ID: 1008030424

View in Genome Browser
Species Human (GRCh38)
Location 6:46688216-46688238
Sequence GTGCAGCTGTGGGGGCTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 491}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030415_1008030424 -9 Left 1008030415 6:46688202-46688224 CCGATGTGATCCCGGTGCAGCTG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030411_1008030424 20 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030414_1008030424 -8 Left 1008030414 6:46688201-46688223 CCCGATGTGATCCCGGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030412_1008030424 9 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030408_1008030424 30 Left 1008030408 6:46688163-46688185 CCTCGCTGGCCCTGCGGGTGTCC 0: 1
1: 0
2: 3
3: 15
4: 192
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491
1008030410_1008030424 21 Left 1008030410 6:46688172-46688194 CCCTGCGGGTGTCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG 0: 1
1: 0
2: 2
3: 52
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030424 Original CRISPR GTGCAGCTGTGGGGGCTGGT GGG Exonic
900158758 1:1213633-1213655 GTGGGGCTGTGGGGCCAGGTGGG + Intronic
900203792 1:1422504-1422526 GAGGAGCTCTGGGGGCTGGGTGG + Intergenic
900316091 1:2057147-2057169 GGGCAGGTGAGGTGGCTGGTGGG - Intronic
900352685 1:2243387-2243409 CTGCAGCTGTGGGTGCAGGCTGG + Intronic
900384296 1:2402535-2402557 GCGCAGCTGTGGGAGCGGGCGGG + Intronic
900418924 1:2547202-2547224 GTCCAGCTGCGGGGCCTGGCTGG - Intergenic
901222339 1:7590358-7590380 GAGCAGGTGTGGGCCCTGGTGGG + Intronic
901672828 1:10866319-10866341 GGGCAGGTGGGGGGGCAGGTTGG - Intergenic
902293404 1:15449763-15449785 GTGCAGTGGTAGGGGCTGCTGGG + Intergenic
902889357 1:19430709-19430731 GTGCAGGTGCGGGTGCGGGTGGG - Intronic
903479823 1:23645087-23645109 GAGGAGCTGTGGGGGCAGGGAGG - Intergenic
903770241 1:25759250-25759272 GAGCAGCTGTCAGGGCTGATTGG - Intronic
903882880 1:26523852-26523874 GGGCAGCTGTTGGGTCTTGTTGG - Intergenic
904463760 1:30695806-30695828 CTGCATCTGTAGGGGCTGGAGGG + Intergenic
905240609 1:36578649-36578671 GTGGAGCTGGGGGTGATGGTGGG - Intergenic
905410573 1:37765337-37765359 GGGCAGCTGTGGGAGCTGGCAGG + Intergenic
906153051 1:43598914-43598936 GTGCAGCATTGGGTGGTGGTGGG + Intronic
907241508 1:53083762-53083784 GTGCAGATAGGAGGGCTGGTGGG + Intronic
907333725 1:53687427-53687449 GTGAAGCGGGGCGGGCTGGTTGG - Intronic
907401174 1:54225881-54225903 GAGCAGCTGTGGGGGGTGGGGGG - Intronic
907768648 1:57437681-57437703 GTGCACTTGTGGGGGCTGGGGGG - Intronic
908780690 1:67686550-67686572 GTGCAGGTCCGGGGGCTGCTCGG - Exonic
910113178 1:83703395-83703417 GAGCAGCTGTGAGGGCTGCAAGG - Intergenic
910670018 1:89763160-89763182 GGGCAGCTCTGAGGGCTGGAGGG + Intronic
913215646 1:116617889-116617911 CTGCAGCTGTGGGAGGAGGTGGG - Intronic
913580115 1:120218134-120218156 GTGCAGCTGAGGTTGCTGGCAGG - Intergenic
913663846 1:121029782-121029804 GGGCAGCTGTGGGGCCTGCCTGG + Intergenic
914015241 1:143813061-143813083 GGGCAGCTGTGGGGCCTGCGTGG + Intergenic
914162577 1:145148164-145148186 GGGCAGCTGTGGGGCCTGCGTGG - Intergenic
914653858 1:149721602-149721624 GGGCAGCTGTGGGGCCTGCCTGG + Intergenic
915722821 1:157996492-157996514 GGGGAGCTCTGGGGGCTGGGTGG - Intronic
917611192 1:176690495-176690517 GTGGAGGTGTGGGAGCTGATGGG + Intronic
919847271 1:201649863-201649885 GAGCAGATGTGAGGGCTGATTGG + Intronic
919914201 1:202129990-202130012 GTGGTGCAGTGGGGGCTGGGTGG - Exonic
920375628 1:205506298-205506320 GTGCAGCTGAGGAGGCTGTGGGG + Intronic
920498308 1:206470778-206470800 GTGCAGGGGTGTGGGCTTGTTGG + Intronic
921300327 1:213745641-213745663 GTGCAGCTGTGAGGCATGGATGG + Intergenic
922135807 1:222825156-222825178 GGGCAGTGGTGGGGGATGGTGGG + Intergenic
922598103 1:226829219-226829241 GTGCAGCTGTCGGAGGTGCTTGG - Intergenic
922699383 1:227749964-227749986 CTGCAGCTGTGGGTGCTAGGAGG - Intronic
923023893 1:230189030-230189052 GGGCAGCTGTAGGGGCTAGAAGG + Intronic
923403994 1:233642657-233642679 GTGATGCTGTGGGGGATGGACGG + Intronic
923628209 1:235631448-235631470 ATGCAGCACTGAGGGCTGGTGGG + Intronic
924691447 1:246355588-246355610 GTGCTGCTGTGGGGGCACGGTGG + Intronic
1063135743 10:3214607-3214629 GTGGAGCTGTGGGGGTTGCCAGG - Intergenic
1064052940 10:12073747-12073769 GCCAAGCTGTGGGGCCTGGTGGG - Intronic
1064284321 10:13979234-13979256 ATGCAGGTCTGGGGCCTGGTGGG + Intronic
1064963081 10:20987889-20987911 ATGAAGCTGTGGAGACTGGTGGG - Intronic
1065184440 10:23158205-23158227 GAGCAATTGTGGGGGGTGGTGGG + Intergenic
1066566748 10:36729312-36729334 GTGCAGCTCTGGGATCTGGAAGG - Intergenic
1067932460 10:50576413-50576435 TGGCAGCTGTGGTGGCTGCTGGG - Intronic
1068020057 10:51570193-51570215 GTTCAGCTGTGCGGGCTGTGCGG - Intronic
1068602808 10:58973561-58973583 GTGCAGCTCTGGGGGATTGGTGG - Intergenic
1069916279 10:71789176-71789198 GTGCAGCTCCGGGAGATGGTGGG + Intronic
1069994787 10:72335611-72335633 GAGCAGCTGTGGGGCCTGCTGGG - Exonic
