGAGCCGCTGTGAAGGCTGGCGG + Intergenic
1002417678 5:179129286-179129308 TGTGGAGCGCTGGGGGCTGGTGG + Intronic
1002618429 5:180469587-180469609 GGTGCAGGAGTGGGAGCTGGGGG - Intergenic
1002858051 6:1055538-1055560 GGTGTTACTGTGGGGGCTGCAGG + Intergenic
1003046792 6:2740601-2740623 GGAATAGGTGTGGGGGCTGGAGG - Intronic
1003325306 6:5086007-5086029 GGAGCAGCTCGGGGGGCTGCTGG + Exonic
1003450874 6:6230409-6230431 GCAGCTGCTGTGGGGGATGGGGG - Intronic
1003878399 6:10458427-10458449 AGTGCAGCAGAGGGGGTTGGAGG + Intergenic
1003883603 6:10500451-10500473 GTTGCAGCTGTGGGGCCAGCTGG + Intronic
1004468352 6:15906354-15906376 GGTACAGCTGTGGGGACAGGAGG + Intergenic
1004888527 6:20074858-20074880 GCAGCTGCTGTGGGGGATGGAGG - Intergenic
1005117695 6:22356479-22356501 GGAGCAGGGGTGGGGGGTGGTGG + Intergenic
1006014901 6:31072654-31072676 AGGGCAGCTGTGGGAGCTGAGGG + Intergenic
1006535716 6:34697018-34697040 GGTCCAGCCGTGGGGGGCGGGGG + Intergenic
1006640696 6:35488228-35488250 CGGGCTGCTGTGGGGCCTGGAGG - Intronic
1006727641 6:36211304-36211326 GGTGCAGCTGAAGGAGCTGCTGG + Exonic
1006864729 6:37200258-37200280 AGCACAGCAGTGGGGGCTGGGGG + Intergenic
1007323616 6:41043954-41043976 GCTGCTGCTGTATGGGCTGGTGG + Exonic
1007473846 6:42106668-42106690 GGTGCAGCTGGGGGAAGTGGGGG + Exonic
1007479652 6:42141921-42141943 GGTGTAGCGGTGGGGGTCGGGGG + Intronic
1007486664 6:42185187-42185209 GGTGGAGCTGAGAGAGCTGGAGG + Intronic
1007617953 6:43193187-43193209 GGTGCAGCAGGCTGGGCTGGCGG + Exonic
1007669503 6:43539666-43539688 GGTGCAGTGGGGGGGCCTGGAGG - Intronic
1008030423 6:46688215-46688237 GGTGCAGCTGTGGGGGCTGGTGG + Exonic
1008521255 6:52363242-52363264 TGTGCAGCTGTGGGTGCTCCAGG + Intronic
1008775407 6:55032000-55032022 GTGGCTGCTGTGGGGGTTGGGGG + Intergenic
1009389707 6:63130884-63130906 GCAGCTGCTGTGGGGGCTGGGGG + Intergenic
1009497977 6:64374194-64374216 GGTGGAGGTGTGGGGGGTGGGGG + Intronic
1010165113 6:72906071-72906093 GTGGCTGCTGTGGGGGATGGGGG + Intronic
1010679324 6:78781258-78781280 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1010742529 6:79525803-79525825 GCTGCAGGTGTGGGGGCGGCAGG + Intronic
1010766608 6:79782410-79782432 GGAGCAGGTGTGGGAGTTGGAGG + Intergenic
1011093522 6:83633551-83633573 GCGGCTGCTGTGGGGGTTGGGGG + Intronic
1011168625 6:84479466-84479488 GTGGATGCTGTGGGGGCTGGGGG - Intergenic
1011233318 6:85187942-85187964 GTGGCTGCTGTGGGGGATGGTGG - Intergenic
1011558901 6:88595658-88595680 GCTGCAGATGTGGGGGCTGGAGG - Intergenic
1011699395 6:89941712-89941734 GGTGGCGCTTTGGGGGCTTGTGG + Intronic
1011832220 6:91387653-91387675 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1011893312 6:92194084-92194106 GGGGCTGCTGTGGGGTATGGGGG + Intergenic
