ID: 1008030426

View in Genome Browser
Species Human (GRCh38)
Location 6:46688226-46688248
Sequence GGGGGCTGGTGGGCGAGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1720
Summary {0: 1, 1: 1, 2: 13, 3: 129, 4: 1576}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008030422_1008030426 -10 Left 1008030422 6:46688213-46688235 CCGGTGCAGCTGTGGGGGCTGGT 0: 1
1: 0
2: 2
3: 31
4: 342
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030415_1008030426 1 Left 1008030415 6:46688202-46688224 CCGATGTGATCCCGGTGCAGCTG 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030420_1008030426 -9 Left 1008030420 6:46688212-46688234 CCCGGTGCAGCTGTGGGGGCTGG 0: 1
1: 0
2: 6
3: 58
4: 567
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030412_1008030426 19 Left 1008030412 6:46688184-46688206 CCTTCGTGGACGTGCATCCCGAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030414_1008030426 2 Left 1008030414 6:46688201-46688223 CCCGATGTGATCCCGGTGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 74
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576
1008030411_1008030426 30 Left 1008030411 6:46688173-46688195 CCTGCGGGTGTCCTTCGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG 0: 1
1: 1
2: 13
3: 129
4: 1576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008030426 Original CRISPR GGGGGCTGGTGGGCGAGCGG CGG Exonic
900119478 1:1042340-1042362 GGGGGCTGGTGAGGCAGAGGCGG + Intronic
900309354 1:2025843-2025865 GGGAGCTGGCGGGCGGGCGGAGG + Intronic
900368163 1:2319940-2319962 GGGGGCAGAGGGGCGGGCGGGGG - Intergenic
900521239 1:3106415-3106437 GGGGGCTGGAGGGCCAGAAGCGG + Intronic
900603609 1:3514361-3514383 GGGGGCTGAGGGGCGAGGGTAGG - Intronic
901044201 1:6385811-6385833 GGGGGCTGGTGGGGGAGGGGCGG - Exonic
901054916 1:6444597-6444619 GGGTGCTGGTAGGCGAGCTGAGG - Exonic
901065128 1:6490719-6490741 GGTGGCTGGAGGCCGGGCGGTGG + Intronic
901086626 1:6614898-6614920 GCGGGCGGGTGGGGGAGGGGAGG + Intronic
901319431 1:8330501-8330523 GGGGGCTGGGCGGCGAGATGGGG - Exonic
901322572 1:8348669-8348691 GGGGGCTTGTCGGGGAGTGGGGG + Intergenic
901631732 1:10651331-10651353 GGGGGCTGGGGTGGGGGCGGGGG + Intronic
901636446 1:10672473-10672495 GGGGGCGGGCCGGCGGGCGGAGG - Intronic
901730100 1:11273145-11273167 GTGGGCTGGAGGGCGGGAGGGGG - Intergenic
901774000 1:11546674-11546696 AGGGGCTGGTGGGCCATGGGAGG + Intergenic
902479441 1:16704006-16704028 GGGTGCTGGTGGGCGAGCTGAGG + Intergenic
902513318 1:16977559-16977581 GAGGGCTGGTGGGCTGGAGGTGG - Intronic
902543402 1:17170481-17170503 GGGGGTTGGGGGGCAAGGGGAGG - Intergenic
902893341 1:19461091-19461113 GGGGGCGGGGGGGGGAGGGGCGG + Intronic
903103510 1:21053605-21053627 CGGGGCGGGTGGCCGGGCGGGGG - Intronic
903194971 1:21679169-21679191 GGGGGGTGGTGGGTGGGAGGGGG - Exonic
903215617 1:21841966-21841988 GTGGGCAGGTGGGCAAGCTGGGG - Intronic
903622474 1:24707833-24707855 GGGGGGTGGAGGGGGAGGGGGGG + Intergenic
903625938 1:24730294-24730316 GGGGGGAGGTGGGGAAGCGGAGG + Intergenic
903724713 1:25431548-25431570 GGGGGCTCGGGGGCCAGCGGCGG - Intronic
903758901 1:25684177-25684199 GGTGGCTGGGGGGCTGGCGGGGG - Intronic
904033638 1:27547953-27547975 GTGGGTGGGTGGGCCAGCGGTGG + Exonic
904181363 1:28668882-28668904 GGGGGCGGGGGGGCGGGCGCGGG + Intronic
904257023 1:29260389-29260411 GTGGGCTGATGGGCGAGGGCGGG + Intronic
904626976 1:31811906-31811928 GGGGGCTGGTTTGAGTGCGGTGG - Intronic
904825620 1:33272028-33272050 TGAGGCTGGTGGGAGAGAGGGGG + Intronic
905104731 1:35557616-35557638 GGGGGCTGGGGCTCGAGCGAAGG - Intronic
905173838 1:36124626-36124648 GGGGGCAGGAGTGAGAGCGGGGG + Intronic
905242509 1:36589950-36589972 GGGGGCTGGTGGGAGAGGGTTGG + Intergenic
905395397 1:37663397-37663419 GGTGGCTGGTGGGCAAGCGGAGG + Intergenic
905398625 1:37685196-37685218 GGGGGGGGGTGGGCGGGGGGTGG + Intronic
905399871 1:37693217-37693239 GGGGGGTGGTTGGGGGGCGGCGG + Intronic
905569402 1:38991654-38991676 GGGGGGTGGTGGGGGAGGGTTGG + Intronic
905912135 1:41662322-41662344 GCGGGCTGGCGGGCGGGCGCCGG + Intronic
906083147 1:43107526-43107548 GGGAGGTGGTGGGGGGGCGGGGG + Intergenic
906140435 1:43531100-43531122 GGGGGCTGGTGGGGGGCCGGGGG - Intronic
906271353 1:44481536-44481558 GGGAGCTGGAGGTTGAGCGGGGG + Intronic
906615833 1:47232245-47232267 CGGGGCGGGCGGGGGAGCGGGGG - Intergenic
906727494 1:48054733-48054755 GGGAGCTGGGGGTCGAGGGGTGG + Intergenic
906770233 1:48476766-48476788 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
906806090 1:48780169-48780191 GGGGGCTGGGGGACTAGGGGAGG - Intronic
906856588 1:49313016-49313038 GGGGGTTGGGGGGCTAGAGGAGG - Intronic
906891018 1:49715108-49715130 TGGGGCTGGGGGGCTAGGGGAGG - Intronic
907011783 1:50969491-50969513 GGAGGCTGCCGGGCGTGCGGCGG - Exonic
907341536 1:53739149-53739171 GGGGGCTGCTGCGCCAGTGGAGG - Intergenic
907613610 1:55900066-55900088 GGAGGCTGGAGGGCTAGGGGAGG + Intergenic
907684392 1:56595774-56595796 GGGGGTTGGGGGGCTAGGGGAGG - Intronic
907822015 1:57979412-57979434 GGGGGATGGGGGGCTAGGGGAGG + Intronic
907829505 1:58051190-58051212 GGGGGCTGGGGGGCTGGGGGAGG - Intronic
908119828 1:60975637-60975659 GGGGCCGGGTGGGCGGGTGGAGG - Intronic
908283464 1:62567546-62567568 GGGGGGTGGAGGGCTAGGGGAGG + Intronic
908446183 1:64201344-64201366 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
908838439 1:68253024-68253046 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
908958635 1:69668287-69668309 GGGGGATGGGGGGCTAGGGGAGG - Intronic
909330093 1:74399569-74399591 TGGGGCCGGGGGGCGGGCGGTGG + Intronic
909416221 1:75408707-75408729 GGGGGCTGGGGGGCTAGGGGAGG + Intronic
909432168 1:75601382-75601404 GGGGGCTGGGGGGCTAGAGGAGG + Intronic
909675964 1:78239339-78239361 GGGGGGTCGAGGGCGAGGGGAGG + Intergenic
909850626 1:80458844-80458866 GGGGCCTGTTGGGGGATCGGGGG - Intergenic
910177748 1:84449078-84449100 AGGGGCTGGGGGGCTAGGGGAGG + Intergenic
910775245 1:90868175-90868197 GGGGGCTGGGGGTTGAGGGGAGG + Intergenic
910799743 1:91133125-91133147 GGGGGCTGGGGGGTTAGGGGAGG + Intergenic
910889083 1:91998355-91998377 GGGGGATGGGGGGCTAGCAGAGG + Intronic
911403464 1:97406544-97406566 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
912221779 1:107686028-107686050 GGGGGGTGGGGGGGGAGGGGGGG + Intronic
912245565 1:107958769-107958791 GGGGGTTGGAGGGCAAGGGGAGG - Intronic
912471210 1:109908202-109908224 TGGGGCTGGGGGGCTTGCGGAGG + Intergenic
912574888 1:110659933-110659955 GGGGGCTGGGGGGCTAGGGAAGG + Intergenic
912676479 1:111686123-111686145 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
912872254 1:113319023-113319045 GGGGGCTGGGGGGCTGGGGGAGG + Intergenic
912881961 1:113424195-113424217 GGGGGCGGGGGGGCAGGCGGCGG - Intronic
913305803 1:117429459-117429481 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
913305982 1:117429833-117429855 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
913506375 1:119519855-119519877 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
913611346 1:120512566-120512588 AGGTGCTGCTGGGAGAGCGGTGG + Intergenic
914402057 1:147330567-147330589 GGGGGTTGGGAGGCGAGGGGAGG + Intergenic
914405067 1:147362410-147362432 GGGGGTTGGAGGGCTAGGGGAGG + Intergenic
914579846 1:149009673-149009695 AGGTGCTGCTGGGAGAGCGGTGG - Exonic
914728517 1:150349883-150349905 GGGGGCGGGGGGGCGGGGGGCGG + Intronic
914764904 1:150629379-150629401 GGGTGCGGGCGGGCGAGCTGGGG - Intronic
914841838 1:151254895-151254917 AGGGGCTCATGGGCGAGAGGCGG + Intronic
914869075 1:151458675-151458697 GGGGGCGGGGGCGCGGGCGGTGG - Intronic
914878529 1:151530058-151530080 GGTGGATGGTGGGGAAGCGGTGG + Exonic
915213294 1:154325487-154325509 GGGGGCCGGGGGGCGGGAGGGGG - Intergenic
915248379 1:154571789-154571811 TGTGCGTGGTGGGCGAGCGGTGG - Exonic
915411019 1:155701015-155701037 GGGGGCGGCTGGCCGGGCGGGGG - Intronic
915420641 1:155778707-155778729 GGGGCCTGTTGGGGGAGCGGGGG - Intronic
915557493 1:156668667-156668689 GGGGGGTGGCGGGGGAGAGGAGG - Intergenic
915579900 1:156807272-156807294 GGGGGCTGGTGGGGCAGGGGAGG + Exonic
915798380 1:158761807-158761829 GTGGGGTGGTGGGAGAGGGGAGG - Intergenic
915833061 1:159148871-159148893 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
915887797 1:159741564-159741586 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
915935430 1:160087739-160087761 GGGGGCGGGTGGGGAAGCTGGGG + Exonic
915972689 1:160365557-160365579 GGGGGCAGGTGGGGGAGCTTGGG + Intergenic
916037879 1:160936798-160936820 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
916277336 1:163008975-163008997 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
916645279 1:166778712-166778734 GGGGGGTGGGGGGTTAGCGGAGG - Intergenic
916928576 1:169550272-169550294 GGGGGGTGGGGGGCGGGGGGAGG - Intronic
917070858 1:171149208-171149230 GGGGGATGGAGGGCTAGGGGAGG - Intronic
917400611 1:174645380-174645402 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
917747618 1:178026128-178026150 GGAAGCTGGTGGGCGAGGGCGGG - Intergenic
917887890 1:179405065-179405087 GGGGGTTGGGGGGCAAGGGGAGG - Intronic
918107230 1:181425524-181425546 GGGGTCGGGGGGGGGAGCGGGGG - Intronic
918156780 1:181855065-181855087 GGGGGCTGGGGGGTGAGGGGAGG + Intergenic
918612270 1:186506545-186506567 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
918766165 1:188486495-188486517 AGGGGGTGGTGGGCAAGGGGAGG + Intergenic
918788515 1:188796073-188796095 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
918788732 1:188798379-188798401 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
919082340 1:192881377-192881399 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
919419606 1:197354812-197354834 GGGGGGGGGTGGGGGGGCGGGGG - Intronic
919419619 1:197354829-197354851 GGGGGGGGGTGGGCGGGGGGGGG - Intronic
920327783 1:205180255-205180277 GGGGGCTGGGGGGAAAGGGGAGG - Intronic
920554864 1:206897390-206897412 GGGGGCTGATGGGGGAGGGGTGG - Intergenic
921044088 1:211460874-211460896 CGGGGCTGCTGGCCGGGCGGGGG - Intergenic
921180977 1:212630889-212630911 AGGGGGTGGGGGGCGAGCAGTGG + Intergenic
921399963 1:214711172-214711194 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
921957254 1:220997761-220997783 GGGGGGTGGGGGGCGGGGGGCGG - Intergenic
922196177 1:223362938-223362960 GGGGGCGGGGGGGGGAGGGGTGG - Intronic
922335526 1:224616074-224616096 CAGGGCTGGAGGCCGAGCGGAGG - Intronic
922644922 1:227276461-227276483 CGGGGCGGCTGGCCGAGCGGGGG - Intronic
922716618 1:227878135-227878157 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
922936547 1:229427169-229427191 GGGGGCTGCTGGCGGAGAGGAGG - Intergenic
922981260 1:229829031-229829053 GGGGGGTGGGGGACGAGGGGAGG - Intergenic
923007947 1:230067188-230067210 GGGGGCCGGGGGAGGAGCGGAGG - Exonic
923055900 1:230425937-230425959 GGGGGCGGGCGCGCGGGCGGCGG - Intergenic
923125626 1:231032369-231032391 GGGGGCTGGCGGGGGCGGGGTGG - Intronic
923237660 1:232049773-232049795 GGGGGCAGGTGGGAGTGAGGGGG + Intergenic
923400758 1:233614031-233614053 CGGGGCGGGCGGGCGCGCGGGGG + Exonic
923422293 1:233828229-233828251 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
923684159 1:236142438-236142460 CGGGGCCGGTCGGCGCGCGGGGG + Intergenic
923711054 1:236387336-236387358 GGGGGCGGCTGGCCGGGCGGGGG - Intronic
923830576 1:237550973-237550995 GAGGGCTGGTGGGCTAGGGGAGG - Intronic
924179420 1:241425122-241425144 AGGGGATGGTGGGCTAGAGGAGG - Intergenic
924265018 1:242273068-242273090 GGGGGATGGGGGGCAAGGGGAGG - Intronic
924613597 1:245593313-245593335 GGGGGCTGGGGAGCTAGGGGAGG - Intronic
924779981 1:247138465-247138487 GGGGGTTGGGGGGTGAGGGGAGG + Intronic
924885838 1:248215513-248215535 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
1063704753 10:8420022-8420044 GGGGGTTAGTGGGCTAGGGGAGG + Intergenic
1063733502 10:8725368-8725390 AGGGTCTGATGGGCGAGCTGAGG - Intergenic
1064046166 10:12017884-12017906 GGGGGTTGGAGGGCCAGGGGAGG - Intronic
1064448701 10:15421879-15421901 GGGGGGTGGGGGGCTAGTGGAGG - Intergenic
1064575099 10:16737013-16737035 GGGGGATGGTGGGGGAGGGGAGG + Intronic
1064733760 10:18359745-18359767 GGGGGGTGGGGGGCTAGAGGAGG - Intronic
1065100390 10:22325624-22325646 GCGGGCGGGCGGGCGGGCGGGGG - Intronic
1065484984 10:26228793-26228815 GGGGGCTGGTGGGGGTGGGGTGG - Intronic
1065594369 10:27296567-27296589 TGGGGCGGGTGGCCGGGCGGGGG + Intergenic
1066005753 10:31144730-31144752 GGGGGGTGGGGGGCGAGGGGAGG - Intergenic
1066172299 10:32862415-32862437 GGGGGTTGGGGGGCTAGGGGAGG + Intronic
1066382185 10:34911300-34911322 GGGGGCGGGTGGGCGGGGGTGGG - Intergenic
1066719791 10:38325422-38325444 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1067101853 10:43339715-43339737 AGGGGCTGGTGGGGCAGGGGAGG + Intergenic
1067235820 10:44448383-44448405 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1067328859 10:45295389-45295411 GGAGGGTGGTGGGCAAGGGGAGG - Intergenic
1067471517 10:46541574-46541596 GGGGAGGGGTGGGCGAGGGGTGG + Intergenic
1067800268 10:49353794-49353816 GGGGGCTGGAGGGTGTGGGGAGG - Intergenic
1068195207 10:53707262-53707284 AGGGGCTGGGGGGCTAGGGGAGG - Intergenic
1068274868 10:54781307-54781329 GGGGGATGGTGGGCTAGGGGAGG - Intronic