1070397314 10:76022679-76022701 GTGGAGCAGTGAGGCCTGGTGGG - Intronic
1073050100 10:100661711-100661733 CTGGCGCTGCGGGGGCTGGTTGG + Intergenic
1073448026 10:103592600-103592622 GTGCACATGTGGGGGCAGGCTGG + Intergenic
1074824032 10:117201927-117201949 GGGCAGCAGTGGGGCCAGGTTGG + Intronic
1074895405 10:117773145-117773167 TGGAAGCTGTGGGGGCCGGTGGG - Intergenic
1075532416 10:123240858-123240880 GGGCAGCTTTGGGGCCTGGGAGG + Intergenic
1075795596 10:125117273-125117295 GTGCAGTCCTGGGGGCTGCTGGG + Intronic
1076003659 10:126931337-126931359 GTGCAGCTGTGAGGTTTGGAGGG + Intronic
1076470400 10:130714379-130714401 GGGCAGCTGTGTGGTCTGGCTGG + Intergenic
1076605626 10:131687592-131687614 GTGCACCTGTGTGTGCTGGCGGG - Intergenic
1076870683 10:133191795-133191817 GTGCTCCTGTGGGGTTTGGTTGG - Intronic
1076888698 10:133273914-133273936 GAGCAGCTGGGCGGGCAGGTAGG - Intronic
1077038603 11:507380-507402 GCGCAGCGGCGGGGCCTGGTGGG + Intergenic
1077081110 11:725124-725146 GTGCAGATGTGGGGGCTCCTGGG - Intronic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1078315299 11:10289283-10289305 CTGCAGCTGTGTGGGGTGGGGGG + Intronic
1078605753 11:12774075-12774097 GTGAAGCTGGAGGGGCTGGTAGG + Intronic
1079125101 11:17713452-17713474 CTGGAGCTGTAGGGGCTGGGGGG - Intergenic
1079224729 11:18595446-18595468 GTCCAGATGTGGGGTCAGGTGGG - Intergenic
1079317447 11:19421172-19421194 ATGCAGCTGAGAGGGCTGGAGGG - Intronic
1079364787 11:19799777-19799799 GGGCAGGTGTGGGGGGTGGTGGG - Intronic
1079685308 11:23352033-23352055 GTGGAGCCATGGGGGCAGGTGGG + Intergenic
1080552369 11:33383675-33383697 GGGCAGGTGTGGTGGCAGGTGGG + Intergenic
1081858952 11:46321029-46321051 GTGCAGGTGTGGGGGCAGGGAGG - Exonic
1083061317 11:59875552-59875574 GTGCTGCTGTAGGAGCTGGGGGG - Intergenic
1083366532 11:62144910-62144932 GGGCAGCTTTTGGGGCTGGGTGG + Intronic
1083594380 11:63911970-63911992 GAGAGGCGGTGGGGGCTGGTTGG + Exonic
1083745746 11:64735642-64735664 GTGCAACTCGTGGGGCTGGTTGG + Exonic
1084119401 11:67060095-67060117 ATGCTGGTGTGGGGGCTGCTAGG - Intronic
1084154686 11:67307034-67307056 GTGCAGCTGGGGGAGCTGGCAGG - Exonic
1084321432 11:68375517-68375539 GTGCAGGAGTGGGGTCTGGATGG - Intronic
1084323797 11:68387743-68387765 GTGGAGCTGTGGGTGCCGATGGG + Intronic
1084363531 11:68684119-68684141 TTGCAGCGGTAGGGGCTGGGAGG + Intronic
1084508527 11:69586872-69586894 GAAGAGCTGTAGGGGCTGGTGGG - Intergenic
1084665322 11:70573265-70573287 CTGCAGCGGTGGGGGCGGGGGGG + Intronic
1084971000 11:72772037-72772059 GTGGTGCTCTGGGGGCTGTTGGG - Intronic
1086747945 11:90453727-90453749 GTGAAGCACTGGGGGCTGGATGG + Intergenic
1087402582 11:97685904-97685926 GTTGGGATGTGGGGGCTGGTAGG + Intergenic
1089499126 11:118922486-118922508 GGGCAGCTGTCGGGGCTGGCAGG + Intronic
1090512055 11:127385858-127385880 CTGCAGCTGTGGCTGCTGGCTGG + Intergenic
1090827961 11:130401157-130401179 GGGCAGCTCTGGGGGCTGGAAGG + Intergenic
1091353638 11:134916958-134916980 GAGCAGCTCTGGGGCCTGGGAGG + Intergenic
1091822100 12:3483131-3483153 GGGCTGCTGTGGGGATTGGTGGG + Intronic
1091841244 12:3622592-3622614 GTGCAGCTGCTGGGTTTGGTTGG + Intronic
1091934860 12:4427160-4427182 GGGCAGGGGTGGGGGCTGGCAGG - Intergenic
1092262183 12:6958692-6958714 GTGCAGAGGTGGGGGCTGCAAGG + Intronic
1092814489 12:12301089-12301111 GTGCATTTGTGGGGACAGGTAGG - Intergenic
1092911070 12:13145417-13145439 TTGCACCTGTGGCTGCTGGTGGG - Intergenic
1092925566 12:13268973-13268995 GTGCAGCTGTACGGGGCGGTGGG + Intergenic
1094528221 12:31247460-31247482 GTGCAGTTATGGGTGTTGGTGGG - Intergenic
1096231856 12:49901163-49901185 GCACCGCTGTGGGGGCTGGGGGG + Exonic
1096873223 12:54607882-54607904 GAGCAGTTGTGGAGGCTGGATGG + Intergenic
1097185894 12:57196118-57196140 GTGCAGCAGTGGGCGCTGTGTGG + Exonic
1097636976 12:62134503-62134525 TTGCAGCTCTGGAGGCTGGAAGG - Intronic
1098347094 12:69517109-69517131 CTACAGCTGTGAGGGCTGGGAGG - Intronic
1101919213 12:108919107-108919129 GTGCAGGTGTGGGTGCAGGTAGG - Intronic
1103119684 12:118371455-118371477 GAGGAGCTGGAGGGGCTGGTGGG - Intronic
1103851702 12:123937565-123937587 GTGCAGCTGGGAGGTCAGGTAGG + Exonic
1104367675 12:128192693-128192715 GTGAACCGGTGGGGGCAGGTAGG - Intergenic
1104745435 12:131207546-131207568 GTGCGGCTGTGAGTGCTGGGAGG + Intergenic
1104788905 12:131469563-131469585 GTGCGGCTGTGAGTGCTGGGAGG - Intergenic
1104882589 12:132082869-132082891 ATGCTGCTCTGGGGGCTGGTCGG - Intergenic
1105304180 13:19157689-19157711 GTGCACCAGTGGGGGAAGGTGGG - Intergenic
1105665714 13:22553449-22553471 GTGAAGCTGTGTGGGCTTCTGGG - Intergenic
1106043922 13:26119968-26119990 TTGCAGCTTTGAGGGCTGGGAGG - Intergenic
1106155313 13:27149615-27149637 CTGCAGATGTGGGGGGTGGGAGG + Intronic
1106275081 13:28197017-28197039 GTGCAGGGGTGGGAGGTGGTGGG + Intronic
1106481514 13:30140555-30140577 ATGCAGCTGTGGGAGGAGGTGGG - Intergenic
1108258082 13:48629754-48629776 TCGAAGCAGTGGGGGCTGGTGGG + Intergenic
1111916359 13:94364758-94364780 GTGCAGCTGTGTGTGGGGGTGGG + Intronic