1012155953 6:95819942-95819964 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1013013932 6:106144177-106144199 AGTGAAGCTGTGGGGCCTGGGGG - Intergenic
1013067708 6:106699731-106699753 GGGGTAGCTGCAGGGGCTGGAGG - Intergenic
1013347668 6:109277787-109277809 GGTGCAGCTGTGGGGATGAGCGG + Intergenic
1013603478 6:111726623-111726645 GGTGTGGGTGTGAGGGCTGGAGG + Intronic
1013721044 6:113028376-113028398 GCAGCTGCTGTGGGGGATGGGGG + Intergenic
1014603895 6:123448552-123448574 GTAGCTGCTGTGGGGGATGGGGG - Intronic
1014811506 6:125891890-125891912 GGAGATGCTGTGGGGGCTGCAGG - Intronic
1016290023 6:142518602-142518624 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1016387244 6:143540392-143540414 GGTGGAGCTGTGGGGGAGGCTGG - Intronic
1016562955 6:145417762-145417784 GATTCAGCTGTGGAGTCTGGGGG - Intergenic
1017327188 6:153152745-153152767 GCTGCAGGTGTGGGGGCGGCGGG + Intergenic
1017867657 6:158457987-158458009 TGTGGAGCAGTGGGGGGTGGAGG - Intronic
1018378820 6:163239625-163239647 GGGGCAGCCGTGGGAGCAGGAGG - Intronic
1018564929 6:165141313-165141335 GGGAAAGCTGTGGCGGCTGGTGG - Intergenic
1018579580 6:165297058-165297080 GATGGAGCTTTGGGGGCTGGTGG - Intronic
1018755278 6:166843194-166843216 GTGGCTGCTGTGGGGGATGGGGG - Intronic
1018762542 6:166904403-166904425 GCAGCAGCCGTGGGGGCAGGCGG - Intronic
1018765896 6:166932444-166932466 GGAGCAGAGCTGGGGGCTGGGGG - Intronic
1019112219 6:169724879-169724901 GGTGCAGCTGCGGATGCTCGGGG - Intronic
1019278146 7:186882-186904 GGTCCAGGTGGGGGTGCTGGAGG - Intergenic
1019342127 7:513292-513314 TGTGCAGCTGGGTGGGGTGGCGG - Intronic
1019521884 7:1464408-1464430 GGTGCTGCGGCTGGGGCTGGTGG + Intergenic
1019541478 7:1553618-1553640 GGTGCAGCTCAGGGAGTTGGGGG + Intronic
1019727875 7:2612838-2612860 GGCGGAGCTGTGGGGGCTGCTGG + Exonic
1019742446 7:2681586-2681608 GGTCCAACTGTGGGGGCTGTGGG + Intronic
1019786514 7:2980681-2980703 GGGGCAGAAGTGGGGACTGGGGG + Intronic
1019922977 7:4174547-4174569 GGTGCAGCTGCGGAGGCAGAGGG + Intronic
1020409069 7:7870600-7870622 GAAGCAGTGGTGGGGGCTGGGGG - Intronic
1020634897 7:10685011-10685033 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
1020855537 7:13416831-13416853 GGTAAAGCTCTGGGGGCTGTTGG + Intergenic
1020860781 7:13489548-13489570 GCAGCTGCTGTGGGGGATGGCGG - Intergenic
1020897095 7:13953715-13953737 GGTGGAGGTGTGGGGGATGCAGG - Intronic
1020968336 7:14901610-14901632 GGTGGGGCAGTGGGGGGTGGGGG - Intronic
1021598351 7:22340621-22340643 GGAAGGGCTGTGGGGGCTGGGGG - Intronic
1022302365 7:29113446-29113468 GGGGCAGTTGTGGGGGCCAGGGG + Intronic
1022508773 7:30922352-30922374 GGGTCAGCGCTGGGGGCTGGGGG + Intronic