1068289694 10:54987007-54987029 GGGGGCTGGGGGGCGAGTGCAGG - Intronic
1068718399 10:60214503-60214525 GGGGGCTGGGGGGTGAGGGGAGG - Intronic
1068834116 10:61533532-61533554 GGGGGGTGGGGGGTGAGGGGAGG - Intergenic
1069227557 10:65962698-65962720 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1069365811 10:67692080-67692102 GGGGGCAGCTGGCCGGGCGGGGG - Intronic
1069650557 10:70044120-70044142 GGGGGATGGGGGGCGAGGGGAGG - Intergenic
1069889195 10:71642717-71642739 GGGAGCTGGTGGCAGAGTGGGGG - Intronic
1070147519 10:73785776-73785798 GGGGCCTGAGGGGCGAGCCGGGG - Exonic
1070823853 10:79379726-79379748 GGGGGCTGGTGGGAGAGAGGTGG + Intergenic
1070831741 10:79422129-79422151 GGGGTATGGTGGGCCAGCTGGGG - Intronic
1070959325 10:80487824-80487846 AGGGTCTGGTGGGTGAGTGGTGG + Intronic
1071000277 10:80823810-80823832 AGGGGCTGGGGGGCAAGCAGAGG + Intergenic
1071027920 10:81137940-81137962 GGGGCCTGTTGGGGGAGAGGGGG - Intergenic
1071066189 10:81639103-81639125 GGGGGCTGGGGGGCTAGGGGAGG - Intergenic
1071108325 10:82124564-82124586 GGGGGGTGGAGGGCAAGAGGAGG + Intronic
1071163611 10:82779865-82779887 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1071273009 10:84026207-84026229 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1071868674 10:89767323-89767345 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1071933300 10:90498128-90498150 GGGGGCTGGTGGTCTAATGGAGG - Intergenic
1071956287 10:90763608-90763630 GGGGGATGGGGGGCAAGAGGAGG - Intronic
1072716039 10:97753202-97753224 CTGGGCTGGTGGGGGAGTGGGGG + Intronic
1072913685 10:99524006-99524028 GGGGGCTGGGTGGGGAGGGGAGG + Intergenic
1072970051 10:100009785-100009807 GGGGGCCGGGCGGGGAGCGGGGG - Intronic
1073232143 10:101981059-101981081 GGGGGTTGGGGGGTGAGGGGAGG + Intronic
1073417232 10:103394748-103394770 TGGAGCTGGTGGGGGGGCGGGGG - Intronic
1073595862 10:104799543-104799565 GGGGGTTGGGGGGCTAGGGGAGG + Intronic
1073637481 10:105214558-105214580 GGCGGCTGGTGGCAGAGCAGGGG + Exonic
1073984678 10:109194520-109194542 GGGGGGTGGGGGACTAGCGGAGG - Intergenic
1074015755 10:109532040-109532062 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1074048209 10:109858531-109858553 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1074216144 10:111386266-111386288 GGGGGCTGGGGGGCTAGGGGAGG - Intergenic
1074306342 10:112281973-112281995 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1074730992 10:116375437-116375459 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1074938060 10:118206136-118206158 GGGGGCTGGTGGCGGGGCAGAGG + Intergenic
1075032168 10:119030615-119030637 GGCGGCGGGCGGGCGGGCGGCGG - Exonic
1075426743 10:122347616-122347638 TGGGGCTGGTGGTCGGGCTGAGG - Intergenic
1075683874 10:124350592-124350614 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1076040446 10:127243388-127243410 GGGTGCTGGTGGTGGAGCAGGGG - Intronic
1076136130 10:128046615-128046637 GGGGGCTGTGTGGCCAGCGGGGG + Intronic
1076140556 10:128075433-128075455 GGGGGGTGGAGGGTGAGGGGAGG - Intronic
1076314624 10:129531770-129531792 GGGGGCTGGTGGGGGTGGGGGGG + Intronic
1076595150 10:131620515-131620537 GGGGGTGTGTGGGCGAGCAGGGG + Intergenic
1076683547 10:132186996-132187018 GCGGGCGGGCGGGCGGGCGGGGG - Exonic
1076787217 10:132757272-132757294 GTGAGCTGGTGAGCGGGCGGGGG - Intronic
1076792877 10:132786097-132786119 CGGGGCGGGCGGGCGGGCGGCGG + Intergenic
1076810788 10:132885437-132885459 GGGGTCTCGGGGGTGAGCGGGGG + Intronic
1076828788 10:132983733-132983755 GGGGGCTGGAGGGCGGGAGAAGG - Intergenic
1076859502 10:133133938-133133960 GAGGGCTGCTGGGTGAGCTGGGG + Intergenic
1076874171 10:133207891-133207913 GGGGGCTGGTGGGGCGGCCGGGG - Intronic
1077095190 11:796148-796170 GCGGGCAGGTGGCGGAGCGGGGG - Exonic
1077233271 11:1468186-1468208 GGGGCCTGGCTGCCGAGCGGAGG - Intergenic
1077333953 11:1995087-1995109 GGGGGCTGGGGGGCATGGGGAGG - Intergenic
1077360673 11:2139044-2139066 GAGGGCTGGAGGGGGAGCGCGGG + Intronic
1077360874 11:2139597-2139619 AGGGGCTGGGGGGTGCGCGGGGG + Intronic
1077478910 11:2803793-2803815 GGGAGCTGGTGGGCCCGAGGTGG - Intronic
1077732041 11:4741646-4741668 GGGGGTGGGTGGGGGAGGGGAGG + Intronic
1078031238 11:7753416-7753438 GGGGGCAGGGGGGCAAGGGGAGG + Intergenic
1078312944 11:10264726-10264748 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1078382021 11:10851001-10851023 GGGGGATGGGGGGCGGGCGGGGG + Intronic
1078458271 11:11492745-11492767 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1078560955 11:12371934-12371956 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1078621163 11:12909523-12909545 GCGGGGTGGGGGGCGAGGGGAGG + Intronic
1079396835 11:20071097-20071119 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1080023981 11:27594641-27594663 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1080164355 11:29219140-29219162 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1080331264 11:31142106-31142128 GGTGGCTGCTGGGAGAGTGGGGG + Intronic
1080734950 11:35004760-35004782 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1080747858 11:35125140-35125162 GGGGGCTGGGGGGTGAGGGGAGG + Intergenic
1080844279 11:36013449-36013471 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1080919876 11:36698391-36698413 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1081364892 11:42222497-42222519 GGGGGCTGGGGGACAAGTGGAGG + Intergenic
1081627448 11:44663961-44663983 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1081812843 11:45922990-45923012 CGAGCCTGGCGGGCGAGCGGGGG + Exonic
1081832154 11:46122360-46122382 GGGGGCGGGGTGGCGAGGGGAGG - Intergenic
1081910342 11:46696217-46696239 GGGGGCAGGAGGGCACGCGGTGG - Intronic
1082108739 11:48248749-48248771 GGGGGGTGGGGGGTGAGGGGAGG - Intergenic
1082637794 11:55617678-55617700 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1082726081 11:56738367-56738389 GGGGGTTGGAGGGCAAGGGGAGG - Intergenic
1082776404 11:57248121-57248143 GGGGGGTGGAGGGCAAGGGGTGG + Intergenic
1082844686 11:57716640-57716662 CGGGGCGGCTGGCCGAGCGGGGG + Intronic
1083011744 11:59407879-59407901 GTGGGCTGGGGGGAGAGGGGAGG + Intergenic
1083102941 11:60329135-60329157 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1083118934 11:60491793-60491815 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1083320431 11:61842647-61842669 GGGGGCTGGTGGGCCATGAGTGG - Intronic
1083505327 11:63151646-63151668 GGTGGGTGGTGGGCTAGGGGAGG - Intronic
1083764384 11:64835094-64835116 AGCGGCTGGAGGGTGAGCGGCGG - Exonic
1083780467 11:64914897-64914919 GGGGGCTGGTGGGGGGGCCGTGG + Intronic
1083812262 11:65112464-65112486 GGGAGCTGGGGGGCTAGGGGCGG + Intronic
1083821365 11:65173040-65173062 GGGGGCTGGTGTGGGAGCTTGGG + Intronic
1083930036 11:65836898-65836920 GGGGGCTGGGGGGTAAGGGGAGG + Intronic
1084031778 11:66485297-66485319 GGGGGCTGGTGGGGTAGAGATGG + Intronic
1084044924 11:66562973-66562995 AGGGGCTGGTGGGCTAGGGCAGG + Intronic
1084195900 11:67523482-67523504 GGGGGCGGGTGGGCAGGCGGGGG + Intergenic
1084365194 11:68693105-68693127 GGAGGCTGGGGGGCGGGCTGAGG - Intergenic
1084650285 11:70485539-70485561 GGGGGCGGGGGAGCGGGCGGGGG + Intronic
1084722677 11:70917854-70917876 GGGGGGTGGAGGGTGAGAGGAGG + Intronic
1085446517 11:76604430-76604452 GGGAGCAGGTGGGAGAGAGGCGG - Intergenic
1085490331 11:76910122-76910144 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1086063541 11:82724038-82724060 GAGGGAGGGTGGGCGGGCGGGGG - Intergenic
1086122399 11:83316486-83316508 TGGGGCTGCTGGCCGGGCGGGGG + Intergenic
1086161890 11:83731279-83731301 AGGGGCTGGGGGGAGAGGGGAGG - Intronic
1086307936 11:85502266-85502288 GTGGGGTGGTGGGCTAGGGGAGG + Intronic
1086871379 11:92041371-92041393 AGGGGGTGATGGGCAAGCGGAGG + Intergenic
1086889873 11:92245340-92245362 GGGGGGTGGCGGGCTAGGGGAGG + Intergenic
1086974271 11:93114686-93114708 GGTGGCTGGTGGGTGGGGGGCGG - Intergenic
1087063350 11:94004588-94004610 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1087138114 11:94740510-94740532 GGGGGCCCGAGGGCGCGCGGCGG - Intronic
1087686246 11:101268974-101268996 TGGGGGTGGTGGGCAAGGGGAGG - Intergenic
1087941549 11:104102927-104102949 GTGGGCTGGGGGGAGAGGGGAGG + Intronic
1087981139 11:104616207-104616229 GGGGGGTGGGGGGCTAGAGGAGG - Intergenic
1088030088 11:105237961-105237983 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1088153617 11:106777679-106777701 GGGGGGTGGGGGGCTAGGGGTGG + Intronic
1088428940 11:109736009-109736031 GGGGGCTGGGGGGCAACAGGAGG + Intergenic
1088760281 11:112922760-112922782 GGGGGCTGGAGGGAGAGGAGAGG + Intergenic
1088959021 11:114642415-114642437 GGGGGCTGGGGGGAGTGGGGAGG - Intergenic
1089123924 11:116162751-116162773 GGGGGCTGGGGTCTGAGCGGAGG - Intergenic
1089323571 11:117642512-117642534 GGTGGCTGCTGGGAGAGCAGGGG + Intronic
1089661165 11:119986461-119986483 GTAGGCTGGTGGGCAAGAGGAGG + Intergenic
1089730045 11:120513666-120513688 GGAGGCTGGTGGGCAAGCCCGGG - Intronic
1089926332 11:122262275-122262297 GTGGGGTGGTGGGAGAGGGGAGG - Intergenic
1089982867 11:122786984-122787006 GGGCGGTGGGGGGGGAGCGGGGG - Intronic
1090225854 11:125071838-125071860 GAGGGCTTGTGGGGGAGGGGGGG + Intronic
1090323062 11:125863403-125863425 GGCGGCTGGCGGGCGGGCGGAGG - Intergenic
1090423154 11:126589422-126589444 GCCTGCTGGTGGGCGGGCGGAGG - Intronic
1090608631 11:128450815-128450837 AGGGGGTGGTGGGCTAGGGGAGG + Intergenic
1090675409 11:128989702-128989724 GGGGGTTGGGGGGCTAGGGGAGG - Intronic
1090721030 11:129473336-129473358 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1090780359 11:130002138-130002160 GGGGGCTGGGGGCCGGGCGCCGG - Intronic
1091035103 11:132225853-132225875 GGGGGTTGGGGGGCTAGAGGAGG - Intronic
1091142345 11:133245967-133245989 GGGGGCTGGGGGTCAAGGGGAGG + Intronic
1091238458 11:134037001-134037023 CGGGGCTGGGGGGCGCGGGGAGG - Intergenic
1091308094 11:134553407-134553429 GGGGGCTGGTGGGCGTCAGGGGG + Intergenic
1202816936 11_KI270721v1_random:50269-50291 GGGGGCTGGGGGGCATGGGGAGG - Intergenic
1091388763 12:112304-112326 GGGGGATGGTGGGGAAGTGGGGG + Intronic
1091621781 12:2094436-2094458 GGGTGGAGGTGGGCGAGCAGGGG + Intronic
1091688530 12:2580483-2580505 GGAGGCAGGTGGGCCAGAGGGGG + Intronic
1091793663 12:3285427-3285449 GGGGGCTGGTGGGAGCACTGTGG - Exonic
1092193229 12:6534729-6534751 GAGGCCTGGTGGGGGAGGGGAGG + Intronic
1092246560 12:6867406-6867428 GGCGGCAGGAGGGCGGGCGGGGG + Exonic
1092496887 12:9005202-9005224 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1092624946 12:10316925-10316947 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1092799033 12:12144912-12144934 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1092861616 12:12724411-12724433 GGGGGCACGTTGCCGAGCGGGGG - Intergenic
1093069822 12:14697204-14697226 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1093165811 12:15803582-15803604 GGGGGTTGATGGGAGAGGGGTGG + Intronic
1093402815 12:18766839-18766861 GGGGGGTGGGGGGCTAGAGGAGG + Intergenic
1093427988 12:19051129-19051151 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1093502853 12:19832287-19832309 GGGGGATGGGGGGCAAGGGGAGG - Intergenic
1093716176 12:22384495-22384517 GGGGGCTAGGGGGCGACGGGAGG + Intronic
1093786304 12:23195539-23195561 GGGTGCTGGTGGGAGAGATGAGG + Intergenic
1093786329 12:23195807-23195829 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1093905264 12:24684014-24684036 GAGGGCTGGCGGGCTAGGGGAGG - Intergenic
1093977275 12:25437221-25437243 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1094344422 12:29451015-29451037 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1094379531 12:29828330-29828352 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1094789808 12:33898954-33898976 GGGGGTTGGGGGGCTAGCGGAGG + Intergenic
1094818506 12:34207978-34208000 GGAGGCTGGTGGGGCAACGGTGG + Intergenic
1095356945 12:41285850-41285872 AGGGGGTGGTGGGCAAGGGGAGG + Intronic
1095528882 12:43161286-43161308 GGTGGCTGGTGGTAGAGCGGTGG - Intergenic
1095846849 12:46755597-46755619 GTGGGGTGGTGGGAGAGGGGAGG + Intergenic
1095917604 12:47495965-47495987 GGGGGCGGGTGGGGGTGCAGGGG - Intergenic
1095938057 12:47706043-47706065 GGGGGCTTGTGGGGAAGCGCAGG - Exonic
1096109475 12:49020480-49020502 GGGGGGTGGGGGGAGAGGGGAGG + Exonic
1096121988 12:49094320-49094342 GGGCGCCAGTGGGCCAGCGGAGG - Exonic
1096235866 12:49925879-49925901 GGGAGCTGGGGGGTGAGGGGTGG + Intergenic
1096328472 12:50687731-50687753 GAGGGCTGGGGGGCAAGGGGAGG + Intronic
1096424908 12:51492832-51492854 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1096459019 12:51811795-51811817 GGAGGCTGGGGGCCGAGGGGAGG - Exonic
1096710479 12:53452164-53452186 GAGGGCGGGCGGGCGGGCGGAGG - Exonic
1096784418 12:54009066-54009088 CGGGGCTGGGGCGCGGGCGGCGG - Intronic
1097041382 12:56158146-56158168 GGGGGGAGGTGGGGGGGCGGGGG - Exonic
1097079752 12:56421396-56421418 TGGGGCTGGTGGCTGAGCGGCGG - Exonic
1097245339 12:57604885-57604907 GGGGCCCGGGGGGCGCGCGGTGG - Intronic
1097310946 12:58118396-58118418 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1097830607 12:64221092-64221114 GGGGGCTGGTTAGGGAACGGGGG + Intronic