1112006196 13:95255755-95255777 GTGCAGGTGTGGAGGGGGGTTGG - Intronic
1112112000 13:96311405-96311427 GGGAAGTTGTGGGGGCTGGTGGG + Intronic
1112467788 13:99658773-99658795 ATGCAGCTGTGGAGGCGGGTTGG - Intronic
1112992557 13:105531949-105531971 GTGCAGCGATGGGGGATGATGGG + Intergenic
1113486503 13:110656511-110656533 GAGCGGCTGTCGGGGCTGGGAGG + Intronic
1113593452 13:111515939-111515961 GAGCAGGTGTGGAGGCTGGCCGG - Intergenic
1113794160 13:113047212-113047234 GTGCTGAGGTGGGGCCTGGTGGG - Intronic
1113900462 13:113793942-113793964 CTGCTGCTGTGGGGCCTGATGGG + Intronic
1113955874 13:114099682-114099704 GGGCTGCTGTGGGGGCTGTGGGG - Intronic
1113955884 13:114099705-114099727 GGGCTGCTGTGGGGGCTGTGGGG - Intronic
1114728838 14:24968947-24968969 ATGCAGCACGGGGGGCTGGTGGG - Intronic
1115434401 14:33356637-33356659 GGGCATCTGTGGGGGGTGCTTGG + Intronic
1115933697 14:38527727-38527749 ATGCAGCTGTGGGAAGTGGTGGG + Intergenic
1117680627 14:58199875-58199897 GTGCGGCTTTGGGGCGTGGTGGG + Intronic
1118689272 14:68322678-68322700 GTGCATCTGTGAGGCCTGGAGGG - Intronic
1119094076 14:71812725-71812747 GTCCAGGTGTGGAGGCTGGGTGG + Intergenic
1119615901 14:76099082-76099104 GTGCAGCTGCGATGGCAGGTAGG - Intergenic
1119890192 14:78176787-78176809 CTGCTGCTGTGGGGGCTGCCTGG + Intergenic
1121325849 14:93019227-93019249 CTGGAGATGTGGGTGCTGGTGGG - Intronic
1121775147 14:96585338-96585360 CTGCAGGAGTGGGGGCTGCTGGG + Intergenic
1123035344 14:105469680-105469702 GGGCAGCCCTGAGGGCTGGTCGG - Intronic
1202905971 14_GL000194v1_random:72710-72732 TGGCAGCAGTGAGGGCTGGTGGG + Intergenic
1123411761 15:20066652-20066674 GTGCAGCTGTGTGAGCAGGAGGG - Intergenic
1123505896 15:20941269-20941291 GGGCAGCGGTGGGTGCGGGTAGG + Intergenic
1123521105 15:21073771-21073793 GTGCAGCTGTGTGAGCAGGAGGG - Intergenic
1123563128 15:21514975-21514997 GGGCAGCGGTGGGTGCGGGTAGG + Intergenic
1123599377 15:21952258-21952280 GGGCAGCGGTGGGTGCGGGTAGG + Intergenic
1124225300 15:27888169-27888191 GTGCTGCCTTGGGGGCTGGAAGG - Intronic
1124933528 15:34147610-34147632 GAGCAACTGTGGGGGTTGGGGGG + Intronic
1125381456 15:39091621-39091643 GTGGAGCAGTGGGGGGTGGGGGG + Intergenic
1125725825 15:41867683-41867705 CTGCAGCTGGAGGGGCTGGCTGG - Intronic
1126804916 15:52338314-52338336 GTGAAGCTGGAGAGGCTGGTGGG + Intronic
1127428423 15:58878554-58878576 CTACAGCTGTGGGAGCAGGTTGG - Intronic
1128080939 15:64856599-64856621 TTGCAGGGTTGGGGGCTGGTAGG - Intronic
1128570792 15:68731419-68731441 GGGAAACGGTGGGGGCTGGTGGG + Intergenic
1129156755 15:73722867-73722889 GTGCACGTGTGGGGGTGGGTCGG + Intergenic
1129252914 15:74318613-74318635 GGGCAGCCTTGGGGGCTGGAGGG - Intronic
1129330957 15:74826903-74826925 GAGCAGCTGTGGGGGTGGGGAGG - Intronic
1129470361 15:75750370-75750392 GTGCTGCTGTGGGAGCCTGTAGG + Intergenic
1129780713 15:78268892-78268914 CAGCAGTTGTGGGGGCTGGGAGG + Intronic
1130108205 15:80944866-80944888 GTGCTGCTGCTCGGGCTGGTGGG - Intronic
1130388557 15:83434551-83434573 GTGGAGATGAGGGGGCTGGAGGG + Intergenic
1132415452 15:101615769-101615791 GTGCAGGTGGGGGCGCTGGCTGG - Intergenic
1202971480 15_KI270727v1_random:242109-242131 GGGCAGCGGTGGGTGCGGGTAGG + Intergenic
1132642005 16:982284-982306 GTGCAGGTGCGGGTACTGGTCGG - Exonic
1132685972 16:1162284-1162306 TCGCAGCTGTGAGGGCAGGTGGG - Intronic
1132699533 16:1216417-1216439 GTGCAAATGCTGGGGCTGGTGGG + Intronic
1132942469 16:2514780-2514802 GTGTCGCTGTGTGGGCTGTTTGG + Intronic
1132977683 16:2718863-2718885 GTGTGGCTGTGGGGGCTGATGGG + Intronic
1133222133 16:4323313-4323335 GGGCAGGTGTGGGGGCTGCGGGG + Intronic
1133690571 16:8210627-8210649 GTGCAGCTGGGGTGTCTTGTTGG - Intergenic
1133732590 16:8589810-8589832 GTGCACCTGGGCGGGCTGGCCGG - Exonic
1134840769 16:17399793-17399815 GTGCAGCTGTGGGTGGTGGTGGG - Intronic
1135391845 16:22100336-22100358 CTGCAGCTGTGGGGGGTGCGGGG - Intronic
1135479952 16:22814216-22814238 GCGCGGCTGTGCGGGCTGGCGGG - Exonic
1136861696 16:33707917-33707939 GTGCGGCTGTGGGGGGTTGGCGG + Intergenic
1137718054 16:50611039-50611061 GCCCAGCTGTGGGGGCAGGGAGG - Intronic
1138046083 16:53726817-53726839 GTGCAGCAGTTGGAGCAGGTTGG + Intronic
1138185978 16:54977960-54977982 GTGCAGCTTTGGGGTGTGGGAGG + Intergenic
1139491153 16:67286726-67286748 CTGCAGAGTTGGGGGCTGGTGGG - Intronic
1140763763 16:78136820-78136842 GTATAGCTGTGTGAGCTGGTGGG + Intronic
1140839192 16:78823266-78823288 CTGCAGCTGGGGCGGCTGGCGGG + Intronic
1141432063 16:83975377-83975399 GTGCAGATGTGGAGGCCGATAGG + Intronic
1141489505 16:84362624-84362646 CTGCAGCTGTGGGCACTGCTGGG - Intergenic
1141715326 16:85723752-85723774 GTGCAGCTGTGGGAAAGGGTGGG + Intronic
1142135333 16:88449384-88449406 GGCCAGCTGTGGGGAGTGGTGGG + Intergenic
1142264214 16:89056266-89056288 GTGCTGCAGTAGGTGCTGGTAGG + Intergenic
1142356657 16:89604594-89604616 GGGGAGCAGTGGGGGCTGGAGGG + Intergenic
1203123193 16_KI270728v1_random:1556101-1556123 GTGCGGCTGTGGGGGGTTGGCGG + Intergenic