1022522984 7:31019788-31019810 GGTGGGGCGGTGGGGGCTGTGGG + Intergenic
1022693431 7:32681094-32681116 AGAGCAGCTGTGAGGGCTGCTGG - Intergenic
1022921108 7:35015689-35015711 AGAGCAGCTGTGAGGGCTGCTGG - Intronic
1023748981 7:43351537-43351559 GTGGCTGCTGTGGGGGATGGGGG + Intronic
1024545472 7:50513790-50513812 GCGGCTGCTGTGGGGGATGGGGG - Intronic
1024617578 7:51128653-51128675 GGAGCAGCCGTGTGGGCTGGAGG - Intronic
1024680177 7:51678228-51678250 TGTCCAGGGGTGGGGGCTGGGGG + Intergenic
1024883714 7:54117362-54117384 GCTGTAGCTATGGGTGCTGGGGG - Intergenic
1025035818 7:55591985-55592007 GGTGCAGCTGAGAGGGGTGAAGG - Intergenic
1025106687 7:56176263-56176285 AGTGCAGGTTTGGGGGGTGGGGG + Intergenic
1025232340 7:57211067-57211089 GGCCCCGCAGTGGGGGCTGGTGG + Intergenic
1025819239 7:64947386-64947408 GATGCGGCTGGCGGGGCTGGGGG - Intergenic
1025829686 7:65038401-65038423 GGTGCCGCGGTGGGAGCGGGTGG + Intergenic
1025916939 7:65873401-65873423 GGTGCCGCGGTGGGAGCGGGTGG + Exonic
1026878197 7:73891797-73891819 GGTGCTGCAGGAGGGGCTGGAGG - Intergenic
1027267901 7:76504146-76504168 GGTCCACCTGTGGTGGATGGAGG + Intronic
1027319712 7:77004008-77004030 GGTCCACCTGTGGTGGATGGAGG + Intergenic
1027723134 7:81769972-81769994 GGTGCTGCTGGACGGGCTGGCGG + Exonic
1028197715 7:87926706-87926728 AGTGCTGTTGTGGGGCCTGGTGG + Intergenic
1028501835 7:91527667-91527689 GCAGCTGCTGTGGGGGATGGTGG - Intergenic
1028985086 7:97003241-97003263 GGGGGAGATGTGGGGGGTGGGGG - Intergenic
1029149919 7:98472552-98472574 GGAGCAGCTGCGGGGGCTCTGGG + Intergenic
1029154070 7:98502671-98502693 GGTGCCTCTGTCGGGGCAGGTGG - Intergenic
1029263704 7:99322546-99322568 GGGGCAGCTGTCTGGGCTGGTGG - Intergenic
1029367831 7:100127668-100127690 GGCGCTGCTGGGGGCGCTGGCGG + Exonic
1029372940 7:100160665-100160687 CCTGCAGCTGTGGGGGGTTGGGG + Exonic
1029374322 7:100168681-100168703 GCAGCAGCTGCTGGGGCTGGCGG - Exonic
1029495528 7:100894135-100894157 GGTGGAGGAGTGGGGGCTGAGGG - Exonic
1029582639 7:101447615-101447637 TTTGCAGCAGTGGGGTCTGGAGG + Intronic
1030105920 7:105987230-105987252 AGAGCAGCTGCGGGGGCTTGTGG + Intronic
1030310131 7:108060409-108060431 GCTGCAGGTGTGGGGAGTGGAGG + Intronic
1030935990 7:115585365-115585387 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
1031598025 7:123670095-123670117 GATGGAGGAGTGGGGGCTGGAGG + Intergenic
1031740109 7:125418784-125418806 GTGGCTGCTGTGGGGGATGGAGG - Intergenic
1032166928 7:129552883-129552905 GGTGGAGATGAAGGGGCTGGAGG - Intergenic
1032360452 7:131250197-131250219 GCTTCAGCTTTGGTGGCTGGGGG + Intronic
1033026828 7:137782415-137782437 GTGGCTGCTGTGGGGGATGGGGG - Intronic
1033225001 7:139554409-139554431 TTTGCTGCTGTGGGGGCAGGTGG + Intergenic