1098160990 12:67648514-67648536 GGGCGGAGGAGGGCGAGCGGAGG + Intronic
1098510352 12:71306050-71306072 GTGGGGTGGGGGGCGAGGGGAGG - Intronic
1098780705 12:74682375-74682397 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1099031389 12:77529737-77529759 GGGGGCTGGGGGGCCAGGGAAGG + Intergenic
1099255341 12:80307717-80307739 CGGGGCGGCTGGCCGAGCGGGGG + Intronic
1099483352 12:83196208-83196230 GGAGGCTGGTGGGCGGGGGGGGG + Intergenic
1099575045 12:84368183-84368205 GGGGGCTGGGGGCCAAGGGGAGG + Intergenic
1099687648 12:85909834-85909856 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1099699693 12:86067556-86067578 GGGGGGTGGGGGGATAGCGGAGG + Intronic
1099749713 12:86757215-86757237 GGGGGTTGGGGGGCTAGGGGAGG + Intronic
1100045250 12:90372394-90372416 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1100402817 12:94246981-94247003 GGAGGCTGGTGGGTTAGGGGAGG - Intronic
1100554396 12:95678186-95678208 GGGGTGTGGGGGGCGAGGGGAGG + Intronic
1100567358 12:95810158-95810180 GGGGGCTTGGGGGCAAGGGGAGG - Intronic
1100611731 12:96195868-96195890 GGGGGCTGGCGGGGAAGGGGCGG - Intronic
1100800012 12:98221300-98221322 GGGGGGTGGGGGGCGGGCGGCGG - Intergenic
1100873892 12:98942241-98942263 GGTGGGAGGTGGGGGAGCGGGGG + Intronic
1101056802 12:100925494-100925516 GGGGGGTGGGGGGCTAGAGGAGG + Intronic
1101067775 12:101040746-101040768 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1101612161 12:106302409-106302431 GGGGCCGAGTGGGGGAGCGGGGG - Intronic
1101790697 12:107924227-107924249 GGGGCATGGGGGGCGAGGGGAGG + Intergenic
1101821010 12:108184299-108184321 GGGGGGTGGTGGTGGAGAGGTGG - Intronic
1101885289 12:108656393-108656415 TGGGGCTGCTGGCCGGGCGGGGG - Intronic
1101911560 12:108863904-108863926 AGGGGGTGGTGGGCCAGGGGAGG - Intronic
1101959105 12:109234799-109234821 GGGGGGTGGGGGCCGAGGGGAGG + Intronic
1102174689 12:110867151-110867173 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
1102247713 12:111365751-111365773 GGGGCCTGTTGGGGGATCGGGGG + Intronic
1102293823 12:111722991-111723013 CGGGGCGGGTGGCCGGGCGGGGG + Intronic
1102370803 12:112381597-112381619 GGGGGCCCGTGGGGGAGGGGAGG + Intronic
1102501885 12:113358736-113358758 GGGGGCCGCTGGGCGCGCGATGG + Exonic
1102543351 12:113638043-113638065 GGGGAGTGGGGGGCGAGCCGGGG - Intergenic
1102571280 12:113828520-113828542 GGGCACAGGTGGGCGAGGGGAGG + Intronic
1102587100 12:113931256-113931278 GGGGCCTTGTGGGAGAGAGGGGG - Intronic
1102753673 12:115319228-115319250 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1102817219 12:115876311-115876333 GGGGGATGGGGGGCAAGCGGAGG + Intergenic
1103168607 12:118793264-118793286 GGGGGTTGGGGGGCAAGGGGAGG - Intergenic
1103480392 12:121246815-121246837 GGGGGCTGGGGGGCTGGGGGAGG - Intronic
1103591501 12:121994295-121994317 CGGGGCGGCTGGCCGAGCGGGGG - Intronic
1104047356 12:125172788-125172810 AGGGGCTGGTGGGCACTCGGTGG + Intergenic
1104100543 12:125604445-125604467 GGGGGGTTGTGGGGGAGGGGAGG + Intronic
1104205948 12:126638631-126638653 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1104360551 12:128129136-128129158 GGGGGCGGGGGGGCGGGCGGGGG - Intergenic
1104485636 12:129149226-129149248 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1104542098 12:129675372-129675394 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1104692726 12:130839005-130839027 GGCGTCTGGAGGGCGGGCGGGGG - Intronic
1104841419 12:131827953-131827975 GGGGACTGGAGGGCGAGGGCGGG - Intergenic
1104864178 12:131942947-131942969 GGGAGTTGGGGGGCCAGCGGTGG + Intronic
1105040257 12:132955980-132956002 GGGGGCTGTAGGGCGGGCGGCGG - Intronic
1105405223 13:20127794-20127816 GAGGTCTGGTGGCCGAGGGGAGG + Intergenic
1106052146 13:26201486-26201508 GGGGGATGTTGGGGGAGGGGAGG + Intronic
1106182442 13:27380943-27380965 GGGGGGGGGTGGGGGAGGGGCGG + Intergenic
1106481364 13:30139557-30139579 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1106902474 13:34368432-34368454 GGGGGTTGGTGGACAAGAGGAGG + Intergenic
1107184529 13:37503053-37503075 AGGGGCTGGGGGGCAAGGGGAGG + Intergenic
1107222470 13:38001358-38001380 GGGGGATGGGGGGCTAGGGGAGG - Intergenic
1107316784 13:39141075-39141097 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1107430952 13:40339725-40339747 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1108125692 13:47240135-47240157 GGGGGATGGAGGGCTAGGGGAGG - Intergenic
1108177249 13:47805221-47805243 GGGGGGTGGGGGGCTAGAGGAGG + Intergenic
1108351940 13:49595861-49595883 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1108384403 13:49885679-49885701 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1108477453 13:50835042-50835064 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1108840174 13:54603397-54603419 GGGGGGTGGGGGGCTAGAGGAGG + Intergenic
1109188475 13:59297685-59297707 GAGGGCTGGGGGGCTAGGGGAGG + Intergenic
1109367063 13:61369278-61369300 GAGGGGTGGTGGGCAAGGGGAGG + Intergenic
1109432112 13:62249606-62249628 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1109667017 13:65553057-65553079 CGGGGGGGGTGGGGGAGCGGTGG + Intergenic
1109930243 13:69206587-69206609 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1110390541 13:74968477-74968499 GGGGGCTGGGGGGCAAGGGGAGG - Intergenic
1110630012 13:77697600-77697622 GGGGGCGGGTGGGGGGGGGGGGG - Intergenic
1110656520 13:78006310-78006332 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1110813502 13:79836825-79836847 GGGGGATGGGGGGTGAGTGGAGG + Intergenic
1110899876 13:80809121-80809143 GGGGGGTGGGGGGCAAGAGGAGG - Intergenic
1110968322 13:81729436-81729458 GGGGGATGGTGGGCAAGAGGAGG - Intergenic
1111167354 13:84476911-84476933 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1111219315 13:85183046-85183068 GGGGGGTGGAGGGCTAGGGGAGG - Intergenic
1111303206 13:86372113-86372135 AGGGGCTGGGGGGCTAGGGGAGG - Intergenic
1111323118 13:86656638-86656660 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1111329845 13:86751076-86751098 GCGGGGTGGTGGGCGAGGGCAGG - Intergenic
1111364538 13:87224697-87224719 GGGGGATGGGGGGCAAGGGGAGG - Intergenic
1111390520 13:87588669-87588691 GGGGGCTGGAGGGCTAGGAGAGG + Intergenic
1111503724 13:89159236-89159258 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1111712623 13:91835733-91835755 GGGGGTTGGGGGGTGAGGGGAGG + Intronic
1111770325 13:92588067-92588089 GGGGGCTGGAGGGAAAGGGGAGG - Intronic
1111814841 13:93139491-93139513 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1111935012 13:94549312-94549334 GGGGGCTGGTGTGAGACCCGAGG - Intergenic
1111962458 13:94826178-94826200 GGGGGGTGGGGGGTGAGGGGTGG - Intergenic
1112332340 13:98486055-98486077 GGAGGGTGGTGGGCTAGGGGAGG + Intronic
1112437073 13:99398241-99398263 GTGGGCTGGGGGGCTCGCGGTGG - Intergenic
1112911699 13:104493474-104493496 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1113136069 13:107090870-107090892 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1113224038 13:108139903-108139925 GGGAGCTGGTGGGGGTGCTGAGG + Intergenic
1113231757 13:108219072-108219094 GTGGGAGGGTGGGGGAGCGGAGG - Intronic
1113492842 13:110705984-110706006 GCGGGCCGGGCGGCGAGCGGGGG - Exonic
1113593774 13:111517931-111517953 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593812 13:111518016-111518038 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593824 13:111518039-111518061 GGGGGCTGGTGAGGGAGCCGGGG - Intergenic
1113593845 13:111518083-111518105 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593855 13:111518104-111518126 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593865 13:111518125-111518147 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593875 13:111518146-111518168 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593885 13:111518167-111518189 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593896 13:111518189-111518211 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593906 13:111518210-111518232 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113593916 13:111518231-111518253 GGGGGCAGGTGAGGGAGCCGGGG - Intergenic
1113631811 13:111893453-111893475 GGGGCCCGGTGGGCGCCCGGAGG + Intergenic
1113643621 13:111976345-111976367 GTGGGTGGGTGGGCGGGCGGGGG + Intergenic
1113682158 13:112252084-112252106 GGCGGGGCGTGGGCGAGCGGTGG + Intergenic
1113768387 13:112894446-112894468 GGGGCCTGGAGGGGGCGCGGGGG + Intronic
1113801537 13:113089164-113089186 GGGGGCGGGGGGGGGGGCGGGGG - Intronic
1114165270 14:20212930-20212952 CGGGGCTGCTGGCCGGGCGGGGG - Intergenic
1114244287 14:20898514-20898536 GTGGGCTGGCGGGAGAGGGGAGG - Intergenic
1114259200 14:21025227-21025249 TGGGGCCGGGGGGCGAGGGGCGG + Intronic
1114461154 14:22886953-22886975 GGGCGAGGGGGGGCGAGCGGAGG - Exonic
1114559461 14:23579657-23579679 GAGGGGTGGTGGGCTAGAGGGGG - Intergenic
1114600154 14:23949446-23949468 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1114694880 14:24617523-24617545 GGGGGGTGGGGGGCAAGAGGAGG - Intergenic
1114700766 14:24676054-24676076 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1114710567 14:24773848-24773870 GGGGGATGGAGGGCTAGGGGAGG + Intergenic
1115016076 14:28615956-28615978 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1115102140 14:29714958-29714980 GGGGGATGGAGGGCTAGGGGAGG + Intronic
1115399118 14:32938748-32938770 GGGGGCGGGTGGCGGCGCGGGGG + Intronic
1115755171 14:36521665-36521687 GGGCGCAGGTGGGAGGGCGGAGG - Intergenic
1115782281 14:36783206-36783228 TGGGGGTGGTGGGGGGGCGGAGG + Intronic
1115963105 14:38857838-38857860 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1116075544 14:40105743-40105765 GGGGGGTGGGGGGCGAGGGGAGG + Intergenic
1116227077 14:42166168-42166190 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1116233903 14:42253495-42253517 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1116331850 14:43606475-43606497 GGGGGCTGGGGGGCAAGGAGAGG + Intergenic
1116417741 14:44698936-44698958 GGGGGCTGGGGGCCTAGGGGAGG + Intergenic
1116496818 14:45570530-45570552 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1116834861 14:49760685-49760707 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1116902479 14:50374936-50374958 GGGGGTTGGAGGGCAAGAGGAGG + Intronic
1116918299 14:50546979-50547001 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1117264094 14:54067761-54067783 GGGGGTTGGTGGGCGGGGGGGGG - Intergenic
1117298627 14:54401781-54401803 GGGGGCTGGTGGGGAACAGGTGG - Intronic
1117327272 14:54681170-54681192 GGGGGCTGGGGGGCTGGAGGGGG - Intronic
1117465938 14:55994185-55994207 AGGGGCTGGTGGGCTAGGGGAGG - Intergenic
1117577145 14:57110787-57110809 GGTGGGTGGTGGGCTAGGGGAGG + Intergenic
1117600637 14:57370552-57370574 GGGGGCTGGTGGGCTAGGGGAGG + Intergenic
1117888681 14:60393730-60393752 GGGGGCTAGTGGGGGAGGTGGGG - Intergenic
1118030348 14:61812618-61812640 GGCGGCTGCTGGGCGCGGGGCGG + Intergenic
1118184313 14:63523097-63523119 AGGGGCTGCTGGCCGGGCGGGGG - Intronic
1118282736 14:64444107-64444129 GGGGGCTGGGGGGCGGGGCGGGG + Intronic
1118490787 14:66257727-66257749 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1118504280 14:66393530-66393552 TGGGGCTGGTGGGCCAGAGCAGG - Intergenic
1119141214 14:72269129-72269151 GGTGGGTGGTGGGGGGGCGGAGG - Intronic
1120514173 14:85450638-85450660 GGGGGGTGGAGGGCTAGGGGAGG + Intergenic
1120535489 14:85689862-85689884 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
1120604899 14:86562746-86562768 GGGGGGTGGGGGGCGCGGGGAGG - Intergenic
1120725307 14:87932312-87932334 GGGGGGTGGGGGGCGAGGGGAGG + Intronic
1120732461 14:88018909-88018931 GGGGGTTGGAGGGCTAGTGGAGG + Intergenic
1121340222 14:93100515-93100537 GGGGGCCGGGGGGAGAGAGGAGG + Intronic
1121412315 14:93756641-93756663 GGGGGCTGGGGGACGTGCTGGGG - Intronic
1121473349 14:94173972-94173994 GGGGGCTGGGGGGCGGGGGCTGG - Intronic
1121600822 14:95201728-95201750 GGGGGGTGGGAGGCGAGGGGAGG - Intronic
1121622515 14:95360424-95360446 GGGGGCTGGGGGGCGCGCGCGGG - Intergenic
1121678197 14:95771466-95771488 GGGGGCAGGTAGGAGAGCAGAGG + Intergenic
1122032949 14:98926877-98926899 GGGGGCTGGGGGGCTGGGGGAGG - Intergenic
1122112120 14:99510279-99510301 GGGGGCCGGTGTGGCAGCGGCGG - Exonic
1122272730 14:100575633-100575655 GGGGGCTGGTGGGGGAAGGTGGG + Intronic
1122328582 14:100897765-100897787 GGGGGGTGGGGGGCGGGGGGGGG + Intergenic
1122434084 14:101680889-101680911 GGGGGCTGGGGAGCAAGGGGAGG - Intergenic
1122937419 14:104966613-104966635 GGGGGCAGGTGGGCAAGGAGTGG - Intronic
1122970743 14:105151209-105151231 GGGGGCTGCTGGGGCTGCGGGGG - Intronic
1123011376 14:105351086-105351108 GGTGGCTGGAGGGCGGGCGGGGG - Intronic
1123015027 14:105369467-105369489 GTGGGCAGGTGGGCGAGTGTGGG - Intronic
1123091965 14:105745928-105745950 GGTGGGAGGTGGGCGAGCAGGGG - Intergenic
1123097538 14:105773607-105773629 GGTGGGAGGTGGGCGAGCAGGGG - Intergenic
1123215648 14:106806863-106806885 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1123853640 15:24384842-24384864 GGGGGGTGGAGGGGGGGCGGTGG - Intergenic