1142597140 17:1035382-1035404 GAGCAGGTGTGGGGGATGGAAGG - Intronic
1142597179 17:1035473-1035495 GAGCAGGTGTGGGGGATGGAAGG - Intronic
1142597193 17:1035504-1035526 GAGCAGGTGTGGGGGATGGAAGG - Intronic
1142597219 17:1035563-1035585 GAGCAGGTGTGGGGGATGGAAGG - Intronic
1142597233 17:1035594-1035616 GAGCAGGTGTGGGGGATGGAAGG - Intronic
1142706027 17:1694966-1694988 GTGCATCTGTGGTGGGAGGTGGG + Intergenic
1143011703 17:3869610-3869632 GTGCAACTGTCGGGGCCGGGAGG + Exonic
1143728769 17:8867942-8867964 GTCCAGGGGTGGGGGATGGTTGG - Intergenic
1143967917 17:10770176-10770198 GAGCAGCAGTGGTGACTGGTTGG - Intergenic
1144157310 17:12518412-12518434 GTGTAGCTCTGGAGGCTGGATGG - Intergenic
1144679747 17:17185130-17185152 GGCCAGCAGTGGGGGCTGGGAGG + Exonic
1144873110 17:18382612-18382634 GAGCAGCTGCGGAGCCTGGTGGG + Exonic
1146549073 17:33764474-33764496 TTACAGCTGTGGAGGCTGGGAGG + Intronic
1147521849 17:41180837-41180859 GTGCAGCTGTGGCTACTGGCTGG + Intergenic
1147540169 17:41350679-41350701 GTGCAGCCGTGGCAGCTGGGGGG + Exonic
1147545398 17:41397451-41397473 GTGCAGCTGTGGCAGCTGGGGGG + Exonic
1147747271 17:42702508-42702530 GTGCTGCCGTGGGGCCTGGGAGG + Exonic
1148205772 17:45778974-45778996 CTGCAGGGGAGGGGGCTGGTCGG - Intergenic
1148868127 17:50639687-50639709 GTGCAGTGGTTGGGGCTGGCAGG + Intronic
1150132574 17:62677270-62677292 GTACAGCCGTGGGGGCTGCGTGG + Exonic
1151325805 17:73379278-73379300 GTGCTGCTGTGGGCACTGGAGGG + Exonic
1151724376 17:75875936-75875958 GAGCAGCTGAGGGGGCCGGGTGG - Exonic
1151883598 17:76910248-76910270 GTGCAGCAGTGGGTGCAGGCGGG - Intronic
1152135521 17:78501082-78501104 GGTCAGCTGTGGAGGCTGGAAGG - Intronic
1152296397 17:79469628-79469650 GTGCAGCTGTGGGTGGAGGGAGG - Intronic
1152624567 17:81382322-81382344 GTGAGGATGTGGGCGCTGGTGGG - Intergenic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1154208072 18:12354774-12354796 GAGGAGCTGTGGGGGGTGGTGGG - Intronic
1154416309 18:14177776-14177798 CAGCAGCGGTGGGGGCGGGTTGG + Intergenic
1155235116 18:23811110-23811132 CTGCAGCTGTGGGACGTGGTTGG + Intronic
1155378367 18:25188106-25188128 GGGCAGCCGTGTGGGCTGTTAGG - Intronic
1156670476 18:39463237-39463259 GTTCAACTTTGGGTGCTGGTAGG + Intergenic
1157196801 18:45626359-45626381 GTGCAGGTGTCGGGGCTAGTGGG - Intronic
1159914089 18:74173376-74173398 GTGCAGCTGGGAGGACTGGGAGG - Intergenic
1160294478 18:77624494-77624516 GTGCTCCTGTGGGGTCTGGCAGG + Intergenic
1160394917 18:78564072-78564094 GTGCAGATGTGGGGTGTGGGGGG - Intergenic
1160419029 18:78731683-78731705 GTGCAGCTGGGGTGGAGGGTGGG - Intergenic
1160892889 19:1388462-1388484 GTGCGGCTGGGGGAGCTGGAGGG + Intronic
1160907061 19:1456432-1456454 GCGCAGCTGTCTGGGCTGGAAGG + Intronic
1160912642 19:1481949-1481971 GGGCGGCTGTCGGGGGTGGTGGG + Exonic
1160928022 19:1556239-1556261 GAGCCGCTGTAGGGGCTGGCGGG + Exonic
1160982223 19:1821668-1821690 TGGCACCTGTGGGGGCTGGCGGG + Exonic
1161221560 19:3120381-3120403 GGGCTGCTCTGGGGACTGGTGGG - Intronic
1161593232 19:5138053-5138075 GAGCAGCGGTGGAAGCTGGTAGG + Exonic
1161597252 19:5156835-5156857 AAGCAGCTGCTGGGGCTGGTGGG - Intergenic
1161932515 19:7350191-7350213 CTGCAGCATTGGGGGCTGGCAGG - Intronic
1162045023 19:7993372-7993394 CTGCTGCTGAGGGGGCAGGTAGG + Intronic
1162054833 19:8056274-8056296 GTGGGGCCGTGGGGGCTGGGGGG + Intronic
1162164552 19:8743412-8743434 GGGCAGCTGTGCAGGGTGGTGGG + Intergenic
1162165624 19:8750880-8750902 GGGCAGCTGTGCAGGGTGGTGGG + Intergenic
1162166689 19:8758336-8758358 GGGCAGCTGTGCAGGGTGGTGGG + Intergenic
1162167755 19:8765792-8765814 GGGCAGCTGTGCAGGGTGGTGGG + Intergenic
1162168694 19:8772090-8772112 GGGCAGCTGTGCAGGGTGGTGGG + Intergenic
1162428564 19:10612651-10612673 CGGAAGCTGTGGGGGCTGGGTGG + Intronic
1162472956 19:10883286-10883308 GTCCAGGTGTGGGGGTAGGTAGG + Intronic
1162744181 19:12789817-12789839 GGGCGGCGGTCGGGGCTGGTCGG + Intronic
1163324326 19:16593358-16593380 GAGCAGATGTGTGGGCAGGTGGG - Intronic
1163403410 19:17108088-17108110 GTGCAGGCGTGGAGGCTGGAGGG - Intronic
1163493059 19:17628124-17628146 GGGCATCTCTGGGGACTGGTGGG + Intronic
1163642385 19:18469071-18469093 GTGCAGCTGTGGCGGGGAGTAGG + Intronic
1163797276 19:19344895-19344917 GTGCAGCTGTGCTGCATGGTTGG - Exonic
1165063321 19:33215600-33215622 GAGAAGGTGTGGGGGCTGGATGG - Intronic
1165116932 19:33534126-33534148 GGGCAGCTGTGGTGGCTGCAAGG + Intergenic
1165132335 19:33640856-33640878 GCCCAGGTGTGGGGGCTGCTGGG + Intronic
1166093850 19:40527734-40527756 GTGGGGGTGTGGGGCCTGGTAGG + Intronic
1166309882 19:41956980-41957002 GAGCAGCTGGGGTGGATGGTGGG - Intronic
1166374589 19:42320446-42320468 GGGCATCTGTGGGGGGTGGAGGG + Intronic
1166518892 19:43466100-43466122 GTCTAGAAGTGGGGGCTGGTCGG + Intergenic
1166831939 19:45644555-45644577 GTGGAGGTGTGGGGGTTGGTAGG - Intronic
1167618266 19:50548064-50548086 GTGTTGCTGTGAGGGCTGATGGG - Intronic
1168005180 19:53481014-53481036 GTGAGGATGTGGGGGTTGGTAGG + Intronic
1168311769 19:55464365-55464387 CTGCAGGTGAGGGGGCTGGTGGG - Intergenic