1033707656 7:143904521-143904543 GGGGAAACTGTGGGGGCAGGTGG + Intergenic
1034116638 7:148589543-148589565 GGTGGGGCTGGTGGGGCTGGAGG - Intergenic
1034116642 7:148589552-148589574 GGTGGGGCTGGTGGGGCTGGTGG - Intergenic
1034281616 7:149858877-149858899 GGGCCAGCTGTGGGGGCAGAGGG + Intronic
1034281626 7:149858910-149858932 GGGCCAGCTGTGGGGGCAGAGGG + Intronic
1034281636 7:149858943-149858965 GGGCCAGCTGTGGGGGCAGAGGG + Intronic
1034281646 7:149858976-149858998 GGGCCAGCTGTGGGGGCAGAGGG + Intronic
1034281656 7:149859009-149859031 GGGCCAGCTGTGGGGGCAGAGGG + Intronic
1034281666 7:149859042-149859064 GGGCCAGCTGTGGGGGCAGAGGG + Intronic
1034311773 7:150094954-150094976 TGGGGGGCTGTGGGGGCTGGGGG - Intergenic
1034617553 7:152432209-152432231 GGTGTGGGTGTGGGGGATGGGGG - Intronic
1034795081 7:154005700-154005722 TGGGGGGCTGTGGGGGCTGGGGG + Intronic
1034829047 7:154293430-154293452 AGTGGAGCTGTGTGGGCTGAAGG + Intronic
1034967508 7:155400319-155400341 GCTGCAGCTGGGGTGGCAGGGGG - Intergenic
1034989430 7:155538664-155538686 GGGGGAGTTCTGGGGGCTGGGGG + Intergenic
1035116656 7:156530322-156530344 GGGACAGCTGTGGAGGCTGCGGG - Intergenic
1035133361 7:156675985-156676007 GGTGCAGCCGTGGAGGCTGTGGG + Intronic
1035257854 7:157643497-157643519 GGCGGAGGTGTGGGGGCTGCAGG + Intronic
1035293891 7:157857110-157857132 GGTGGAGCTGGGGATGCTGGAGG + Intronic
1035356684 7:158279989-158280011 GGGGCAGCGGTGGGGCGTGGGGG - Intronic
1035356703 7:158280036-158280058 GGGGCAGCGGTGGGGCGTGGGGG - Intronic
1035587608 8:787796-787818 GGTGGTGCTGTTGGGGCTTGAGG + Intergenic
1035689613 8:1551449-1551471 GGCGCAGCTGGAGGGGCTTGGGG - Intronic
1035737963 8:1902602-1902624 GGTGGAGATGTGGGGGGAGGGGG - Intronic
1035905268 8:3502978-3503000 TGTGCATGTGTGGGGGCAGGGGG + Intronic
1036149138 8:6281849-6281871 AGTTCAGCTGTGAGGGCTGTAGG - Intergenic
1036578814 8:10054364-10054386 GGCGCTGCTGGCGGGGCTGGAGG - Exonic
1036646961 8:10616951-10616973 GGCCCCGCTGTGGGAGCTGGAGG - Intronic
1036654649 8:10670422-10670444 GGTGTAGGTGTGGGGGTTGGGGG + Intronic
1037579101 8:20234250-20234272 GGAGCAGCTATGGAGACTGGTGG - Intergenic
1037755028 8:21705043-21705065 GGTGCAGCTGTCGTGGCAGCGGG - Exonic
1037954377 8:23042723-23042745 GGGGCTGCTGTGGGGAGTGGAGG - Intronic
1038268244 8:26052230-26052252 GGTGCGGCAGTGGTGGCGGGGGG + Intergenic
1038348799 8:26757513-26757535 GGAGCAGAGGTGGGGGGTGGGGG - Intronic
1038367212 8:26948421-26948443 GTAGCTGCTGTGGGGGATGGGGG + Intergenic
1038370960 8:26989879-26989901 GATGCAGCTGTGGGTGCAGAAGG - Intergenic
1039083296 8:33755347-33755369 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1039348912 8:36739777-36739799 TGTGCATGTGTGGGGGCAGGAGG + Intergenic