1124163069 15:27292278-27292300 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1124163683 15:27298828-27298850 GGGGGGTGGGGGGCTAGGGGCGG - Intronic
1124500791 15:30225234-30225256 GGGGGCTGGCGGGCGCGCCCAGG - Intergenic
1124629220 15:31327507-31327529 GTGGGCTCGGGGGCGGGCGGCGG - Exonic
1124679405 15:31717382-31717404 GGGAACTGGGGGGCGAGGGGAGG - Intronic
1124742779 15:32313433-32313455 GGGGGCTGGCGGGCGCGCCCAGG + Intergenic
1124939386 15:34203879-34203901 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1125104005 15:35949649-35949671 TGGGGGTGGGGGGCTAGCGGAGG + Intergenic
1125200991 15:37100587-37100609 GGGGGCGGGAGGGGGAGGGGAGG + Intronic
1125208576 15:37183551-37183573 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1125286756 15:38101416-38101438 GGTGGGTGGGGGGCGAGGGGAGG + Intergenic
1125873959 15:43127611-43127633 GGGGGGTGGTCGGGGGGCGGAGG - Intronic
1125877988 15:43167238-43167260 TGGGGCGGCTGGCCGAGCGGGGG + Intronic
1125957236 15:43798978-43799000 GCGGGCTGGTGGGGGAGTGGAGG + Exonic
1126128636 15:45319160-45319182 GGGGGCTGGGGGGCTGGGGGAGG + Intergenic
1126134254 15:45375771-45375793 GGGGGGTGGTGGGGTAGTGGGGG + Intronic
1126569315 15:50132959-50132981 GAGGGGTGGTGGGCTAGGGGAGG + Intronic
1126767027 15:52019556-52019578 GCGGGCAGGCGGGCGAGCAGGGG - Intronic
1126837123 15:52678976-52678998 GTGAGCTGCTGGGCGAGCGGTGG - Intronic
1126967593 15:54073023-54073045 GGGGGGTGGAGGGCTAGGGGAGG - Intronic
1127236617 15:57059735-57059757 GGGGGCTGGGGGGAGGGTGGAGG + Intronic
1128534765 15:68482080-68482102 GGAGGCTGGTGGGGGACCGGGGG + Intergenic
1128582152 15:68818130-68818152 GGGCGCTGGCAGGCGGGCGGCGG - Intronic
1129115874 15:73365118-73365140 GGGTGCTGGTCGGGGTGCGGTGG + Intronic
1129825049 15:78629323-78629345 TGTGGGTGCTGGGCGAGCGGTGG + Exonic
1129901095 15:79149909-79149931 GTGGGGTGGTGGGGGAGGGGAGG + Intergenic
1130261606 15:82358628-82358650 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1130279629 15:82510384-82510406 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1130301106 15:82680381-82680403 AGCGGCTGGTGGGCGTGAGGGGG + Intronic
1130471008 15:84226569-84226591 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1130478502 15:84341139-84341161 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1130493268 15:84446992-84447014 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1130540401 15:84817485-84817507 GGGCGCGGGTGGGCGGTCGGGGG + Exonic
1130593298 15:85231206-85231228 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1131094750 15:89648251-89648273 GGGGGCCGGCGGGCGAAAGGTGG - Exonic
1131629917 15:94165640-94165662 GGTGGCTGGGGGGCGGGGGGGGG + Intergenic
1131850439 15:96537437-96537459 GGGGGCTGGTTGGGGGGCTGGGG - Intergenic
1131861308 15:96656427-96656449 GGGGGGTGGCGGGCTAGGGGAGG - Intergenic
1132092650 15:98958403-98958425 GGGGGCGGGCGGGGGAGCTGGGG - Exonic
1132262292 15:100436470-100436492 CGGGGCTGGGGGGCAAGGGGAGG + Intronic
1132522229 16:397131-397153 GGGGGCTCCCGGGCGGGCGGGGG + Intronic
1132555470 16:570105-570127 GGGGGGTGGGCGGCGCGCGGCGG + Intronic
1132581279 16:685828-685850 GGGTGCTGATGGGAGAGGGGTGG - Intronic
1132607620 16:800130-800152 GGAGGCCGGGGAGCGAGCGGGGG + Intronic
1132647632 16:1006524-1006546 GGGGGCTGGGGGCTGAGTGGTGG - Intergenic
1132686130 16:1162869-1162891 GTGGTCAGGTGGGCGAGCAGAGG + Intronic
1132689612 16:1176666-1176688 GGGGGCTGATGGGGGTCCGGGGG + Intronic
1132702702 16:1228859-1228881 GGGGGTTGGGGGGCGGGGGGCGG + Intronic
1132705624 16:1242009-1242031 GGGGGTTGGGGGGCGGGGGGCGG - Intronic
1132804989 16:1771254-1771276 GGGGCGCGGTGAGCGAGCGGGGG - Intronic
1132863936 16:2084569-2084591 GGAGGCCACTGGGCGAGCGGGGG - Exonic
1132870598 16:2114137-2114159 GGGGGCTGGTGGTGGAGCCTCGG + Intronic
1132893068 16:2214096-2214118 GGAGGCTGGGGGGCGGGCGGCGG - Intronic
1133025920 16:2988913-2988935 GGGGGCCGGAGGGGGAGAGGAGG + Intergenic
1133041790 16:3064870-3064892 GGGGGCTGGGGGCCGTGAGGAGG + Intergenic
1133074723 16:3271408-3271430 CGGGGCGGTTGGGCGGGCGGAGG + Intronic
1133125195 16:3641836-3641858 GGGGGCTGGAAGGAGAGCAGGGG + Intronic
1133270942 16:4610571-4610593 GGGGCCTGGAGGGTGAGCAGGGG - Intronic
1133287806 16:4698605-4698627 GGGGGGTGGGGGGCGCGGGGAGG + Intronic
1133325039 16:4937109-4937131 GAGCGCAGGTGAGCGAGCGGCGG + Exonic
1133549256 16:6838170-6838192 GGGGGCTAGGGGGCAAGGGGAGG - Intronic
1133680449 16:8115311-8115333 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1133828104 16:9297136-9297158 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1133984109 16:10654931-10654953 GGGGGGGGGTGGGGGAGGGGAGG - Intronic
1134344864 16:13380813-13380835 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1134521934 16:14922767-14922789 GGGGGCTGGTGGTGGAGCCTCGG - Intronic
1134677433 16:16100347-16100369 GGCTGCTGGTAGGAGAGCGGGGG + Intronic
1134709603 16:16321418-16321440 GGGGGCTGGTGGTGGAGCCTCGG - Intergenic
1134716817 16:16361447-16361469 GGGGGCTGGTGGTGGAGCCTCGG - Intergenic
1134949999 16:18347227-18347249 GGGGGCTGGTGGTGGAGCCTCGG + Intergenic
1134957935 16:18390712-18390734 GGGGGCTGGTGGTGGAGCCTCGG + Intergenic
1135382954 16:22008875-22008897 GAGAGCTGGTGGGCGAGGGGAGG + Intronic
1135732262 16:24904931-24904953 GGGGGGTGGAGGGCAAGGGGAGG - Intronic
1136136375 16:28259086-28259108 GGTGGCTGGTGGGCAGACGGAGG - Intergenic
1136285789 16:29240673-29240695 GGGGGCTGGTGGGGGGGTGGAGG - Intergenic
1136399694 16:30010726-30010748 GGGCTGTGGTGAGCGAGCGGGGG - Intronic
1136426076 16:30169635-30169657 CGGGGCGGCTGGCCGAGCGGGGG - Intergenic
1136478358 16:30526717-30526739 GGGGGCTCGGGCGGGAGCGGGGG - Intronic
1136637945 16:31537619-31537641 GGGGGCGGCTGGGCAAGGGGTGG - Intergenic
1136649558 16:31656380-31656402 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1136666782 16:31819534-31819556 GGGGGCGGCTGAGCGAGGGGTGG + Intergenic
1137456678 16:48623115-48623137 GGTGGGTGGGGGGCAAGCGGAGG - Intergenic
1137683179 16:50368696-50368718 GGGGGCCGGGGTGCGGGCGGCGG - Intronic
1137738652 16:50742882-50742904 GGGGGGTGGGGGGCGAATGGGGG + Intronic
1137947908 16:52751853-52751875 GGGAGCTGGTGGGTGGGTGGAGG - Intergenic
1138023443 16:53503970-53503992 GGGGGCTGGGGGGAGGGGGGAGG + Intronic
1138097027 16:54219814-54219836 GGGGGATGGAGGGCAAGAGGTGG + Intergenic
1138102102 16:54260689-54260711 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1138105368 16:54284861-54284883 GGGGGCTGGTGCGGGAGCGCAGG + Exonic
1138627248 16:58262085-58262107 GGGGGCATGTGGGGGAGTGGGGG - Intronic
1138889843 16:61128837-61128859 GGGAGCCGGTGGGGGAGGGGCGG + Intergenic
1138900332 16:61261308-61261330 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1139211008 16:65076670-65076692 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1139280394 16:65765584-65765606 GGGGGGTGGGGGGCTAGAGGAGG - Intergenic
1139448684 16:67014110-67014132 TGTGGCAGGCGGGCGAGCGGCGG - Intergenic
1139471557 16:67180547-67180569 GGGGACTGGTAGGCGGGCTGGGG + Exonic
1139510259 16:67424135-67424157 GGGGGCTGGTGGGGGAGAGGCGG - Intergenic
1139652265 16:68368336-68368358 GGGGGCAGGGGGGCGGGAGGTGG + Intronic
1140147975 16:72330520-72330542 GGGGGGTGGTGGGCTGGGGGAGG + Intergenic
1140157326 16:72445283-72445305 GGGTGCTGGGGGGCTAGGGGAGG - Intergenic
1140309286 16:73833603-73833625 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1140559077 16:75956105-75956127 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1140604269 16:76516084-76516106 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1140657536 16:77155853-77155875 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1140700099 16:77573748-77573770 GGGGGCTGCGGGGCAAGGGGAGG + Intergenic
1140993659 16:80239648-80239670 GGGGGGTGGTGGGCTAGGGGAGG - Intergenic
1141052769 16:80786918-80786940 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1141531361 16:84648787-84648809 GCGGGCGGGTGGGCGAGTGGGGG + Intronic
1141585031 16:85028001-85028023 GGGGTCCGCGGGGCGAGCGGGGG + Intronic
1141610420 16:85178060-85178082 GGGTGCTGGTGGGCGATGAGAGG + Intronic
1141624224 16:85253053-85253075 GGGGGGTGGGGGGGGGGCGGGGG - Intergenic
1141641178 16:85342518-85342540 GGGGGCTGGTGGGGCTGCCGAGG - Intergenic
1141989580 16:87602445-87602467 GGGGGGCGGGGGGCGGGCGGGGG + Intronic
1142145175 16:88489918-88489940 GGGAGCTGGTGGGTGAGGGAGGG + Intronic
1142356514 16:89604199-89604221 GGGGGCTGGAGGGGGAGCCCTGG + Intergenic
1142477033 17:194591-194613 GGAGGAGGGAGGGCGAGCGGAGG + Intergenic
1142586786 17:979194-979216 GGGGGGTGGAGGGCGGGCAGGGG + Intronic
1142611225 17:1109932-1109954 GGGGGCTGGTCTGTGAGTGGGGG - Intronic
1142763929 17:2055665-2055687 GGGGTCGGGCGGGCGAGCAGCGG + Intronic
1142809329 17:2387821-2387843 GAGGGCTGGGGGGCCAGCGTGGG + Intronic
1142931289 17:3286057-3286079 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1143024038 17:3930478-3930500 AGGGGCTGGTGGGTGGGAGGAGG + Intronic
1143412115 17:6715591-6715613 GGGGGTTGGAGGGCAAGGGGAGG - Intergenic
1143419430 17:6777251-6777273 GGGGGGTGGCGGGCAAGGGGAGG - Intronic
1143438734 17:6951317-6951339 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1143513132 17:7406636-7406658 GGCGGCTGGTGGGGGGGCGGGGG + Intronic
1143516232 17:7420551-7420573 GGGAGCTGGTGGGATAGTGGGGG + Intronic
1143576135 17:7794372-7794394 GGGGGCTGCAGGACGAGGGGAGG + Intronic
1143736733 17:8916474-8916496 GGGGGCGGGGGGGCGGGGGGCGG - Intronic
1143829565 17:9640387-9640409 GGGGGGTGGTGGGTGGGGGGAGG - Intronic
1143936010 17:10484882-10484904 GGGGCCTGGTGGGGGAGGGGTGG - Intergenic
1144140106 17:12340119-12340141 GGGGACTGGTGGGTGAGGGGAGG - Intergenic
1144559766 17:16312110-16312132 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
1144725390 17:17499378-17499400 TGGGGCTGGTGGGGGGGGGGTGG - Intergenic
1144761716 17:17710947-17710969 GGGGGCAGGTGGGAGGGAGGAGG + Intronic
1144843331 17:18202355-18202377 GGGGGCTGGTGGAAGATGGGTGG + Intronic
1145047119 17:19627692-19627714 CGGGGCGGCTGGGCGGGCGGGGG + Intergenic
1145199027 17:20923337-20923359 GGTGGCTGGGGGGCAAGGGGAGG - Intergenic
1145715529 17:27016546-27016568 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1145761032 17:27425616-27425638 GGGGGCTGGAGGAGCAGCGGGGG + Intergenic
1145805857 17:27728953-27728975 GGGGGGTTGTGGGCAAGGGGAGG - Intergenic
1146161083 17:30559774-30559796 GGGGGCTGGAGGAACAGCGGGGG + Intronic
1146222074 17:31032881-31032903 GGGGGGTGGGGGGCGCGTGGTGG - Intergenic
1146421142 17:32687130-32687152 GGAGGCTGGGGTGCGGGCGGGGG - Intronic
1146488862 17:33265497-33265519 GGGGCCTGTTGGGGGAGTGGTGG + Intronic
1146613312 17:34328018-34328040 GGTGGGTGGTGGGCTAGGGGAGG + Intergenic
1147143736 17:38473680-38473702 GGGGGCGGGTGGGCGTGGGTAGG + Intronic
1147172622 17:38631030-38631052 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1147440332 17:40443661-40443683 GCGGGCGCGCGGGCGAGCGGCGG - Exonic
1147522959 17:41191987-41192009 GGGGGATGGGGGGCAAGGGGAGG + Intronic
1147541161 17:41361168-41361190 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1147598835 17:41733753-41733775 AGGGGTGGGTGGGCGGGCGGAGG - Intronic
1147609648 17:41793963-41793985 GAGGGCCGGAGGGCGAGAGGCGG - Intergenic
1147627107 17:41907395-41907417 GGGGACTGGGGGGAGGGCGGTGG - Intronic
1147774819 17:42893268-42893290 GGGGGCTGGTGGGTAGGAGGTGG - Intergenic
1147924528 17:43938446-43938468 GGGGGGTGGGGGGGGCGCGGGGG + Intronic
1147948178 17:44092228-44092250 GGGAGCTGTTGGGAGAGCTGGGG + Exonic
1147990017 17:44326824-44326846 GGGGGCGGGCGGGCGGGTGGAGG + Intergenic
1148048670 17:44758928-44758950 GGGGGGCGGCGGGAGAGCGGAGG + Intergenic
1148111586 17:45147531-45147553 GGGGGCGGGCGGGGGAGTGGAGG - Intergenic
1148177601 17:45581171-45581193 GGGGGGTGGGGGGCGAGGGGAGG + Intergenic
1148318892 17:46732344-46732366 AGGGGGTGGTGGGGGAGGGGTGG - Intronic
1148693578 17:49546316-49546338 GGGGGCAGGTGGGAGTGCGAAGG + Intergenic
1148786634 17:50149064-50149086 GCTGGCTGGCTGGCGAGCGGGGG + Intronic
1149485821 17:57042035-57042057 GGGGTCAGGTGGGGGAGGGGAGG + Intergenic
1149582663 17:57762169-57762191 GGGGGCTGGGGGTGGAGTGGTGG - Intergenic
1149625059 17:58074316-58074338 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
1150210407 17:63438456-63438478 GCGGGGTGGGGGGCGGGCGGGGG - Intronic
1150698501 17:67426607-67426629 GGAGGGTGGGGGGCGAGGGGAGG + Intronic
1150747729 17:67829459-67829481 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1150793686 17:68221202-68221224 GGGGGCGGGGGGGGGAGCTGAGG - Intergenic
1151005949 17:70436141-70436163 GGGGGATGGGGGGCTAGGGGAGG - Intergenic
1151119616 17:71778123-71778145 CAGGGCTGGTGAGCGGGCGGTGG + Intergenic
1151172177 17:72256220-72256242 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1151198996 17:72453977-72453999 GGGGGGTGGGGGGCAAGAGGAGG - Intergenic
1151218097 17:72591694-72591716 TGGGGCTAGGGGGTGAGCGGGGG - Intergenic
1151584605 17:75001504-75001526 GAGGGCTGGGGGGCGGGCGAGGG + Intronic
1151761118 17:76103731-76103753 GGGGCCCGGTGGGCCCGCGGAGG - Exonic
1151833440 17:76569074-76569096 TGGGGGTGGTGGGGGGGCGGGGG + Intronic
1151876333 17:76869760-76869782 GGAGCGTGGTGGGCGGGCGGTGG + Intronic