925870403 2:8265187-8265209 CTGCAGCTTTGGAGGCTGGCTGG + Intergenic
926010513 2:9402520-9402542 GGGCAACTGTGGGAGCTGGCTGG - Intronic
926060294 2:9800883-9800905 GTGCAGCTGGTGGGGGTGGAGGG + Intergenic
926132665 2:10314288-10314310 GTGCAGGGGTGGGGGGTGGCAGG + Intronic
926744377 2:16138896-16138918 GTGAAAGTGTGGGGGATGGTTGG - Intergenic
927476067 2:23415034-23415056 GGGCAGCTGTGGGGCCTTGTGGG - Intronic
927668634 2:25050269-25050291 GGGCAGCTGTGCAGGGTGGTGGG + Intronic
928140484 2:28724182-28724204 GGACAGCAGTGGGGGCTGGGAGG + Intergenic
928435160 2:31250102-31250124 GTGGGGCGGTGGGGGCGGGTGGG + Intronic
932163088 2:69480822-69480844 CTGCAGCTGCAGGGACTGGTCGG - Intronic
933750298 2:85598884-85598906 ATGCAGCTGTGGCAGCTGGCAGG + Exonic
934976861 2:98808870-98808892 GTGCAGCTGCAGGGGATGGGCGG + Intronic
935582909 2:104774273-104774295 GTGCTGGTGTAGGGGTTGGTTGG + Intergenic
935599107 2:104904207-104904229 CTGCAGCTGTGGGGAACGGTTGG + Intergenic
936066329 2:109335217-109335239 GAGCAGCTGTGGGGACTGTGGGG + Intronic
936524811 2:113235347-113235369 ATGCAGCTATGGCGGCGGGTGGG - Intronic
937981543 2:127619067-127619089 GTTGGGTTGTGGGGGCTGGTTGG + Intronic
937981550 2:127619085-127619107 GTTGGGTTGTGGGGGCTGGTTGG + Intronic
937981596 2:127619229-127619251 GTTGGGTTGTGGGGGCTGGTTGG + Intronic
937981621 2:127619298-127619320 GTTGGGTTGTGGGGGCTGGTTGG + Intronic
939991066 2:148876645-148876667 CTGCAGCTGGGGCTGCTGGTAGG + Intronic
940370356 2:152894529-152894551 ATGCAGCAGTGGGAGCTGGTGGG + Intergenic
940468208 2:154059900-154059922 GTGAAGCTTGGGGAGCTGGTAGG + Intronic
941652872 2:168112355-168112377 GGTCAGCGGAGGGGGCTGGTTGG + Intronic
941688227 2:168469764-168469786 TTGCAGTTGTGGGGGTGGGTAGG - Intronic
943390557 2:187262182-187262204 GGGCAGCTTTGGGGAATGGTTGG - Intergenic
944513087 2:200483836-200483858 GTGCAGCTGTGGCCACTGGAGGG + Intergenic
945425383 2:209694405-209694427 GTGCAGGTGTGGTGGCTGGAAGG - Exonic
946208141 2:218125726-218125748 GAGCAGCTGTGGTGGCTGAAGGG + Intronic
946959662 2:224970635-224970657 ATGCAACTGTGGGGGCTCATGGG - Intronic
947716939 2:232345573-232345595 GTGCTGCTGAGGGGGCTGAATGG + Intergenic
948065846 2:235078646-235078668 GTGCAAATGTGTGGGCTGGTTGG - Intergenic
948083342 2:235225838-235225860 GTGGTGCTGTGTGAGCTGGTGGG + Intergenic
948139288 2:235660939-235660961 GTGCAACTGTGGAGACTGGAGGG + Intronic
948248706 2:236507668-236507690 GCGCAGCTGTGGGAGCCGGTCGG + Intergenic
948263695 2:236622472-236622494 GTGGAGGTGTGGGGGATGGAAGG + Intergenic
948805841 2:240453242-240453264 GTGCAGCTGGGGCGACGGGTGGG - Intronic
948819279 2:240530319-240530341 GTGTTGCAGTGGGGCCTGGTGGG + Intronic
948976852 2:241468705-241468727 GTGCACTTGTGGGGGCTGTGGGG - Intronic
1168961681 20:1874444-1874466 TTGCTGCTGTGGGGGCTGCAGGG - Intergenic
1170603319 20:17858495-17858517 GAGGAGATGTGAGGGCTGGTCGG - Intergenic
1170787954 20:19483738-19483760 TTGCAACTGTGGGGCCAGGTTGG + Intronic
1172011498 20:31848560-31848582 CTGCACCTGCGGGGGCGGGTGGG + Intronic
1172117375 20:32581121-32581143 GGGCAGCTAGGGGTGCTGGTGGG - Intronic
1172441933 20:34971941-34971963 CTGCAGCTGGTGGGGCTGCTTGG + Intergenic
1172798962 20:37563285-37563307 TGGCAGGTGTGGGGGCTGGGAGG + Intergenic
1172841673 20:37905733-37905755 GGGCAGCTGTGGGGGCTCCTCGG - Intronic
1173450586 20:43160079-43160101 GTTCTGCTGTATGGGCTGGTGGG - Intronic
1173578969 20:44132835-44132857 CTGCAGGTGTGGGGGGCGGTGGG - Intronic
1173616651 20:44407511-44407533 GGGGAGCTGTGGGTGCAGGTGGG - Intronic
1173645647 20:44631631-44631653 GTGGAGTTCTGGGGGCTGGAGGG - Intronic
1174039298 20:47687572-47687594 GGGAAGCTCTGAGGGCTGGTGGG + Intronic
1174076987 20:47944350-47944372 CTGCATCTCAGGGGGCTGGTAGG + Intergenic
1174360748 20:50027680-50027702 GTGCAGGGCAGGGGGCTGGTTGG - Intergenic
1175736109 20:61388386-61388408 GTGCAGCTGTAGGGGCTGTAGGG - Intronic
1175859193 20:62141153-62141175 CAGCTACTGTGGGGGCTGGTGGG + Intronic
1176138803 20:63536264-63536286 GTGCAGGGGTGGGGTCTGGCCGG - Intronic
1176290788 21:5043594-5043616 GTGAAGCTCTGAGGGCAGGTTGG + Intergenic
1176524798 21:7857961-7857983 GCTCACCTGTGGTGGCTGGTAGG - Intergenic
1178595266 21:33947766-33947788 GTGCAAGTGTGGGGGCACGTGGG - Intergenic
1178658818 21:34487974-34487996 GCTCACCTGTGGTGGCTGGTAGG - Intergenic
1179018567 21:37616799-37616821 GAGCAGCTGGGGGGAATGGTTGG + Exonic
1179502882 21:41821052-41821074 GTGCAGAAGTGAGGCCTGGTCGG - Exonic
1179635156 21:42704042-42704064 GTGCTGCCGTGAGGGCTGGCGGG - Intronic
1179866467 21:44220047-44220069 GTGAAGCTCTGAGGGCAGGTTGG - Intergenic
1180098816 21:45574805-45574827 CTGCAGCTGTGTGGGCCGGGAGG + Intergenic
1180108638 21:45637239-45637261 GTGCAGCAGTGGAGCCTGCTGGG + Intergenic
1180167689 21:46038499-46038521 GTGCAGCCGTGGGGCCTGGCCGG - Intergenic
1180175021 21:46083141-46083163 GTGCAGATGTGGTGGCAGGCGGG - Intergenic
1180296449 22:10941333-10941355 GAGTAGCTTTGGGAGCTGGTAGG + Intergenic