1039567982 8:38564753-38564775 GGTGAGGCGGTGGGGGCCGGTGG - Intergenic
1039884169 8:41646035-41646057 GATCCAGCTGTTGGGGCGGGGGG - Exonic
1039890426 8:41682146-41682168 AGGGCAGGTGTGGGGGCTGGAGG - Intronic
1040052807 8:43033050-43033072 GGGGCGGCTGGGGGGGGTGGGGG + Intronic
1040080100 8:43276194-43276216 GGGGCCGCTGTGGGGGCGGGCGG + Intergenic
1040294769 8:46143430-46143452 GGTTCAGCTTTGGGGGCTTATGG + Intergenic
1040298230 8:46174340-46174362 GGGACAGCTGTGGGGGCTTCTGG - Intergenic
1040341331 8:46442618-46442640 GGGACAGCTGTGGGGGCTTTTGG + Intergenic
1040549734 8:48428924-48428946 GATGGAGTTGTGGGGGCAGGGGG - Intergenic
1040898465 8:52392368-52392390 GGTGCAGGTGGAGAGGCTGGTGG + Intronic
1041293755 8:56333470-56333492 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1042104680 8:65313888-65313910 GGGGCAGCAGTGGGGCGTGGGGG - Intergenic
1042122876 8:65507404-65507426 GGGGCTGCTGTGGGGGATGGAGG + Intergenic
1042335929 8:67630335-67630357 GGTGCAGCTTTGGGATGTGGGGG + Intronic
1042467135 8:69140831-69140853 GGGGCTGCTGTGGGGGGTGGAGG + Intergenic
1042821749 8:72937154-72937176 GGTGAAGCTGTCGATGCTGGAGG - Exonic
1042926554 8:73973379-73973401 GGTGCAGATGAGGAGGCTGTAGG + Intronic
1043448257 8:80340461-80340483 GGGGAAGCTGTGGAGGCTGAGGG - Intergenic
1045272178 8:100671200-100671222 TGTGCAGTTGTGGAGGCTGCAGG + Intergenic
1045494705 8:102698656-102698678 AGTGCAGAAGTGGGGGCTTGGGG + Intergenic
1045503039 8:102757910-102757932 GGTGGAGCAGTGAGGGATGGTGG + Intergenic
1045684039 8:104692801-104692823 GGTGGGGATGTGGGGGGTGGAGG - Intronic
1045779820 8:105849793-105849815 GCTGCTGCTATGGGGGTTGGGGG - Intergenic
1047130764 8:122017442-122017464 GTGGCTGCTGTGGGGGATGGGGG + Intergenic
1047411556 8:124628518-124628540 GCACCTGCTGTGGGGGCTGGTGG - Intronic
1048328492 8:133456357-133456379 GGTTCAGCTCTGGGTGCTGCAGG + Exonic
1048868957 8:138781608-138781630 GGTGCAGCTGTGGGAAGTTGGGG + Intronic
1049181607 8:141225891-141225913 GGGGCAGCTGTGGGGACTATAGG - Intronic
1049374815 8:142284335-142284357 GGTGAAGGGGTGAGGGCTGGGGG + Intronic
1049432042 8:142569701-142569723 GGTCCAGCTGATGGGGCTGCTGG - Intergenic
1049434877 8:142581890-142581912 GGCTCACCTGTGGGGGCTGCTGG - Intergenic
1049443526 8:142619750-142619772 GGAGCAGTTGTGGGGGGGGGGGG - Intergenic
1049651972 8:143773919-143773941 GCAGCAGCTGGGGGTGCTGGGGG + Intergenic
1049653834 8:143789133-143789155 GGTGCTGGTGGGGGCGCTGGCGG + Intergenic
1049689127 8:143951077-143951099 GTTGGAGCCGTGGGGCCTGGTGG - Intronic
1049709724 8:144058053-144058075 TGTCCAGCTGCGGGGCCTGGAGG + Exonic
1049747137 8:144267721-144267743 GCAGGAGATGTGGGGGCTGGGGG + Intronic