1151919283 17:77141284-77141306 GGGGGGCGGAGGGCGAGCAGGGG - Intronic
1152134596 17:78496454-78496476 CGGGGGTGGTGGGCGGGGGGAGG + Intronic
1152228426 17:79103107-79103129 GGGGGCAGGTGGGCGATCTTGGG + Intronic
1152250319 17:79209148-79209170 GTGGCCTGGTGGGAGAGGGGAGG - Intronic
1152279024 17:79374329-79374351 GGGGGCTGGTGTGTGGGTGGTGG + Intronic
1152357247 17:79813284-79813306 GGCGGCCGCGGGGCGAGCGGGGG - Intergenic
1152366679 17:79860482-79860504 CGGGGCTGGTGGCCCAGCCGGGG + Intergenic
1152468468 17:80478074-80478096 GGGGGCTGGGGGGCGGGTAGAGG - Intergenic
1152476659 17:80522840-80522862 GGGGGGTGGTGGGCTGGAGGAGG + Intergenic
1152572477 17:81126869-81126891 TGGGGCTGGTGGTCGAGGGTTGG + Intronic
1152800327 17:82327929-82327951 GGGGGCTGGTGGACGGGCTGGGG - Intronic
1152800355 17:82327996-82328018 GGGGGCTGGTGGACAGGCCGGGG - Intronic
1152922382 17:83072559-83072581 GGGGGCTGGAGGGTGTGGGGCGG + Intergenic
1152966361 18:119091-119113 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1153066091 18:1046724-1046746 GGGGGTTGGGGGGCAAGGGGAGG - Intergenic
1153474870 18:5488413-5488435 GGGGACTGGGGGGCTAGGGGAGG + Intronic
1153515119 18:5895308-5895330 GGGAGCTGGAGGATGAGCGGCGG - Exonic
1153772416 18:8426292-8426314 GGGGGCTGGAGGGAGTGCAGAGG + Intergenic
1153794330 18:8609251-8609273 GGGGGCGGGCAGGCGAGCAGAGG + Intergenic
1153951801 18:10064075-10064097 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1154053767 18:10991372-10991394 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1154070665 18:11149160-11149182 GGGGGCTGGAGGGCGAGACCCGG - Intergenic
1154174521 18:12076665-12076687 GGGGCCTGCTGGGCGAGCGGCGG + Intergenic
1154194248 18:12254293-12254315 CGGGGCTGGCAGGCGGGCGGGGG + Intergenic
1154381691 18:13857427-13857449 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1155127662 18:22895246-22895268 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1155508270 18:26551081-26551103 GGGAGCTGGTGGGAGGGGGGTGG - Intronic
1155566726 18:27143791-27143813 GGGGGATGGGGGGCAAGGGGAGG + Intronic
1155711463 18:28885851-28885873 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1155761141 18:29568491-29568513 GGGGGCTGGGGGGCTAGGGGAGG + Intergenic
1155845206 18:30696350-30696372 GAAGGCTGGAGGGCGAGCAGCGG + Intergenic
1155848320 18:30736946-30736968 TTGGGGTGGTGGGCGAGGGGAGG + Intergenic
1155956724 18:31960975-31960997 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1156036521 18:32771783-32771805 GGGGGCTGTCGAACGAGCGGGGG + Intronic
1156166186 18:34424102-34424124 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1156259926 18:35436789-35436811 GGGGCTGGGAGGGCGAGCGGAGG + Intergenic
1156429835 18:37060007-37060029 GGGGGATGGGGGGCTAGGGGAGG + Intronic
1156466530 18:37351101-37351123 AGGTGCTGGTGGGGGAGAGGGGG + Intronic
1156466960 18:37353734-37353756 GTGGGCTGGTGGGGGCGGGGGGG + Intronic
1156626366 18:38914858-38914880 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1156717063 18:40024195-40024217 GGGGGGTGGGGGGCGGGGGGTGG - Intergenic
1157065810 18:44349528-44349550 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1157318110 18:46610399-46610421 GGGGGCTGGGGGGCTGGGGGAGG + Intronic
1157542776 18:48523871-48523893 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1158091232 18:53716153-53716175 AGGGGCTGGTGGGCAAAGGGAGG - Intergenic
1158297117 18:56010705-56010727 AGGGGATGGGGGGCGAGGGGAGG - Intergenic
1158365026 18:56724795-56724817 GTGGGGTGGTGGGAGAGCGGGGG - Intronic
1158413713 18:57231156-57231178 GGGGACAGGTGGGAGAGGGGAGG + Intergenic
1159123738 18:64199187-64199209 GGGGGGTGGTGGACTAGGGGAGG + Intergenic
1159225011 18:65522604-65522626 AGGGGTTGGTGGGCAAGGGGAGG + Intergenic
1159349169 18:67249699-67249721 GGGGGATGGGGGGCTAGGGGAGG - Intergenic
1159542042 18:69790265-69790287 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1160158995 18:76456739-76456761 GGGGGCTGGGGGGTGGGGGGGGG + Intronic
1160163712 18:76493325-76493347 GGGGGCGGGGGGGGGGGCGGGGG + Intronic
1160408586 18:78659766-78659788 GGGGGATGGTGGGTGCCCGGCGG - Intergenic
1160534637 18:79585561-79585583 GGGGGCTGCTAGGTGTGCGGGGG - Intergenic
1160725442 19:616144-616166 GGGGGCTGGCGGGCGCGCCCGGG - Exonic
1160749433 19:727048-727070 GGCAGCTGGAGGACGAGCGGAGG + Exonic
1160794932 19:940901-940923 GGGCCCTGGCGGGCGAGGGGTGG + Intronic
1160809600 19:1007732-1007754 GGGGCGTGGTGGGCGCGCTGTGG - Exonic
1160822447 19:1064858-1064880 AGGGGCTGGAGGGTGAGCTGAGG + Intronic
1160829233 19:1095217-1095239 GGGGGCGGGGGCGCGGGCGGCGG - Intronic
1160860492 19:1235437-1235459 GGCGGCGGGTGGCCGAGGGGCGG + Intronic
1160916548 19:1499396-1499418 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
1160927764 19:1555426-1555448 GGGGGCAGGGGGGTGGGCGGCGG - Exonic
1160935537 19:1592817-1592839 GGGGGCTGGCGAGCGCGGGGAGG - Intergenic
1161068102 19:2248173-2248195 GGGGGCTGGTGGGTGAACCCCGG - Exonic
1161313810 19:3608758-3608780 GGGGGGTGGGGGGCGGGGGGCGG - Intergenic
1161628404 19:5339752-5339774 GGGGGCTGCGGGGGGAGGGGAGG - Intronic
1161925188 19:7294309-7294331 GGCGGGTGGCGGGCGGGCGGCGG + Intergenic
1161951975 19:7472588-7472610 GAGGGCAGGTGAGCGAGCTGAGG - Intergenic
1161973556 19:7596640-7596662 GGGGCCTGGGGGTCGTGCGGTGG - Intronic
1162012064 19:7823453-7823475 GGGGGATGGAGGGGGAGGGGTGG + Intergenic
1162296630 19:9818578-9818600 AGAGGCTGGTGGACGACCGGTGG - Exonic
1162394285 19:10407628-10407650 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1162742696 19:12782670-12782692 GGCGGGGGCTGGGCGAGCGGAGG + Intronic
1162860591 19:13503938-13503960 GAGGGCTGTTGGGGGAGAGGGGG - Intronic
1162860937 19:13505693-13505715 GGGGGCTGGGGGGTGGGCAGCGG - Intronic
1162895575 19:13763144-13763166 CAGGGCTGGTGGGCGAGCCGGGG - Exonic
1163074047 19:14872559-14872581 GGTGGGTGGAGGGCTAGCGGAGG + Intergenic
1163126014 19:15244518-15244540 GGGGGCTGCTGGGGAGGCGGGGG + Exonic
1163136826 19:15317602-15317624 GGGGGGTGGTGGGCAAGGGGTGG + Intronic
1163273609 19:16268894-16268916 ACGGGCTGGTGGGTGGGCGGAGG - Intergenic
1163441236 19:17323653-17323675 AGGGGCTGGGGGGCGGGTGGGGG + Exonic
1163655763 19:18543763-18543785 GGGGGCTGGGGCGGGGGCGGGGG + Intronic
1163701200 19:18787457-18787479 GGGGGTTGGGGGGCGAGGAGAGG - Intronic
1164081541 19:21865403-21865425 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
1164105331 19:22105337-22105359 TGGGGCGGCTGGCCGAGCGGGGG - Intergenic
1164417233 19:28057374-28057396 GGGGGGTGGGGGGTGAGGGGAGG + Intergenic
1164623929 19:29714686-29714708 GGTGGCTGGTGGGGCAGGGGCGG - Intronic
1164722725 19:30444241-30444263 GGGGCCTGCTGGGCGTGCGGCGG - Exonic
1164889279 19:31809258-31809280 GGGGCCTGTTGGGGGAGCTGGGG + Intergenic
1165003202 19:32782109-32782131 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1165013218 19:32863663-32863685 GGTGGCTGGTGGGGGAGTAGGGG - Intronic
1165402944 19:35613342-35613364 GGCGGGTGGTGGGGGAGCGCGGG - Intronic
1165677884 19:37743985-37744007 GGGGGCTGGGAGGTGAGGGGAGG + Intronic
1165774290 19:38395721-38395743 GCCGGGGGGTGGGCGAGCGGGGG - Exonic
1165825035 19:38700870-38700892 GTGGCCTGGTGGGCCAGCAGAGG + Intronic
1165856311 19:38880942-38880964 GGGGGCGGGGGAGGGAGCGGTGG - Intronic
1166030109 19:40118780-40118802 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1166136462 19:40780153-40780175 GTGGGCTGGTGGGCAGCCGGTGG + Intronic
1166142685 19:40813421-40813443 GGGAGATGGTGGGCGGGGGGTGG + Intronic
1166307066 19:41940972-41940994 GGCGGCGGGAGGGCGAGCGCCGG - Intergenic
1166317596 19:41997788-41997810 GGGGGTGGGTGGGCGGGCAGGGG - Intergenic
1166360100 19:42249432-42249454 TGGGGCAGGCGGGCCAGCGGGGG + Exonic
1166409168 19:42544854-42544876 GGAGGCTGGGGGGGGGGCGGGGG + Intronic
1166409467 19:42547011-42547033 GGGGGCTGGGCGGTGAGCAGAGG + Intronic
1166765678 19:45251339-45251361 GCGGGCAGGCGGGCGGGCGGGGG - Exonic
1166947101 19:46404098-46404120 GGGGGCAGGTGGGCGTGGCGGGG + Intergenic
1166959689 19:46490022-46490044 GGGGGCAGGTGGGCGTGGCGGGG - Intronic
1167275723 19:48538055-48538077 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1167633412 19:50639565-50639587 GGGGATCGGTGGGCGAGGGGTGG + Intronic
1167642458 19:50689088-50689110 GTGGGGTGGTGGGCGGGCTGGGG + Intronic
1167806054 19:51786439-51786461 GGGGGCTGGGGGGCTAGGGGAGG + Intronic
1168145572 19:54418716-54418738 GGGGGCGGGTGGGGGTGTGGGGG - Intronic
1168386250 19:55965797-55965819 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1202710752 1_KI270714v1_random:18287-18309 GCGGGCGGGCGGGCGGGCGGGGG + Intergenic
1202713480 1_KI270714v1_random:29912-29934 GGGTGCTGGTGGGCGAGCTGAGG + Intergenic
925281309 2:2687184-2687206 GGGGGATGGAGGGCGAGGTGAGG + Intergenic
925403344 2:3590784-3590806 CGGGGCGGCTGGCCGAGCGGGGG + Intergenic
925739112 2:6989751-6989773 GGGGGCGGCTGGGAGAGCAGAGG - Intronic
925756974 2:7142597-7142619 GGGGAGTGGTGGGCTAGGGGAGG + Intergenic
925929350 2:8694294-8694316 GGTGGGTGGTGGGGGAGCGGTGG + Intergenic
926103428 2:10135474-10135496 GGGCCCTGGTGGGGGAGGGGAGG + Intergenic
926722478 2:15971467-15971489 GGGGGCTGGTGGGGGGGCTCAGG + Intergenic
926820172 2:16843368-16843390 GCGGGGTGGGGGGCGAGGGGAGG - Intergenic
926914192 2:17877767-17877789 GGGGGCGGGAGGGGGAGCGCGGG + Intergenic
927747414 2:25634396-25634418 CGGGGCGGGTGGCCGGGCGGGGG - Intronic
928094084 2:28393403-28393425 GGGGGCGGGAGGGCGCGCGCAGG + Exonic
928602463 2:32916235-32916257 GGGGGGTGGGGGGGGGGCGGGGG + Intergenic
928634993 2:33235902-33235924 GGGAGGTGGTGGGCTAGGGGAGG + Intronic
928854839 2:35790755-35790777 GGGAGTTGGTGGGCAAGTGGTGG - Intergenic
928858475 2:35827975-35827997 GGGGGGTGGTGGGGGGGTGGTGG + Intergenic
928860418 2:35850478-35850500 GTGGGGTGGTGGGAGAGGGGAGG + Intergenic
929353559 2:40991175-40991197 AGGGGCTGGGGGGCTAGAGGAGG + Intergenic
929535748 2:42783343-42783365 TGGGGCTGGTGGTTGAGCGAAGG - Exonic
929874036 2:45781634-45781656 GGGGGCCGGGGGGCGGGCGCGGG - Intronic
929941573 2:46337911-46337933 GGGGGCTGGTGTGCCAGCTGAGG + Intronic
930136038 2:47905401-47905423 GCGGGCGGGCGGGCGGGCGGGGG - Intronic
930222468 2:48759109-48759131 GGGGGATGGGGGGCAAGGGGAGG - Intronic
930933465 2:56917949-56917971 GGGGAGTGGTGGGCTAGGGGAGG + Intergenic
931125034 2:59265450-59265472 GTGGGGTGGTGGGAGAGGGGAGG + Intergenic
931142601 2:59479300-59479322 GGGGGCTGGGAGGCAAGGGGAGG + Intergenic
931189621 2:59987572-59987594 AGGGGGTGGTGGGCTAGGGGAGG + Intergenic
931215345 2:60236919-60236941 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
931253666 2:60553272-60553294 GTGGGCTGCGGGGCGGGCGGCGG + Exonic
931557627 2:63522175-63522197 GGGGGGTGGGGGGCTAGAGGAGG - Intronic
931834594 2:66085528-66085550 GTGGGGTGGGGGGCGGGCGGGGG + Intergenic
932367307 2:71161344-71161366 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
932380178 2:71275526-71275548 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
932881343 2:75504795-75504817 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
932926355 2:75979391-75979413 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
933109709 2:78381959-78381981 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
933195564 2:79385675-79385697 GGGGGGTGGTGGGCAAGGGGAGG - Intronic
933318333 2:80741504-80741526 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
933335699 2:80956165-80956187 AGGGGGTGGTGGGCAAGCGGAGG - Intergenic
933467761 2:82677090-82677112 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
933601956 2:84341843-84341865 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
933666768 2:84971007-84971029 CGGGGCTGGCGTGCGGGCGGCGG + Intergenic
934475138 2:94588561-94588583 GGGGGCTGGAGGGTGAGAAGAGG - Intronic
934564169 2:95329377-95329399 GGGGCCTGGTGGTCCAGAGGTGG - Intronic
934753025 2:96806105-96806127 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
934763907 2:96869961-96869983 GAGGGCTGGCGGGCGAGCGCGGG - Exonic
934780381 2:96966134-96966156 GGGGGCTGGTGGGGGATAGGAGG - Intronic
934872368 2:97878696-97878718 AGGGGCTGGGGGGCTAGAGGAGG + Intronic
935112235 2:100104568-100104590 GGTGGGCGGTGGGCGGGCGGCGG - Intronic
935240241 2:101171609-101171631 GGGTGGTGGTGGGGGGGCGGGGG - Intronic
935455054 2:103257449-103257471 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
936038019 2:109128423-109128445 GGGTGCTGGTCGGCGGGCAGCGG + Intergenic
936083223 2:109449289-109449311 GGGGGCTGGTGGCTGTGCTGCGG - Exonic
936145862 2:109980346-109980368 GGGAGCTGGGGGGAGAGCAGGGG - Intergenic
936198828 2:110391132-110391154 GGGAGCTGGGGGGAGAGCAGGGG + Intergenic
936695535 2:114943041-114943063 GGGGGGTGGAGGGCTAGAGGAGG - Intronic
937309483 2:120893317-120893339 GGAGGCTGGGGGGCGGGCAGGGG - Intronic
937457585 2:122055783-122055805 TGGGGCTGGTGGGGGAAAGGAGG - Intergenic
937478239 2:122234148-122234170 GGGGGCGGGGGGGCGGGCGGCGG + Intergenic
937492019 2:122379813-122379835 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
937734264 2:125270698-125270720 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
937741229 2:125356952-125356974 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