1181008834 22:20028502-20028524 TGGCAGCTCTGGAGGCTGGTGGG - Intronic
1181086425 22:20441673-20441695 GTGGGGCTGTGGGGGCAGCTGGG - Exonic
1181310914 22:21944263-21944285 AGGCAGCTGTGGGGGATGCTGGG + Intronic
1181319063 22:21990814-21990836 GAACAGCTCTGGGGGCTGTTGGG - Intergenic
1181356120 22:22297408-22297430 GTGCGGCTGTGGGCGGTGGGGGG - Intergenic
1181513578 22:23399569-23399591 GTGCAGAGGTGGGTGCTGGGAGG - Intergenic
1181518811 22:23433721-23433743 GTGCAGCCGTGGGGGCGGGCGGG + Intergenic
1182060198 22:27391741-27391763 GTGCTGCTCTGGGGGCGGGGGGG + Intergenic
1182078900 22:27515109-27515131 GTCCAGCTGTTAGGGCTGGAAGG - Intergenic
1182675657 22:32037103-32037125 TTGCCTCTGTGGGGGCTGGTGGG - Intergenic
1183163728 22:36132129-36132151 TGGCAGCTGGGGAGGCTGGTGGG - Intergenic
1183175506 22:36222194-36222216 GTGCAGCTGAGGGCCCTGATGGG + Intergenic
1183184505 22:36284386-36284408 GACCAGGTGTGGGCGCTGGTGGG - Exonic
1183197740 22:36364998-36365020 ATGCAGAAGTAGGGGCTGGTGGG - Intronic
1183309386 22:37101215-37101237 ATGCAGCTGGGAGGGCAGGTGGG + Intronic
1183347292 22:37314888-37314910 GTGCAAATGTGGGGGTGGGTGGG - Exonic
1183500758 22:38177385-38177407 GGGCAGCAGTGGGTGCTGATGGG - Intronic
1183663228 22:39233643-39233665 GTGCATTTATGGGGGCTGGAAGG - Intronic
1183674204 22:39290752-39290774 GCTCAGCTGGGTGGGCTGGTGGG - Intergenic
1184236442 22:43185748-43185770 GTGCTGCCGTGGAGGCTGGCTGG + Intronic
1184672669 22:46023605-46023627 GGGCAGCTGCCAGGGCTGGTGGG - Intergenic
1184686898 22:46100342-46100364 CTGCAGCCTTGGGGGCTGCTGGG + Intronic
1185060439 22:48603662-48603684 CTGCACCTCTGTGGGCTGGTTGG - Intronic
1185372596 22:50467979-50468001 GTGCAGATGCTGGGGCGGGTGGG - Intronic
1185400050 22:50610943-50610965 GCGCAGCTGTTGGGGCTGCGGGG + Exonic
949945095 3:9183856-9183878 GTACAGCTGTGGGGGCTGAGGGG - Intronic
950308986 3:11939523-11939545 GTGAATATGTGGGGGTTGGTGGG + Intergenic
950443118 3:13021356-13021378 GGACAGCTGTGGGGGGTGGTGGG - Intronic
950572684 3:13811766-13811788 GTGCATTGCTGGGGGCTGGTAGG - Intergenic
950626231 3:14249160-14249182 ATGCAGCTGCTGGGGCTGGTGGG - Intergenic
950901298 3:16500185-16500207 GTGGAGCTGTGGGAGCAGGATGG - Intronic
953411071 3:42690775-42690797 TTGGAGCTGTGGGTGCTGGGTGG + Intronic
953456084 3:43043337-43043359 GTCCAGCTGTGGGGGTGGGAAGG - Intronic
953515426 3:43586291-43586313 GTGGAGCTGTGGGTCTTGGTGGG + Intronic
953626647 3:44577676-44577698 GGCCAGCAGTGGGGGCTGGGCGG - Intronic
954106500 3:48412415-48412437 GTGTGGCTGTTGGGGCTGGGTGG - Intronic
954364582 3:50139219-50139241 GTGCAGCTGGAGGTGCTGGGTGG + Intergenic
954447241 3:50553333-50553355 GTCCAGCTGGAGGGGCTGGCAGG - Intergenic
954755862 3:52839367-52839389 CTGCAGCAGTGGGGGCTGGGAGG + Exonic
954799739 3:53180439-53180461 GTGCAGCTGTGTGTTCTGGGTGG + Intronic
956122376 3:65979096-65979118 GAGTAGCTGTGGGGGGTGGCGGG - Intronic
957215728 3:77317661-77317683 GGGCTGCTGGGGGGGCTGCTGGG + Intronic
957215756 3:77317730-77317752 GGGCTGCTGGGGGGGCTGCTGGG + Intronic
957215785 3:77317799-77317821 GGGCTGCTGGGGGGGCTGCTGGG + Intronic
957215810 3:77317855-77317877 GGGCTGCTGGGGGGGCTGCTGGG + Intronic
957298647 3:78363033-78363055 GTGCTGCTTTGGGGGATGCTAGG + Intergenic
958787450 3:98613225-98613247 GTGCTGTTGTGGGGGCAGGGTGG - Intergenic
959754114 3:109876025-109876047 TTGCAGTTGCGGGGGTTGGTAGG - Intergenic
960432543 3:117587300-117587322 GTGCAGCTGTAGGGGAAGGAAGG + Intergenic
961033078 3:123623382-123623404 GTGTAGCAATGGGGGCAGGTAGG - Intronic
961107939 3:124258101-124258123 GAGCAGCTGCGGGAGTTGGTTGG + Intronic
961264970 3:125634431-125634453 GTGGGGAGGTGGGGGCTGGTGGG + Intergenic
961378370 3:126481828-126481850 GTGCTGCACTGTGGGCTGGTGGG - Intronic
961530538 3:127537429-127537451 GTGCAGCTGTGGGTAATGGGTGG + Intergenic
961995388 3:131236640-131236662 TGGGAGCTGTGGGGGCTTGTTGG + Intronic
963189149 3:142450085-142450107 GTGGTGCTGGGTGGGCTGGTGGG + Intronic
963314303 3:143742806-143742828 GTGAAGCTGTGGGGTGTGGGAGG + Intronic
967444952 3:189555311-189555333 CTGCATCTGTGGGGGATGGGGGG + Intergenic
968282849 3:197490153-197490175 GTGAAGCTCTGGGTGCTGGCTGG + Intergenic
968458938 4:714159-714181 TCGCAGATTTGGGGGCTGGTGGG - Intronic
968489357 4:881793-881815 GTGCCGCTGCAGGCGCTGGTGGG - Intronic
968869957 4:3236761-3236783 GCACAGCAGTGGGGGGTGGTGGG - Intronic
968904522 4:3445237-3445259 GTGCATAAGTGGGGGCTGGCAGG - Intronic
968916016 4:3497382-3497404 GTGCAGTTTTGGGGCCAGGTTGG + Intronic
969340078 4:6535055-6535077 GGGCGGCAATGGGGGCTGGTGGG + Intronic
969479388 4:7439893-7439915 GTGCACCTGTGGGGGCAGGTGGG + Intronic
976264523 4:83178011-83178033 CTGCAATTCTGGGGGCTGGTGGG - Intergenic
976850828 4:89542517-89542539 CTGAATCTGTGGGGGTTGGTTGG - Intergenic
978465745 4:109006897-109006919 GGGCACCTGTGGGGGCTTGGGGG + Intronic
980915657 4:139031114-139031136 GTGGAGCTGTGGAGAGTGGTCGG + Intronic
981121492 4:141056463-141056485 GGGCAGGGGTGTGGGCTGGTGGG + Intronic