1049790110 8:144468529-144468551 GGGGCAGCTGGGGGTGCAGGAGG + Exonic
1049795748 8:144496600-144496622 GGTGCAGCCGCTGAGGCTGGGGG - Exonic
1049819219 8:144624492-144624514 GGTGCAGATGTGCGGGTTAGAGG - Intergenic
1049826982 8:144675135-144675157 GTTGCAGCTGGGGAGGCTTGGGG - Intergenic
1049884924 9:20393-20415 GATGGAGCTATGGGGGTTGGAGG + Intergenic
1050147380 9:2583638-2583660 GTAGCTGCTGTGGGGGATGGGGG - Intergenic
1050526934 9:6554530-6554552 AGTGCACTTGTAGGGGCTGGGGG - Intronic
1050972305 9:11893235-11893257 GGGGCTGCTGTGCGGGGTGGGGG + Intergenic
1052253489 9:26426969-26426991 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
1052537140 9:29761602-29761624 GAAGCTGCTGTGGGGGATGGAGG - Intergenic
1052560719 9:30079565-30079587 AGTGCCACTGTGGGGGCTGTGGG + Intergenic
1052731464 9:32291234-32291256 GGGGCTGCTGTGGGGCATGGGGG + Intergenic
1052998567 9:34564826-34564848 GGTGCCTCTGTGGGGGGTGGGGG + Exonic
1053542871 9:38993277-38993299 GGTGCAGGGGTTGGGGGTGGGGG + Intergenic
1053807317 9:41816794-41816816 GGTGCAGGGGTTGGGGGTGGGGG + Intergenic
1054301899 9:63386009-63386031 TGTGCGGCTGTGGGGGGGGGTGG + Intergenic
1054623275 9:67370633-67370655 GGTGCAGGGGTTGGGGGTGGGGG - Intergenic
1054781930 9:69173966-69173988 GGTGCAGGCGTGGGGGCTGCGGG + Intronic
1054816808 9:69483462-69483484 GGTGCTGGTGTTGGGGCTGAGGG + Intronic
1055935370 9:81599442-81599464 AGTGTGACTGTGGGGGCTGGGGG + Intronic
1056177083 9:84045582-84045604 GGTGGTGCTGTGGGGGAGGGCGG + Intergenic
1056470739 9:86902854-86902876 GGTGGAGGTGAGGGTGCTGGAGG - Intergenic
1056601813 9:88052770-88052792 GACGCAGCTGTGGCAGCTGGGGG - Intergenic
1056699045 9:88887079-88887101 GTGGCTGCTGTGGGGGGTGGGGG + Intergenic
1057045760 9:91885294-91885316 GTTGAAGCTTTGGGGGTTGGGGG + Intronic
1057277703 9:93684769-93684791 GGTGCTGATGTGGGTGGTGGAGG + Intergenic
1057475709 9:95399446-95399468 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
1058202481 9:102061698-102061720 GTTGCAGGGGTGGGGGCTGGGGG - Intergenic
1058410394 9:104725025-104725047 GCAGCTGCTGTGGGGGCTGGGGG - Intergenic
1059343624 9:113613534-113613556 CCTGCAGCTGTTTGGGCTGGAGG + Intergenic
1059404078 9:114089298-114089320 GGAGCAGCTGGGGTTGCTGGAGG - Intronic
1059852742 9:118362689-118362711 GGTGGAGTGGTGGGGGATGGTGG - Intergenic
1060225176 9:121786098-121786120 GGTGCAGCTGAAGGGGCTTGGGG - Intergenic
1060409694 9:123391968-123391990 GGAGCAGCCGTGGGGGATGATGG - Intronic
1060504116 9:124185521-124185543 GGTGCTGCTGCTGTGGCTGGTGG - Intergenic
1060555423 9:124505126-124505148 GCTGCGGCTGGGGGGCCTGGAGG - Intronic
1060667856 9:125443681-125443703 GGGGGAGCTGGCGGGGCTGGCGG - Intronic
1060788684 9:126470521-126470543 GGAGGAGGTGGGGGGGCTGGTGG + Intronic