937813160 2:126221296-126221318 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
938208848 2:129447382-129447404 GGGGGGTGGGGGGAGAGGGGAGG + Intergenic
939029027 2:137048050-137048072 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
939050694 2:137303950-137303972 AGGGGGTGGTGGGCTAGGGGAGG - Intronic
939800112 2:146697861-146697883 GGGGGCGGGGGGGCAGGCGGGGG + Intergenic
939808980 2:146808272-146808294 GGGGGGTGGGGGGGGAGCGGGGG + Intergenic
939817112 2:146910063-146910085 GGGGGCTGGGGGACTAGGGGAGG - Intergenic
939941258 2:148354254-148354276 GGGGGGTGGAGGGCAAGGGGAGG - Intronic
939999624 2:148954022-148954044 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
940572258 2:155452793-155452815 CGGGGGTGGTGGGCTAGGGGAGG + Intergenic
940635615 2:156293704-156293726 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
940652292 2:156451494-156451516 AGGGGCGGCTGGCCGAGCGGGGG + Intronic
940750644 2:157623611-157623633 GGGGGTTGGTGGGGGAGGTGGGG + Intronic
940830092 2:158457079-158457101 GGGGGCCGGTGGGGGAGGGAGGG + Intronic
940851448 2:158691275-158691297 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
940868539 2:158840292-158840314 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
940926554 2:159370169-159370191 GTGGGGTGGTGGGAGAGGGGAGG + Intronic
941040938 2:160622857-160622879 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
941072986 2:160975712-160975734 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
941242485 2:163056523-163056545 GGGGGCTGGGGGGAAAGGGGAGG + Intergenic
941590228 2:167410582-167410604 AGGGGCTGGGGGGCAAGTGGAGG + Intergenic
941770865 2:169344261-169344283 GGGGGTTGGGGGGCTAGGGGAGG - Intronic
942314226 2:174683011-174683033 CGGGGCAGGCGGGCGCGCGGAGG - Intergenic
942355703 2:175108426-175108448 CGGGGCTGCTGGCCGGGCGGGGG - Intronic
942733161 2:179081351-179081373 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
942761471 2:179403529-179403551 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
942803397 2:179902078-179902100 GGGGTGTGGTGGGCAAGGGGAGG - Intergenic
942811369 2:180004682-180004704 GGGGGGAGGGGGGCGAGGGGCGG - Intronic
942954597 2:181759344-181759366 GTGGGCTGGTGGGCAAGGGAGGG + Intergenic
943140224 2:183973324-183973346 GGGGGCTGGTGGGCTAGGGGAGG - Intergenic
943635091 2:190297897-190297919 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
943682871 2:190786375-190786397 AGGGGCGGGGGGGGGAGCGGGGG - Intergenic
943885350 2:193210038-193210060 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
943973350 2:194440042-194440064 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
944093552 2:195941370-195941392 GGGGGTTGGGGGGCAAGAGGAGG + Intronic
944154176 2:196593361-196593383 GGCGCCTGGAGAGCGAGCGGCGG - Intronic
944495797 2:200306623-200306645 GCGGGCGGGTCGGCGGGCGGGGG + Intronic
944797982 2:203207300-203207322 GGGGGCGGCTGGCCGGGCGGGGG - Intronic
945210415 2:207376613-207376635 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
945845365 2:214938097-214938119 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
946263863 2:218521482-218521504 GGGGGATGGAGGGCAAGGGGAGG - Intronic
946321834 2:218959143-218959165 GGGGGGTGGGGGGCGAGGTGGGG + Intergenic
946422199 2:219571268-219571290 GGGGGCAGGGGGGGGTGCGGAGG + Exonic
946495258 2:220190160-220190182 GGGGGCTGCAGGGCTAGGGGAGG + Intergenic
946682357 2:222230411-222230433 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
946721295 2:222611443-222611465 GGGGGCGGGGGGGCGCGTGGGGG + Intronic
946868789 2:224067225-224067247 GGGGCCTGTTGGGCGTGGGGAGG + Intergenic
947002236 2:225469849-225469871 GGGGGATGGGGGGCTAGGGGAGG + Intronic
947024473 2:225721481-225721503 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
947549730 2:231037663-231037685 TGCTGCTGGTGGGCGAGCTGTGG + Exonic
947797917 2:232906131-232906153 CGGGGCGGGTGGCCGGGCGGGGG - Intronic
948045447 2:234940240-234940262 GAGGGCTGGTGGGAGGGCGGTGG + Intergenic
948252861 2:236544509-236544531 GGGGGCTGCTGTGCGAGCACAGG + Intergenic
948378754 2:237539043-237539065 AGGGGCGGGTGGGCGCGCAGAGG + Intronic
948567714 2:238897304-238897326 AGGGGCAGGGGGGCGCGCGGAGG - Intronic
948753325 2:240144796-240144818 GGGGGCTGGGGTGGGAGTGGAGG - Intergenic
948920529 2:241064047-241064069 GGAGGCCGGTGTGAGAGCGGCGG + Exonic
948945685 2:241217939-241217961 GGGGGCGGGGGGGGCAGCGGGGG + Intronic
949047248 2:241877715-241877737 GGGGGGTGGGGGGCGAAGGGCGG - Intergenic
949077182 2:242068019-242068041 AGAGGCTGGTGGGGGAGCAGAGG - Intergenic
1168800938 20:642748-642770 GGGTGCGGGTGGACGAGCCGGGG + Intergenic
1169370966 20:5027991-5028013 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1169414172 20:5401792-5401814 GGGGGCTGGTGGGGGGGGGGTGG - Intergenic
1169930000 20:10822305-10822327 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1169957760 20:11124629-11124651 GGGGGTTGGTGGGCGGGTGACGG + Intergenic
1170049209 20:12123854-12123876 GTGGGGTGGTGGGAGAGGGGAGG - Intergenic
1170234329 20:14085033-14085055 GGGGGGTGGTGGGGGAGAGGTGG + Intronic
1170744324 20:19085390-19085412 GGGGCCTGTTGGGGGAGTGGGGG + Intergenic
1171003931 20:21444345-21444367 GGGGCCTGTTGGGGGAGGGGTGG + Intergenic
1171143036 20:22759460-22759482 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1171767978 20:29300657-29300679 TGGGCCTGGTGGGCGCCCGGAGG - Intergenic
1171824053 20:29878596-29878618 GCGGGCTGGGGGCAGAGCGGCGG - Intergenic
1172587354 20:36093837-36093859 GGGGGCTGGGGGGAGGCCGGAGG - Intronic
1172650624 20:36499352-36499374 GCGGGCAGGTGGGCGGGAGGTGG - Intronic
1172852607 20:37977345-37977367 GGGGGCGGGGGGGCGGGGGGGGG + Intergenic
1173068413 20:39736996-39737018 GGGGGTTGGTGGGGCAGAGGGGG + Intergenic
1173090812 20:39969309-39969331 GGGAGGTGGAGGGCGAGGGGAGG - Intergenic
1173097105 20:40045012-40045034 AGGGGGTGGTGGGCTAGGGGAGG - Intergenic
1173569640 20:44067986-44068008 GGGCGCTGGTGGGTCAGCAGAGG - Intronic
1173817791 20:46000874-46000896 GGGGGTGGGTGGGAGAGAGGGGG + Intergenic
1173843655 20:46174810-46174832 GAGGGCAGGTGGGCCTGCGGGGG + Exonic
1173958814 20:47055567-47055589 GGGGGCAAGTGTGCGAGAGGAGG - Intronic
1174020554 20:47525738-47525760 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
1174597029 20:51692484-51692506 TGGGGCTGGAGGGGGAGCGTGGG + Intronic
1174908569 20:54579922-54579944 GGGGGATGGAGGGCTAGGGGAGG - Intronic
1175267088 20:57709613-57709635 GGGGGCTCGGGGGCGGCCGGGGG + Exonic
1175358675 20:58389709-58389731 GAGGGCTGGTGCGGGAGCCGGGG + Intronic
1175648386 20:60695420-60695442 AGGGTCTGGTGGGAGAGTGGAGG - Intergenic
1175755699 20:61528409-61528431 GGGGGGTGGAGGGGGAGAGGAGG + Intronic
1175963158 20:62647248-62647270 GGGGGCTGGTGTGGCAGGGGAGG + Intronic
1176032751 20:63021609-63021631 GGGAGCTGGTGTGTGAGGGGGGG + Intergenic
1176093982 20:63331212-63331234 GGTGACTGGTGGGCCAGCAGTGG - Intronic
1176095979 20:63344833-63344855 AGGGGCTGATGGCAGAGCGGGGG + Exonic
1176223618 20:63981649-63981671 CGGGGCGGGCGGGCGGGCGGGGG - Intronic
1176300302 21:5096144-5096166 GGGGCCTGTGGGGCGGGCGGTGG - Intergenic
1176548564 21:8212142-8212164 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1176556458 21:8256350-8256372 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1176567495 21:8395177-8395199 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1176575397 21:8439392-8439414 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1177296521 21:19183050-19183072 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1177442811 21:21149558-21149580 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1177509675 21:22069155-22069177 GGGGGGTGGGGGGCAAGTGGAGG - Intergenic
1177853206 21:26373404-26373426 GGGGGCTGGGGAGCTAGGGGAGG - Intergenic
1177920342 21:27143928-27143950 GTGTGCTGCTGGGCTAGCGGCGG - Intergenic
1177925339 21:27207366-27207388 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1177955458 21:27592791-27592813 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1178487408 21:33027691-33027713 GGCGGCAGTGGGGCGAGCGGGGG + Exonic
1178779775 21:35590683-35590705 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1178792075 21:35709990-35710012 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1178992383 21:37366699-37366721 CGGGGCTGGGGGGCGGGAGGAGG + Intronic
1179059101 21:37963461-37963483 GGGGGGTGGGGGCCTAGCGGAGG - Intronic
1179788690 21:43743452-43743474 GGGGGCTGGGGGGAGGGAGGTGG - Intronic
1179856720 21:44165767-44165789 GGGGCCTGTGGGGCGGGCGGTGG + Intergenic
1179925985 21:44534179-44534201 CGGGGCTGGTGTGTGAGGGGTGG + Intronic
1179926014 21:44534255-44534277 CGGGGCTGGTGTGTGAGGGGTGG + Intronic
1179926060 21:44534390-44534412 TGGGGCTGGTGTGTGAGGGGCGG + Intronic
1179926082 21:44534450-44534472 CGGGGCTGGTGTGTGAGGGGTGG + Intronic
1180062154 21:45390977-45390999 AGGGGCTGGGGGGCGAGCCTGGG - Intergenic
1180107075 21:45626163-45626185 GGGGGGTGGGGGGCGAGGGGAGG - Intergenic
1180414027 22:12693063-12693085 GGGGGATTGTGGGAGTGCGGAGG + Intergenic
1180541786 22:16455874-16455896 GGGGGGTGGTGGGCTGGGGGAGG + Intergenic
1181299247 22:21867651-21867673 GCGGGCCGGCGGGCGGGCGGAGG + Intronic
1181361105 22:22336754-22336776 GGGGGCTGGGGGTCAAGGGGAGG + Intergenic
1181648137 22:24244750-24244772 GGCGGCTGGTGGGCAGACGGAGG + Exonic
1182055192 22:27347709-27347731 GGGGGCTGGGGGGCGTTAGGCGG - Intergenic
1182785803 22:32906649-32906671 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1183256670 22:36766776-36766798 GGGAGCTTGTGGGGGAGCCGAGG - Intronic
1183384252 22:37505990-37506012 GTGGGCTGGTGAGCAGGCGGAGG - Intronic
1183385740 22:37513515-37513537 GGGGGCTGCTGGGACAGGGGAGG - Intronic
1183427296 22:37746617-37746639 GGGGGCGAGTGGGCGAGGGAAGG - Intronic
1183670401 22:39269417-39269439 GGGGTTTGGAGTGCGAGCGGGGG - Intergenic
1184086906 22:42270710-42270732 GCGGGCGGGAGGGCGCGCGGCGG + Intronic
1184101547 22:42343876-42343898 GAGGGCGGGCGGGCGGGCGGAGG + Intergenic
1184101577 22:42343944-42343966 GGGGGCGGGCGGGCGGGAGGTGG + Intergenic
1184201368 22:42971811-42971833 CGGGGCTGCTGGCCGGGCGGGGG - Intronic
1184523187 22:45007689-45007711 AGGGGCGGGTGTGCGAGCGCGGG + Intronic
1184594245 22:45504212-45504234 GGGGGCTGGAGGGGGAGGGGAGG + Intronic
1185044519 22:48522468-48522490 GGGGGCTGGTGGGCTCCCTGGGG + Intronic
1185067529 22:48639650-48639672 GGGGGCTGGTGGGGCAGTGGGGG - Intronic
1185228746 22:49668196-49668218 GGGGGCGGGGGGGCGGGCAGGGG + Intergenic
1185272322 22:49935166-49935188 GGGGGCTGGTGGTCGCGGTGGGG + Intergenic
1185374194 22:50474679-50474701 GGGGGCTGGGGGCCGAGGGCTGG - Intronic
1185388452 22:50547081-50547103 GCGGGCTCCTGGGCGAGTGGGGG - Intergenic
1203253448 22_KI270733v1_random:128447-128469 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1203261502 22_KI270733v1_random:173525-173547 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
949273761 3:2254031-2254053 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
949304229 3:2621496-2621518 GGGGGGTGGGGGGCTAGTGGAGG + Intronic
949490663 3:4585911-4585933 GGGGGCTGGGGGGCTAGGGGAGG - Intronic
949617151 3:5766281-5766303 GGGGGTTGGGGGGTGAGGGGAGG + Intergenic
949728414 3:7077571-7077593 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
949853455 3:8440231-8440253 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
950434007 3:12967750-12967772 CGGGGCCGGAGGGCGAGCTGGGG + Intronic
950434018 3:12967774-12967796 CGGGGCCGGAGGGCGAGCTGGGG + Intronic
950452497 3:13073170-13073192 GGAGGCTGGGGCGGGAGCGGGGG + Intergenic
950553860 3:13683735-13683757 GGGGGCTGGTGGGGCAACAGGGG - Intergenic
950619117 3:14188944-14188966 GGGGGCTGGGAGGCTAGGGGAGG - Intronic
950759260 3:15206227-15206249 GGCGGCTGGTGGGCGGGGCGAGG + Exonic
951168555 3:19511136-19511158 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
951424510 3:22528208-22528230 GGGGGGTGGAGGGTGAGAGGAGG - Intergenic
951503410 3:23415886-23415908 GGGGGCTGGGAGGCTAGGGGAGG - Intronic
951823549 3:26841981-26842003 AGGGGGTGGGGGGCTAGCGGAGG - Intergenic
952659492 3:35827960-35827982 GGGGGGTGGTGGGCTAGGGGAGG + Intergenic
952744494 3:36764409-36764431 CGGGGCTGGCAGGCGGGCGGCGG - Intergenic
953122501 3:40058925-40058947 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
953440160 3:42909711-42909733 GGGGGCGGCTGGCCGGGCGGAGG + Intronic
954107738 3:48418415-48418437 GCGGGCTGCTGGGCTGGCGGTGG - Intronic
954230993 3:49217492-49217514 GGGGGCTGGGGGGCTGGGGGAGG + Intronic
954713614 3:52516604-52516626 TGGGGCGGGTGGGTGAGTGGCGG + Intronic
954864685 3:53718573-53718595 GGGGGCGGGGGGGCGGGGGGTGG - Intronic
954930706 3:54278833-54278855 GGGGGATGGGGGGCAAGGGGAGG + Intronic
955089825 3:55738902-55738924 AGGGGTTGGTGGGCTAGTGGAGG - Intronic
955265262 3:57436818-57436840 GGGGGCCAGGGGGCGGGCGGGGG + Intronic
955356723 3:58237923-58237945 GGAGGCGGGCGGGCGGGCGGTGG + Intronic
955448373 3:59038125-59038147 AGGGGCTGGGGGGCTAGGGGAGG + Intronic
955464352 3:59220975-59220997 GGGGGTTGGGGGGCAAGGGGAGG - Intergenic