982585692 4:157234868-157234890 GTGCAGTTGTGCGGGGTGGTTGG + Intronic
982720128 4:158850619-158850641 GAGTAGCAGTGGGGGCTGGAGGG + Intronic
984695489 4:182775313-182775335 GTGCAGCTGGGGAGGCTGGAGGG + Intronic
985570609 5:642781-642803 GAGCAGCCGTGCAGGCTGGTGGG + Intronic
985995605 5:3595594-3595616 AGACAGCTGCGGGGGCTGGTCGG + Intergenic
986398390 5:7354187-7354209 GTGCAGGTGTGGGGGCAGAGTGG - Intergenic
989623833 5:43410672-43410694 CTGCCGCTGTGGGGACAGGTGGG + Intronic
989709982 5:44387296-44387318 TTGCAGGGGTGTGGGCTGGTTGG - Intronic
991570151 5:68045205-68045227 GTGCAGCTGTGGGAGGTGAAGGG - Intergenic
992022210 5:72635742-72635764 GTGGAGTTGTGGGGGGAGGTGGG - Intergenic
993920542 5:93795300-93795322 GTGCTGTTGTGGGGCATGGTGGG - Intronic
995612091 5:113921791-113921813 GTGCATTTGTGGGGGCTAGTTGG - Intergenic
997259385 5:132454399-132454421 GTCCAGGTGTTGTGGCTGGTGGG - Intronic
999490266 5:152043377-152043399 ATGCAATTGTTGGGGCTGGTGGG - Intergenic
999986025 5:157006266-157006288 GTGCAGCTGTGGGGAATGGAAGG + Intergenic
1000731037 5:164834477-164834499 GGGCATCTGTGGGGTCTGGAAGG + Intergenic
1001850822 5:174963424-174963446 ATGAAGCAGTTGGGGCTGGTTGG - Intergenic
1001984287 5:176060902-176060924 GAGCAGCGGTGGGGGCGGGTGGG + Intronic
1002159693 5:177307861-177307883 GAGCAGCTCCGGGGGCTGGCAGG - Exonic
1002233189 5:177783163-177783185 GAGCAGCGGTGGGGGCGGGTGGG - Intronic
1002262790 5:178006618-178006640 GAGCAGCGGTGGGGGCGGGTGGG + Intronic
1002605388 5:180379998-180380020 CTGGACCTGTGGGGGCGGGTGGG + Intergenic
1003209109 6:4043861-4043883 GTACTGCTCTGGGGGCTGCTTGG - Exonic
1004468353 6:15906355-15906377 GTACAGCTGTGGGGACAGGAGGG + Intergenic
1005117696 6:22356480-22356502 GAGCAGGGGTGGGGGGTGGTGGG + Intergenic
1006379148 6:33687688-33687710 GTACAGCTCAGGGGGCTGATTGG + Intronic
1006443149 6:34064484-34064506 GTGGAGTTGAGGGGGCTTGTGGG + Intronic
1006453314 6:34117795-34117817 GTGCAGCCTTGGGTGCTGGGTGG - Intronic
1007811125 6:44486366-44486388 TTGCAGGAATGGGGGCTGGTTGG - Intergenic
1008030424 6:46688216-46688238 GTGCAGCTGTGGGGGCTGGTGGG + Exonic
1009966668 6:70585510-70585532 TTACAGCTCTGGAGGCTGGTAGG - Intronic
1012522414 6:100136862-100136884 GTGCGGCTGGGTGGGCTTGTAGG - Intergenic
1013292618 6:108732329-108732351 CTCCAGCTGTTGGGGCAGGTGGG + Intergenic
1013475123 6:110499835-110499857 GGACAGATGTGGGGTCTGGTTGG + Intergenic
1013648649 6:112170988-112171010 GTGAGGCTGAGGAGGCTGGTAGG + Intronic
1014740445 6:125143119-125143141 GTGCCGCTGTGGGGTCTGCATGG - Intronic
1015877194 6:137834543-137834565 GTTGAGATGTGGGGCCTGGTGGG - Intergenic
1016387243 6:143540391-143540413 GTGGAGCTGTGGGGGAGGCTGGG - Intronic
1018887944 6:167957171-167957193 ATGAAGCAGTGGGGGCAGGTGGG - Intronic
1019342126 7:513291-513313 GTGCAGCTGGGTGGGGTGGCGGG - Intronic
1019521885 7:1464409-1464431 GTGCTGCGGCTGGGGCTGGTGGG + Intergenic
1019599749 7:1875220-1875242 GTGCAGCCGTGGGGGCGGGCAGG - Intronic
1019631413 7:2051750-2051772 GGGCAGCTGGTGGGGGTGGTGGG - Intronic
1019742447 7:2681587-2681609 GTCCAACTGTGGGGGCTGTGGGG + Intronic
1021886838 7:25147501-25147523 GGGCAGCTCTGGGGTCTGGGTGG + Intronic
1021937133 7:25642110-25642132 TTGCAGGTGTGTGGGTTGGTGGG - Intergenic
1022985610 7:35650858-35650880 GTGCAGCTGCTGGTTCTGGTAGG - Intronic
1024083582 7:45875714-45875736 GTGAAGCAGCGGGGGCTGCTTGG + Intergenic
1024229315 7:47352416-47352438 ATGCAGCTGTGGGGCCGTGTTGG - Intronic
1024897666 7:54279215-54279237 GTGGATGTGTGGGGGCTGGGTGG + Intergenic
1025106688 7:56176264-56176286 GTGCAGGTTTGGGGGGTGGGGGG + Intergenic
1025232341 7:57211068-57211090 GCCCCGCAGTGGGGGCTGGTGGG + Intergenic
1026157082 7:67835783-67835805 TTGCAGTTTTGGAGGCTGGTGGG + Intergenic
1026973397 7:74481100-74481122 GAGCAGCTGTGTTGGATGGTTGG + Intronic
1028197716 7:87926707-87926729 GTGCTGTTGTGGGGCCTGGTGGG + Intergenic
1028962263 7:96761997-96762019 GTGCTGTTGTGGGGAATGGTAGG - Intergenic
1029154069 7:98502670-98502692 GTGCCTCTGTCGGGGCAGGTGGG - Intergenic
1029275901 7:99404152-99404174 ATCCAGCTGTGGGGTCTGGGAGG - Intronic
1029283703 7:99452397-99452419 CTGCGGCAGTGGGGGCTGCTCGG - Exonic
1029503696 7:100949625-100949647 ATGCAGCTGTTGGGGCTCCTCGG + Exonic
1029510654 7:100992778-100992800 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029511143 7:100996027-100996049 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029511871 7:101000698-101000720 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029512363 7:101003947-101003969 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029512444 7:101004526-101004548 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1032011661 7:128351511-128351533 CTGCAGCTGTGCGCGCTGGCAGG - Exonic
1033707657 7:143904522-143904544 GGGAAACTGTGGGGGCAGGTGGG + Intergenic
1034116641 7:148589551-148589573 GTGGGGCTGGTGGGGCTGGTGGG - Intergenic
1035040064 7:155920747-155920769 GGGAAGCTGAGGGGGCTGGGAGG + Intergenic