1060819651 9:126654030-126654052 GGTGGAGCTGTAGGGGATCGGGG - Intronic
1060819839 9:126654964-126654986 GTCACAGCTGTGGGGGATGGGGG - Intronic
1060835607 9:126753265-126753287 AGTCTAGCTGTGTGGGCTGGTGG - Intergenic
1061069270 9:128298952-128298974 GGTGCAATTGTGGAGGGTGGAGG - Intergenic
1061069327 9:128299244-128299266 GATGCTGCTGTGGGTGGTGGAGG - Intergenic
1061208529 9:129177689-129177711 GGTGCAGCTGGTGGAGCTGGTGG + Exonic
1061231675 9:129319247-129319269 GGTGCAGCAGAGGGGGCCAGGGG - Intergenic
1061628356 9:131855783-131855805 GCTGGAGATGTGGAGGCTGGGGG + Intergenic
1061803790 9:133127236-133127258 GGTGCAGTTCTGGGGGCTGCCGG + Intronic
1061961329 9:133990770-133990792 GGTGCAGGTGGCGGGGGTGGCGG - Intronic
1061985851 9:134129780-134129802 AGTGCAGCTGGGGGCGCAGGAGG + Intergenic
1062015118 9:134287546-134287568 GGTGCTGGGGTGGGGGCGGGGGG - Intergenic
1062119104 9:134824562-134824584 GGAGCAGCGGTGGGTGATGGAGG - Intronic
1062286844 9:135777148-135777170 GGTACAGCTGTGGCATCTGGTGG + Intronic
1062472398 9:136712336-136712358 GGTGCTGCGGGAGGGGCTGGGGG - Intergenic
1062473805 9:136717955-136717977 GGGGGAGACGTGGGGGCTGGGGG + Intronic
1062483011 9:136761129-136761151 GCGGCAGCCGTGGGAGCTGGGGG + Intronic
1062526456 9:136979855-136979877 GGTGCACCTGTGGGCTTTGGGGG - Intronic
1062530629 9:136997975-136997997 GGGGCAGCAGAGGGGGCTGGGGG - Intergenic
1062542648 9:137048466-137048488 GGTGGAGCGGTGGGGGATAGAGG + Exonic
1062569739 9:137179596-137179618 GGAGCAGATGTGGGGAGTGGAGG - Intronic
1185950373 X:4425736-4425758 GGTGCAGCTTGTGGAGCTGGAGG + Intergenic
1186166158 X:6828456-6828478 TGTGCATGTGTGGGTGCTGGGGG - Intergenic
1186196657 X:7116210-7116232 GAGGCTGTTGTGGGGGCTGGGGG + Intronic
1186471824 X:9827740-9827762 GGTGCTGCTGTGTGGGGAGGTGG + Intronic
1187219199 X:17307746-17307768 GCAGCTGCTGTGGGGGATGGGGG + Intergenic
1189426830 X:40909410-40909432 GGTGGAAAAGTGGGGGCTGGAGG + Intergenic
1189567193 X:42255069-42255091 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1189962159 X:46333921-46333943 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1190094368 X:47467036-47467058 GGTGCTGTGGTGGGGGATGGAGG + Intronic
1190108840 X:47576680-47576702 AGGGCAGCTGTGGGGAGTGGGGG + Intronic
1190512741 X:51191130-51191152 AGAGCAGGAGTGGGGGCTGGGGG + Intergenic
1191138616 X:57092846-57092868 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1191813625 X:65218636-65218658 GCGGCTGCTGTGGGGGATGGGGG - Intergenic
1192362286 X:70447456-70447478 TCTGCAGCTGTGGGAGTTGGTGG - Intronic
1192814411 X:74576110-74576132 GGGGCAGCTGTGGGAGCTAAAGG - Intergenic
1193156850 X:78183316-78183338 GCGGCTGCTGTGGGGGATGGGGG - Intergenic