956001265 3:64732255-64732277 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
956051473 3:65252922-65252944 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
956269972 3:67441225-67441247 AGGGGCTGGGGGGCTAGGGGAGG + Intronic
956343125 3:68248716-68248738 GGTGGGTGGTGGGCGGGGGGCGG + Intronic
956542531 3:70357585-70357607 GGGGGCTGGGAGGCTAGGGGAGG + Intergenic
956633188 3:71336418-71336440 GGGGGGTGGAGGGCAAGGGGAGG - Intronic
956973438 3:74553078-74553100 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
957008159 3:74974110-74974132 GGGGGCTGAGGGGCAAGGGGAGG + Intergenic
957210161 3:77248605-77248627 GGGCGCAGGTGAGCGAGCGCAGG - Intronic
957384018 3:79471934-79471956 GGGGGTTGGGGGGCTAGGGGAGG + Intronic
957467716 3:80616258-80616280 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
957964394 3:87303890-87303912 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
957964500 3:87305013-87305035 GGAGGCTGGGGGGCTAGGGGAGG - Intergenic
958046713 3:88293764-88293786 GGGGGTTGGGGGGTGAGGGGAGG - Intergenic
958775485 3:98478119-98478141 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
958808331 3:98836897-98836919 GGGGGCGGCTGGCCGGGCGGGGG + Intronic
958922322 3:100121234-100121256 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
958976239 3:100670703-100670725 GGGGGCTGGGGGGCTAGGGAAGG - Intronic
959119770 3:102219559-102219581 GGGGGTTGGGGGGCAAGGGGAGG - Intronic
959415670 3:106074775-106074797 CGGGGCTGCTGGCCGGGCGGGGG + Intergenic
959453258 3:106528737-106528759 GGGGGTTGGGGGGTGAGGGGAGG + Intergenic
959763460 3:109996605-109996627 GGGGGCTGGGGGGCTGGGGGAGG - Intergenic
959807400 3:110573729-110573751 GGGGGCTGGGGGACTAGGGGAGG + Intergenic
960030017 3:113046520-113046542 CGGGGCTGCTGGCCGGGCGGGGG + Intergenic
960030065 3:113046647-113046669 CGGGGCTGCTGGCCGGGCGGGGG + Intergenic
960101207 3:113745741-113745763 GCGGGCTGAAGGGCCAGCGGAGG - Intronic
960125770 3:113996870-113996892 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
960177849 3:114537981-114538003 GGTGGCTGGGGGGCTAGGGGAGG + Intronic
960248911 3:115430742-115430764 GGGGGATGGAGGGCAAGGGGAGG + Intergenic
960503241 3:118462708-118462730 GGGGGTTGGTGGGCTAGGGGAGG + Intergenic
960887275 3:122409009-122409031 GGCGGGGGGTGGGGGAGCGGGGG - Intronic
961167101 3:124770888-124770910 GGGGGAGGGTGGGGGATCGGGGG - Intronic
961354098 3:126323647-126323669 GGGGGGTGGGGGGCCAGGGGAGG - Intergenic
961612585 3:128152927-128152949 GGGGGCGGGGGGGAGGGCGGGGG - Intronic
962010906 3:131389897-131389919 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
962787947 3:138785108-138785130 CGGGGCGGCTGGCCGAGCGGGGG - Intronic
962948988 3:140200796-140200818 GGAGGCAGGTGGGGGAGGGGAGG - Intronic
963216830 3:142757643-142757665 GGGGGATGGGGGGCAAGGGGAGG + Intronic
963428087 3:145157664-145157686 GGGGGCTGGAGGGCAAGGAGAGG + Intergenic
963768853 3:149368061-149368083 GGGGGCTGGGGGGCAAGGGGAGG + Intergenic
964351290 3:155806095-155806117 GGCGGGTGGTGGGCGCGGGGCGG - Intronic
965082683 3:164054682-164054704 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
966182223 3:177197634-177197656 GCGGGCGGGCGGGCGCGCGGGGG + Intergenic
966532680 3:180998320-180998342 GGGGGGTGGAGGGCTAGAGGAGG - Intergenic
967055321 3:185825065-185825087 GGTGGGTGGCGGGCGGGCGGAGG - Intergenic
967386126 3:188912735-188912757 GGGGGCAGGAGGGAGAGAGGGGG + Intergenic
967435646 3:189443011-189443033 TGGGGGTGGTGGGTGAGGGGAGG - Intergenic
967802542 3:193679129-193679151 GGGGCGTGGGGGGCGAGGGGAGG + Intronic
968156877 3:196388300-196388322 GGGGGCTGGGGGGCTGGGGGAGG + Intronic
968288541 3:197522062-197522084 GGGGGCTGTTGGTCAAGTGGTGG - Intronic
968520127 4:1031376-1031398 GGGGGCTGGTGGCCGCAGGGTGG + Intergenic
968661415 4:1800258-1800280 GGTGGCTGGTGGGTGGGCTGCGG + Intronic
968661762 4:1801585-1801607 GCGGGCGGGTGAGTGAGCGGAGG - Intronic
968697734 4:2041144-2041166 GTGGGGTGGGGGGGGAGCGGGGG + Intronic
968701381 4:2059666-2059688 CGGGGCAGGTGGGGGCGCGGGGG - Exonic
968702625 4:2064131-2064153 GGGGGCGGGCGGGCGAGCGGCGG - Exonic
968712697 4:2130668-2130690 GGAGGCTGGTGGGGGAGAGATGG + Intronic
968762402 4:2449493-2449515 GGGTGCTGGTGGGTCAGCGTTGG - Intronic
968808197 4:2788424-2788446 TGGGGCTGGAGGGGGAGCAGTGG - Intergenic
968815330 4:2818668-2818690 GGGCGCGGTTGGGCGGGCGGCGG + Intronic
968852723 4:3094562-3094584 CGGGGCGGGTGGCCGGGCGGGGG + Intronic
968852764 4:3094646-3094668 CGGGGCGGGTGGCCGGGCGGGGG + Intronic
968969166 4:3784509-3784531 GGGGCTTGGTGGGGGAGCTGGGG + Intergenic
969381575 4:6802539-6802561 GGGGGCTGGTGGGTTGGGGGGGG - Intronic
969559840 4:7939887-7939909 GGGGGCGGGACGGCGGGCGGCGG - Exonic
969833782 4:9821496-9821518 AGGGGCTGGGGGGCAAGAGGAGG + Intronic
970472563 4:16393137-16393159 CGGGGCGGCTGGCCGAGCGGGGG + Intergenic
970710846 4:18860152-18860174 GGGGGCAGGTGGGGGGGTGGTGG + Intergenic
970754879 4:19413863-19413885 GGGGGGGGGGGGGCGGGCGGGGG - Intergenic
971000744 4:22319407-22319429 GGGGGGTGGAGGGCTAGGGGAGG + Intergenic
971018979 4:22515795-22515817 GGGGCCTGCGGGGCGAGCGGCGG + Exonic
971085182 4:23266627-23266649 GGGGGGTGATGGGGGAGGGGAGG + Intergenic
971244053 4:24912811-24912833 AGGGGCTGGTGAGCGAGGTGAGG - Exonic
971555601 4:28010879-28010901 GGGAGCTGGTGGACGGGTGGCGG + Intergenic
972719106 4:41678077-41678099 AGGGGTTGGGGGGCTAGCGGAGG - Intronic
972760846 4:42102415-42102437 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
972953371 4:44358040-44358062 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
973016827 4:45150275-45150297 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
973149778 4:46872964-46872986 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
973313338 4:48732774-48732796 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
974323660 4:60386664-60386686 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
974403803 4:61439596-61439618 GGGGGTTGGAGGGCTAGGGGAGG - Intronic
975118447 4:70704761-70704783 GCGGGCTGTGGGCCGAGCGGCGG + Intronic
975345587 4:73289464-73289486 GGGGGCTGGGGGACTAGGGGAGG - Intergenic
975519247 4:75280855-75280877 GGGGGCTGGGAGGCAAGGGGAGG + Intergenic
976149451 4:82077952-82077974 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
976160113 4:82190118-82190140 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
976212003 4:82680985-82681007 GAGGACTGGTGGGGGAGGGGAGG - Intronic
976342605 4:83962426-83962448 GAGAGTTGGTGGGCGAGTGGTGG + Intergenic
976348291 4:84030465-84030487 GGGGGGTGGGGGGCGGGGGGAGG + Intergenic
976429889 4:84950247-84950269 GGGGGTTGGGGGGCAAGGGGAGG + Intronic
976693669 4:87895299-87895321 GGGGGCTGGGGGGCAAGGGGAGG + Intergenic
976697201 4:87929846-87929868 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
976862130 4:89677939-89677961 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
977257708 4:94758467-94758489 TGGGGCGGGAGGGCGAGCTGAGG + Intronic
977290315 4:95158959-95158981 AGGGGCTGATGGGCCAGAGGAGG + Intergenic
977325944 4:95575018-95575040 GGGGGCTGGGGGGCTAGGGGAGG - Intergenic
977339018 4:95734145-95734167 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
977711281 4:100128916-100128938 GGGGGATGGGGGGCAAGGGGAGG - Intergenic
977908350 4:102501854-102501876 TGGGGCTGGAGGGGGTGCGGAGG - Intronic
978123574 4:105110326-105110348 CGGGGCTGCTGGCCGGGCGGGGG - Intergenic
978205947 4:106081508-106081530 GGGGCCTGTTGGGGGAGCTGGGG + Intronic
978206707 4:106088926-106088948 GGGTGCTGGTGGGCGAGGGAAGG + Intronic
978299472 4:107250138-107250160 GGGGGTTGGGGGGCAAGGGGAGG + Intronic
978730081 4:112015298-112015320 GGGGGCTGGAGGGCGAGGGGAGG + Intergenic
978998078 4:115179744-115179766 GGGCGCTTGTGGGCCAGCTGGGG - Intergenic
979096680 4:116559593-116559615 GGGGGCTGGTGGGCTGGGGGAGG + Intergenic
979143051 4:117202665-117202687 GGGAGATGGCGGGCGAGAGGAGG - Intergenic
979199856 4:117964468-117964490 GGGGCCTGTTGGGGGAGGGGAGG - Intergenic
979314921 4:119251047-119251069 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
979587644 4:122440207-122440229 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
980185183 4:129452053-129452075 GGGAGCTGGGGGTCGAGGGGAGG + Intergenic
980261490 4:130455316-130455338 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
980476665 4:133327114-133327136 CGGGGCTGGGGGGCAAGGGGAGG + Intergenic
980504055 4:133691661-133691683 GGGGGATGGGGGGTGAGTGGAGG + Intergenic
980664734 4:135916541-135916563 AGGGGCTGGGGGGCTAGGGGAGG + Intergenic
980804101 4:137789640-137789662 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
980855657 4:138436120-138436142 AGGGGCTGGGGGGCAAGGGGAGG + Intergenic
981016013 4:139975208-139975230 GGAGGCTGGTGTGGGAGAGGAGG - Intronic
981395524 4:144244284-144244306 GGGGGGTGGGGGGCAAGTGGAGG - Intergenic
981432583 4:144678533-144678555 GGGGGATGGGGGGCTAGGGGAGG - Intronic
981528784 4:145733142-145733164 GGCGGCGGGTGGGCGGGCCGTGG - Intronic
981550806 4:145938509-145938531 GGGGGCGGGCGGGCGGGCAGGGG + Intronic
981779509 4:148411124-148411146 GGTGGGTGGTGGGCGGGTGGGGG - Intronic
981782542 4:148444403-148444425 GGGCGCGGGTTGGCGAGCGGAGG - Intronic
981903755 4:149895713-149895735 GGGGGATGGTGGCCCAGCAGTGG + Intergenic
982113642 4:152078678-152078700 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
982492199 4:156043484-156043506 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
982615697 4:157636610-157636632 CGGGGCTGCTGGCCGGGCGGGGG + Intergenic
982662461 4:158223554-158223576 GGAGGGTGGTGGGCAAGGGGAGG - Intronic
983051625 4:163054775-163054797 GAGGGGTGGTGGGTGAGGGGAGG - Intergenic
983179997 4:164636501-164636523 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
983400530 4:167259014-167259036 GGGGGAGGGTGGGAGAGCAGCGG + Intergenic
983479878 4:168260256-168260278 GTGGGGTGGTGGGAGAGGGGAGG - Intronic
983743446 4:171164833-171164855 TGGGGGTGGTGGGCAAGCGGAGG + Intergenic
983819720 4:172178411-172178433 GGGGGTTGAGGGGCTAGCGGAGG - Intronic
983940213 4:173529383-173529405 GGGGGCTGGGGGGTGGGGGGTGG - Exonic
983944521 4:173570302-173570324 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
984325805 4:178249011-178249033 GGGGGATGGGGGGCAAGGGGAGG - Intergenic
985122966 4:186662009-186662031 GGGGGCTGGCCGGGGGGCGGGGG - Intronic
985478408 5:92331-92353 AGGGGCGGGTGGGGGCGCGGGGG + Intergenic
985478437 5:92384-92406 AGGGGCGGGTGGGGGCGCGGGGG + Intergenic
985478476 5:92467-92489 AGGGGCGGGTGGGGGCGCGGGGG + Intergenic
985539586 5:481883-481905 CGGGGCTGGGGGGCGGGGGGGGG - Intronic
985539643 5:482038-482060 CGGGGCTGGGGGGCGGGGGGGGG - Intronic
985542132 5:492160-492182 GGGGACTCGTGGGGGAGGGGAGG + Intronic
985580463 5:693151-693173 GGGGGCTCGGGGGAGCGCGGGGG + Intronic
985697280 5:1347761-1347783 GGGGGATGGAGGGAGAGAGGAGG + Intergenic
985956705 5:3271096-3271118 GGGGGCTGCTGGGCAAGCACAGG - Intergenic
986118581 5:4806004-4806026 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
986338869 5:6773858-6773880 GGGGGTGTGTGGGGGAGCGGCGG - Intergenic
986339049 5:6774338-6774360 GGGGGTGTGTGGGGGAGCGGCGG - Intergenic
986339083 5:6774424-6774446 GGGGGTGTGTGGGGGAGCGGCGG - Intergenic
986358069 5:6948361-6948383 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
986518389 5:8587080-8587102 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
986626200 5:9725596-9725618 GGGGGCGGATGGGGGAGGGGCGG - Intergenic
986665294 5:10097291-10097313 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
987228282 5:15866654-15866676 GGGGGGTGGGGGGTGAGGGGAGG - Intronic
987548888 5:19352681-19352703 GTGGGGTAGGGGGCGAGCGGAGG - Intergenic
987600332 5:20059974-20059996 GGGGGCTGGGGGGCTAGGGGAGG + Intronic
987605772 5:20134212-20134234 GGAGGCTGGTTGGGGAGGGGTGG - Intronic
987714566 5:21550667-21550689 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
987719649 5:21617304-21617326 GGGGGCTGTTGGGGGATGGGAGG + Intergenic
987752587 5:22060317-22060339 GGGGGTTGGGGGGCAAGGGGAGG + Intronic
987934165 5:24442592-24442614 GGGGCCTGTTGGGCGGTCGGGGG - Intergenic
988240019 5:28596922-28596944 CGGGGCGGCTGGCCGAGCGGGGG + Intergenic
988369278 5:30346009-30346031 GGGGGCCGGGGGGGGCGCGGGGG - Intergenic
988479201 5:31615416-31615438 GGGGGGTGGGGGGCTAGCAGAGG - Intergenic
988820269 5:34876837-34876859 GGGGGCTGGGGGGCTGGGGGAGG + Intronic
989009423 5:36853263-36853285 GGGGGGTGGGGGGCTAGAGGAGG + Intergenic
989083508 5:37651104-37651126 GGGGGATGGAGGGCTAGGGGAGG - Intronic
989178752 5:38556302-38556324 GGGGGCGGGTGGGCGCGGCGCGG - Intronic
989246514 5:39261175-39261197 GGGGGATGGGGAGCGAGGGGAGG + Intronic
989461449 5:41704147-41704169 GGAGGCTGGGGGGCTAGGGGAGG - Intergenic
990102928 5:52215560-52215582 GGGGGATGGGGGGCTAGAGGAGG - Intergenic
990533062 5:56693373-56693395 GGGGACTGGTGGGCGAGCGGTGG - Intergenic
990726095 5:58756521-58756543 GGGGGGTGGGGGGCCAGGGGAGG - Intronic
990810450 5:59716381-59716403 GGGAGTTGGTGGGCAAGTGGCGG - Intronic
990909242 5:60837309-60837331 GGGGGGTGGGGGGGGAGTGGGGG + Intronic
991040586 5:62171257-62171279 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