1035133362 7:156675986-156676008 GTGCAGCCGTGGAGGCTGTGGGG + Intronic
1035468155 7:159093121-159093143 GTGGTCCTGCGGGGGCTGGTGGG + Intronic
1036464171 8:8980752-8980774 ATGCAGCAATGGGGACTGGTAGG - Intergenic
1036654650 8:10670423-10670445 GTGTAGGTGTGGGGGTTGGGGGG + Intronic
1037840829 8:22244592-22244614 GTGAGGCTGTGGGGGCAGCTTGG - Intergenic
1038170693 8:25128800-25128822 GTGCGGCTGTGGGGGCTGCCCGG - Intergenic
1038374090 8:27020752-27020774 GCGCATCTGTGGGGAATGGTAGG + Intergenic
1038439278 8:27560329-27560351 ATCCAGCTGTGGGTGCAGGTTGG - Intergenic
1038902838 8:31863450-31863472 GTGCAGAGGTCAGGGCTGGTGGG - Intronic
1039567981 8:38564752-38564774 GTGAGGCGGTGGGGGCCGGTGGG - Intergenic
1039890425 8:41682145-41682167 GGGCAGGTGTGGGGGCTGGAGGG - Intronic
1039970719 8:42319629-42319651 GTGGAGCTCTGTGGGCGGGTAGG + Exonic
1040079369 8:43271923-43271945 TTGCAGCTGTGGGGCCGGGTCGG - Intergenic
1040080101 8:43276195-43276217 GGGCCGCTGTGGGGGCGGGCGGG + Intergenic
1040286529 8:46103326-46103348 GTGCAGCCCTGGGGGCTTCTGGG + Intergenic
1040294770 8:46143431-46143453 GTTCAGCTTTGGGGGCTTATGGG + Intergenic
1040298229 8:46174339-46174361 GGACAGCTGTGGGGGCTTCTGGG - Intergenic
1040341332 8:46442619-46442641 GGACAGCTGTGGGGGCTTTTGGG + Intergenic
1040981506 8:53250743-53250765 GCGCAGCGCTGGGGGCTGGGCGG - Intronic
1045503040 8:102757911-102757933 GTGGAGCAGTGAGGGATGGTGGG + Intergenic
1046624899 8:116566047-116566069 GTGCAGGTGTGCTGGCTGGCTGG + Intergenic
1046962172 8:120123828-120123850 GGGCGGCGGTGGGGGCTGGAAGG + Intronic
1047010079 8:120663005-120663027 GTGGGGGTGGGGGGGCTGGTGGG + Intronic
1047218781 8:122901628-122901650 GTGCAGATCTGGGGGCTGCTTGG + Intronic
1047411555 8:124628517-124628539 CACCTGCTGTGGGGGCTGGTGGG - Intronic
1047754395 8:127907533-127907555 CTGCAGCTCTGTGGGCTGGCTGG + Intergenic
1047890579 8:129303816-129303838 GTACACCTCTGGGGGCTTGTTGG - Intergenic
1048976818 8:139677813-139677835 CTGCAGCTGTGGGGACCTGTTGG - Intronic
1049434876 8:142581889-142581911 GCTCACCTGTGGGGGCTGCTGGG - Intergenic
1049458021 8:142703968-142703990 GTGCACCTGTGCCAGCTGGTGGG - Exonic
1049474448 8:142790304-142790326 GTGCAGGTGAGGGGGCTGAGAGG - Intergenic
1049607108 8:143534850-143534872 GTGGGGCTGGGGGCGCTGGTCGG - Intronic
1049689126 8:143951076-143951098 TTGGAGCCGTGGGGCCTGGTGGG - Intronic
1049692167 8:143966203-143966225 GTGCAGCCATGGGGGCCTGTTGG - Intronic
1049709725 8:144058054-144058076 GTCCAGCTGCGGGGCCTGGAGGG + Exonic
1049774707 8:144398941-144398963 CTGCAGGTGTGTGGGCAGGTAGG - Exonic
1052560720 9:30079566-30079588 GTGCCACTGTGGGGGCTGTGGGG + Intergenic
1053102180 9:35380375-35380397 GTGCAGCTGTCGGAGCTTTTGGG + Intronic
1053249256 9:36560708-36560730 GAGCAGCCCTGAGGGCTGGTGGG + Intergenic
1053392551 9:37746176-37746198 GTGCAGCTGTGGGCTCGGGCAGG - Exonic
1054356964 9:64071188-64071210 TGGCAGCAGTGAGGGCTGGTGGG + Intergenic
1056423397 9:86452496-86452518 ATGCAGCAGTGGGAGCTGGGTGG - Intergenic
1056580327 9:87885057-87885079 GAGGAGCTGGGGGAGCTGGTGGG - Exonic
1057565602 9:96163859-96163881 GTGCAGCTGTGTGGGTTTCTAGG - Intergenic
1057903714 9:98968370-98968392 GTGGAGGTGTGTGGGCTGGGTGG + Intronic
1059777361 9:117488907-117488929 GTGCAGCTGATGGGGCAGGAAGG + Intergenic
1060225175 9:121786097-121786119 GTGCAGCTGAAGGGGCTTGGGGG - Intergenic
1060409693 9:123391967-123391989 GAGCAGCCGTGGGGGATGATGGG - Intronic
1060504115 9:124185520-124185542 GTGCTGCTGCTGTGGCTGGTGGG - Intergenic
1060545483 9:124456745-124456767 GTCCAGCCGTGTGGGCAGGTGGG - Intronic
1060960112 9:127674768-127674790 CTGCAGCTGTGAGTCCTGGTTGG + Intronic
1060962576 9:127691472-127691494 GTGCAGCTGTGGGTGGAGGCTGG + Exonic
1060974204 9:127755062-127755084 GTGCAGGTGAGGGGGCGGCTCGG - Intronic
1061587777 9:131579676-131579698 GAGCACCTGTGTGGGCTGGATGG + Intronic
1061985852 9:134129781-134129803 GTGCAGCTGGGGGCGCAGGAGGG + Intergenic
1203748508 Un_GL000218v1:57927-57949 TGGCAGCAGTGAGGGCTGGTGGG + Intergenic
1203561217 Un_KI270744v1:60093-60115 TGGCAGCAGTGAGGGCTGGTGGG - Intergenic
1189022053 X:37350802-37350824 GTGCAGGGGTGGGGGTTGGGCGG - Intronic
1192224931 X:69221628-69221650 CTGCAGCTCTGGGGGCAGGATGG - Intergenic
1192359901 X:70432839-70432861 GAGCAGGTGTGGGGGCTGGAAGG + Intronic
1192362285 X:70447455-70447477 CTGCAGCTGTGGGAGTTGGTGGG - Intronic
1193635357 X:83943713-83943735 ATGCAGGTGTGGGTGCTGGTGGG + Intergenic
1195270225 X:103221249-103221271 GCGCGGCTGTGGGGGCCGGGCGG - Intergenic
1196938448 X:120752570-120752592 CTGCAGCTGTGAGGGGTGGAGGG - Intergenic
1197571610 X:128156884-128156906 GGGCAGCTGTGCAGGGTGGTGGG + Intergenic
1197700823 X:129598213-129598235 GTGGAGAGGTGGGGGCTGGAGGG - Intergenic
1198305827 X:135382234-135382256 GTCCAGCTGTATGGGCTGGAGGG - Intergenic
1199305208 X:146259504-146259526 GTGTAGCTGTGGGGACTCTTGGG + Intergenic
1199597816 X:149522038-149522060 GTGCAGCTGTGGTGCCTGTGGGG - Intronic
1201303843 Y:12534036-12534058 GTGCAGCTGTGGCTGCTGGATGG + Intergenic