1193600486 X:83504246-83504268 GGAGTAGCGGTGGGGGGTGGAGG - Intergenic
1193635356 X:83943712-83943734 TATGCAGGTGTGGGTGCTGGTGG + Intergenic
1193716061 X:84935752-84935774 GATGAAGGTGTGGGGGCTGTCGG - Intergenic
1193791638 X:85821836-85821858 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1193826313 X:86231449-86231471 GTGGCTGCTGTGGGGGGTGGGGG + Intronic
1194795546 X:98207700-98207722 TGTGCAGGGGTGGGGGCTGTTGG + Intergenic
1194926921 X:99836526-99836548 GCGGCAGCTGTGGGGAATGGGGG + Intergenic
1195075867 X:101326692-101326714 GCAGCTGCTGTGGGGGATGGGGG - Intergenic
1195162058 X:102180679-102180701 GGTGGAGCTGAGGGAGATGGAGG + Intergenic
1195709092 X:107759890-107759912 GGCTCGGCTGTGGGGGCGGGAGG + Intronic
1195795452 X:108642204-108642226 GTGGCTGCTGTGGGGGATGGAGG - Intronic
1196024014 X:111020974-111020996 GTGGCTGCTGTGGGGGATGGGGG - Intronic
1196523281 X:116699649-116699671 AATGCATCTGTGAGGGCTGGAGG - Intergenic
1196737482 X:118992487-118992509 GCAGCTGCTGTGGGGGATGGGGG - Intronic
1196888728 X:120272149-120272171 AGAGCAGCTGTAAGGGCTGGGGG - Intronic
1196938449 X:120752571-120752593 ACTGCAGCTGTGAGGGGTGGAGG - Intergenic
1197055492 X:122113775-122113797 GCAGCTGCTGTGGGGGATGGGGG + Intergenic
1197571609 X:128156883-128156905 GGGGCAGCTGTGCAGGGTGGTGG + Intergenic
1197700824 X:129598214-129598236 GGTGGAGAGGTGGGGGCTGGAGG - Intergenic
1197810196 X:130434423-130434445 GGTGGAGGGGTGGGGGCAGGGGG - Intergenic
1198085738 X:133279827-133279849 CCTGCAGCTGAGGGGGCTGATGG + Intergenic
1198276453 X:135098854-135098876 GATGGAGCTGTGCGGGCTCGTGG - Intergenic
1198305828 X:135382235-135382257 TGTCCAGCTGTATGGGCTGGAGG - Intergenic
1198312688 X:135436907-135436929 GGTGCAGCGGTGCGCGGTGGAGG + Intergenic
1198392861 X:136193949-136193971 GATGCAGCTGGGGGGGGTTGGGG - Intronic
1199173498 X:144758079-144758101 GATGCAGCTGTGGTGGCTAAGGG + Intergenic
1199368716 X:147020098-147020120 GAGGGAGCTGTGGGGGCGGGGGG + Intergenic
1199597817 X:149522039-149522061 TGTGCAGCTGTGGTGCCTGTGGG - Intronic
1199668519 X:150121252-150121274 GTGGCTGCTGTGGGGGATGGGGG - Intergenic
1199832940 X:151562804-151562826 GGGGCAGCGGGGGGGGCGGGGGG + Intergenic
1199858457 X:151779127-151779149 GGTGGGGTGGTGGGGGCTGGGGG + Intergenic
1199913718 X:152315815-152315837 GTGGCTGCTGTGGGGGATGGAGG - Intronic
1200142782 X:153910138-153910160 GGTGCTGCCGAGGGGACTGGGGG - Intronic
1200831569 Y:7691617-7691639 GTTGCAGCTGAAGGGGCGGGGGG - Intergenic
1201273927 Y:12281594-12281616 TGTGCAGGTATGGGGGCTGTGGG + Intergenic
1201643126 Y:16199997-16200019 GGAGGAGCTGAGGGGGCTGAGGG - Intergenic
1201659689 Y:16385324-16385346 GGAGGAGCTGAGGGGGCTGAGGG + Intergenic