991073580 5:62513239-62513261 CGGGGCGGGTGGCCGGGCGGGGG + Intronic
991100246 5:62784068-62784090 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
991523137 5:67523652-67523674 GGGGGCTGGAGGGCTAGGGGAGG - Intergenic
991537935 5:67693686-67693708 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
991539933 5:67716285-67716307 GGGGACTGGAGGGTGAGGGGAGG + Intergenic
991579909 5:68143946-68143968 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
991749034 5:69779389-69779411 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
991800616 5:70359200-70359222 GGGGGCTGGGGGGCAAGGGGAGG - Intergenic
991827984 5:70650841-70650863 GGGGGCTGGGGGGCAAGGGGAGG + Intergenic
991892974 5:71358640-71358662 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
992054686 5:72976764-72976786 GGGGGCTGGGGGGCTGGGGGAGG - Intronic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
992574682 5:78097297-78097319 CGGGGCTGCTGGCCGGGCGGGGG - Intronic
993059733 5:83024827-83024849 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
993080969 5:83300722-83300744 GGGGGGTGGGGGGCAAGAGGAGG - Intronic
993201595 5:84822937-84822959 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
993433096 5:87856543-87856565 GGGGGGTGGAGGGCTAGTGGAGG - Intergenic
993586800 5:89741353-89741375 GGGAGGTGGTGGGCGAGGGGAGG - Intergenic
993821066 5:92617627-92617649 GGGGGCTGGGGGGTGAGGGGAGG - Intergenic
993963890 5:94336402-94336424 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
994109190 5:95981131-95981153 GTGGGCTGGTTGGTGAGCTGAGG + Intergenic
994219534 5:97179811-97179833 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
994232843 5:97329132-97329154 AGGGGGTGGGGGGCGAGGGGAGG - Intergenic
994415505 5:99464693-99464715 GGGGGCTGGGGGGCTAGGGGAGG + Intergenic
994566566 5:101453975-101453997 GGGGGCTGGGGGGAAAGGGGAGG + Intergenic
994605980 5:101967443-101967465 GGGGGCTGGGGGGCTAGGGGAGG - Intergenic
994865375 5:105262102-105262124 TGGGGCTGGTTGGGGAGGGGTGG + Intergenic
994981240 5:106876609-106876631 GGGAGTTGGTGGGCCAGTGGTGG + Intergenic
995052723 5:107724745-107724767 GCGGGCAGGTGGGCGGGAGGCGG - Intergenic
995108864 5:108405533-108405555 GTGGGCTGGGGGGCTAGGGGAGG + Intergenic
995142573 5:108749387-108749409 GGGGGCTGATGGGCGTGAGGCGG + Intronic
995262994 5:110127453-110127475 AGGGGCTGGGGGGCAAGGGGAGG - Intergenic
995612671 5:113926549-113926571 GGGGGGTGGGGGGCTAGAGGAGG + Intergenic
995621166 5:114027228-114027250 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
995643759 5:114287597-114287619 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
995684477 5:114757344-114757366 GGGGGCTAGAGGGTGGGCGGTGG - Intergenic
995893639 5:116985744-116985766 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
996878530 5:128266962-128266984 GGGGGTTGGGGGGCGAGGGGAGG - Intronic
996966725 5:129315129-129315151 GGGGGGTGGTGGGCTAGGGTAGG - Intergenic
997003937 5:129796839-129796861 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
997585344 5:135040134-135040156 GGGGGCTGGTGGTCGAGTTTGGG + Intronic
998026389 5:138819853-138819875 GGGGGCGGGGGGGTGAGTGGGGG + Intronic
998502858 5:142648506-142648528 GGGGGTTGGGGGGCTAGGGGAGG + Intronic
998580785 5:143373461-143373483 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
999133569 5:149302433-149302455 GGAGGCTTGTTGGGGAGCGGTGG - Exonic
999665855 5:153912240-153912262 GGAGGATGGTGGGTGAGAGGAGG - Intergenic
999737519 5:154523782-154523804 GAGGGCTGGGGGGCGGGCAGAGG - Intergenic
999797030 5:154998383-154998405 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
999873519 5:155776641-155776663 GGGGGCTGGAGGTGGGGCGGGGG - Intergenic
1000021872 5:157325249-157325271 GTGGGCTGGTGGGGGAGAAGAGG - Intronic
1000074281 5:157770463-157770485 GGTGGCGGGTGGGGGAGCGGGGG + Intergenic
1001117916 5:168955089-168955111 GGGGGGTGGTGGGGGTGGGGTGG + Intronic
1001345821 5:170897552-170897574 GGGGGTTGGGGGGCTAGGGGAGG - Intronic
1001403059 5:171457644-171457666 GGTGGCTGGTGGCAGGGCGGGGG + Intergenic
1001992791 5:176132477-176132499 GGGTGCTGGTGGGGCAGGGGTGG + Intergenic
1002007383 5:176246751-176246773 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1002037175 5:176480807-176480829 GGGGGCTGGGGGGCTAGGGGAGG + Intronic
1002218997 5:177663875-177663897 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1002522804 5:179800770-179800792 GGGACCTGGTGGGGGAGGGGTGG - Intronic
1002691377 5:181053014-181053036 GGGGGCGGGGGCGCGCGCGGCGG - Intronic
1002772787 6:303843-303865 GGGGGCTGGAGGTGGAGAGGAGG + Intronic
1002851925 6:1003993-1004015 GGGAGCAGGCGGGCGAGCGAGGG - Intergenic
1002927095 6:1611028-1611050 GGGGGCTGGCGGCCGGGCGGGGG - Exonic
1002955608 6:1860453-1860475 GGGGGCTGGGGAGAGAGAGGAGG + Intronic
1003046511 6:2737972-2737994 GGGGGCGGGTGGGGGGGGGGTGG + Intronic
1003280312 6:4685614-4685636 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1004044625 6:12012244-12012266 GGGGGCGGGGGGGGGAGCGCGGG - Intronic
1004102891 6:12633042-12633064 GGGGGGTGGTGTGTGAGGGGAGG - Intergenic
1004103426 6:12639513-12639535 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1004205113 6:13585384-13585406 GGGGGGTGGTGGGCTTGGGGAGG - Intronic
1004231138 6:13834386-13834408 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1004326495 6:14678752-14678774 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1004414847 6:15415571-15415593 CGGGGCTGCTGGCCGGGCGGGGG + Intronic
1004716688 6:18223331-18223353 GGGGGGCGGGGGGCGGGCGGTGG - Exonic
1004799009 6:19124733-19124755 TGGGGGTGGTGGGCAAGGGGAGG + Intergenic
1004924433 6:20403585-20403607 GGGCGCTGGAGGGGGAGAGGGGG + Intronic
1005606670 6:27484758-27484780 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
1005892383 6:30150545-30150567 GGGGGCTGGAAGGAGAGGGGAGG + Intergenic
1005929867 6:30475370-30475392 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1006095195 6:31651972-31651994 GGGAGCTGGAGGACGAGAGGTGG + Intronic
1006215055 6:32434341-32434363 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1006337623 6:33428590-33428612 GGGGGCTGTTGGGCCAGCCACGG + Intronic
1006366858 6:33621233-33621255 GGGTGCCGGCGGGCGAGCTGCGG + Exonic
1006654254 6:35576674-35576696 GGGGCCCGGGGGGCGGGCGGGGG + Intronic
1007101666 6:39252131-39252153 GGGGGGTGGTAGGTGAGGGGAGG - Intergenic
1007298490 6:40847350-40847372 GGGGGGTGGAGGGCTAGGGGAGG + Intergenic
1007610706 6:43147077-43147099 GGGGCCTGCTGGGCTAGCTGTGG + Intronic
1007844848 6:44745451-44745473 GGGGGATGGGGGGCTAGGGGAGG - Intergenic
1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG + Exonic
1008104278 6:47425744-47425766 GGGGGGTGGGGGGCAAGGGGCGG - Intergenic
1008201024 6:48591171-48591193 GGGGGCTGGTGAGCAAGGGGAGG - Intergenic
1008395097 6:50997085-50997107 GGAGGCTGGGGGGCTAGGGGAGG - Intergenic
1008643693 6:53491247-53491269 GGGGGTGGGTGGGCTAGGGGAGG - Intergenic
1009573352 6:65418706-65418728 GGGGGTTGGTAGGTGAGGGGAGG + Intronic
1009592526 6:65690722-65690744 GTGGGCTGGGGGGCTAGAGGAGG - Intronic
1009756516 6:67947299-67947321 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1009821829 6:68812816-68812838 GGGGGTTGGGGGGCTAGGGGAGG - Intronic
1010038582 6:71355488-71355510 GGGGGCTGGGGGGCTAGGAGAGG - Intergenic
1010096628 6:72054068-72054090 GGGGGGTGGTGGGCAAGGGGAGG - Intronic
1010245022 6:73654269-73654291 GGGGGCTTGCGGGCGGGCAGTGG + Intergenic
1010583503 6:77628507-77628529 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1010679903 6:78786754-78786776 GGGGGCTGGGGGGAAAGGGGAGG - Intergenic
1010762648 6:79741292-79741314 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1010878275 6:81136546-81136568 GGGGGGTGGTGGGCTAGGAGAGG + Intergenic
1010879203 6:81147479-81147501 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1010933704 6:81835164-81835186 GGGGGCTGGGGGGCTATGGGAGG - Intergenic
1011080514 6:83485752-83485774 GGGGGCTGGGGGGCAATGGGAGG + Intergenic
1011101696 6:83729037-83729059 GGGGGTTGGGGGGCGGGGGGAGG + Intergenic
1011136852 6:84109743-84109765 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1011398029 6:86930969-86930991 GGGGGATGGAGGGCTAGGGGAGG - Intergenic
1011405855 6:87014803-87014825 GGGGGGTGGAGGGCTAGGGGAGG + Intronic
1011474479 6:87737455-87737477 GGGGGCAGGTGGGAGAGTGAGGG - Intergenic
1011766858 6:90629559-90629581 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
1011975019 6:93284845-93284867 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1011985371 6:93436894-93436916 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1012475139 6:99608757-99608779 GGGAGCTGGTGGACGAGTCGGGG + Exonic
1012487076 6:99734376-99734398 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1012550960 6:100464571-100464593 CGGGGCTGCTGGGCGGGCGCGGG + Intronic
1012554674 6:100497243-100497265 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1012577335 6:100819164-100819186 GGGGGCTGGGGGGCTGGGGGAGG + Intronic
1012591964 6:100992738-100992760 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1012778783 6:103530030-103530052 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1013168576 6:107616078-107616100 GGGGGGTGGGGGGGGGGCGGGGG + Intronic
1013200067 6:107886000-107886022 GGGTGGTGGTGGGCTAGGGGAGG - Intronic
1013310688 6:108890897-108890919 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1013453311 6:110306155-110306177 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1013472416 6:110476843-110476865 CGGGGCGGGTGGGAGAGCGGCGG - Intergenic
1013625102 6:111929146-111929168 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1014070924 6:117180836-117180858 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1014149538 6:118037868-118037890 GGGGGGTGGGGGGCAAGAGGAGG + Intronic
1014480844 6:121935030-121935052 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1014561081 6:122891586-122891608 GGGGGCTGAGGGGCAAGGGGAGG - Intergenic
1014666381 6:124242887-124242909 AGGGGCTGGGGGGCTAGGGGAGG + Intronic
1014691092 6:124564487-124564509 GCTGGCTGGTGGGGGAGGGGGGG - Intronic
1014754202 6:125285163-125285185 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1015063492 6:128997119-128997141 GGGGCCTGTTGGGGGAGGGGTGG + Intronic
1015472407 6:133620585-133620607 GGGGGCTGGTAGGCTAAAGGAGG + Intergenic
1015709680 6:136126266-136126288 GGGGGGTTGTGGGTGAGAGGAGG - Intronic
1015747507 6:136526184-136526206 GGGGGCTGGTAGGGGAGGTGGGG - Intronic
1015802639 6:137076148-137076170 GGGGGTTGGGGGGCTAGAGGAGG + Intergenic
1015860254 6:137670013-137670035 GGGGTCTGTTGGGGGAGCTGTGG - Intergenic
1015992278 6:138958489-138958511 GGGGAGTGGGGGGCGAGGGGAGG - Intronic
1016238418 6:141896699-141896721 GGGGGGTTGTGGGCAAGGGGAGG + Intergenic
1016275478 6:142346874-142346896 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1016329020 6:142936475-142936497 AGGTGCTGGTGGTCGGGCGGTGG - Intronic
1016482943 6:144502401-144502423 GGGGGCTGGGGGGCTAGGGGAGG - Intronic
1017057433 6:150450370-150450392 GGGGGGTGGAGGGCTAGGGGAGG + Intergenic
1017792770 6:157815887-157815909 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1017809014 6:157970726-157970748 GGGGGCTGTGGGGTGAGGGGAGG + Intergenic
1017846326 6:158261718-158261740 GGAGGCTGGTGGGCGTGGGCTGG + Intronic
1017888707 6:158621944-158621966 CAGGGCAGGTGGGCGAGCTGCGG - Intronic
1017963152 6:159239755-159239777 GGCGGGTGGTGGTCGTGCGGCGG - Exonic
1018020950 6:159761965-159761987 GGGAGGTGGAGGGCGAGGGGCGG + Exonic
1018203429 6:161415603-161415625 GGGGGCTGGCGGGGGGTCGGGGG - Intronic
1018582437 6:165318696-165318718 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1018643512 6:165927076-165927098 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1018677566 6:166236121-166236143 GGCGGCTGGTGGGCAGGGGGTGG - Intergenic
1018767265 6:166944456-166944478 GGGGGCTGGAGGGGAAGAGGAGG - Intronic
1018827056 6:167416052-167416074 GGGGGCTGGTGGGCTGCCTGAGG + Intergenic
1018840683 6:167514302-167514324 GGGGGGTGCTGGGGGAGCTGGGG + Intergenic
1019101608 6:169635234-169635256 GGGGGCAGGTGGGGGAAGGGGGG + Intronic
1019472591 7:1229536-1229558 CGGGGCTGGCGGGCCAGAGGGGG + Intergenic
1019494767 7:1332569-1332591 GGGGGCTGCGGGGGGAGCTGTGG - Intergenic
1019564546 7:1672917-1672939 GGGGGCCGGTGGCGGGGCGGGGG + Intergenic
1019693942 7:2434099-2434121 GCGGGCGGGTGGGCGGGCGGAGG - Exonic
1019793086 7:3029960-3029982 GGGGGTTGGGGGGCAAGGGGAGG + Intronic
1019981419 7:4624289-4624311 CGGGGCTGCTGGCCGGGCGGGGG - Intergenic
1020212069 7:6165066-6165088 TGGGGCTGGTGGGAAAGGGGAGG - Intronic
1020344851 7:7151973-7151995 GGGGGGTAGTGGGGGAGGGGAGG - Intergenic
1020831741 7:13102835-13102857 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1020854216 7:13396757-13396779 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1020913416 7:14161665-14161687 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1021099782 7:16574647-16574669 GGGGGCTGGAGGGCTGGGGGAGG + Intronic
1021104048 7:16616725-16616747 GAGGGCTGGGGGACCAGCGGAGG + Intronic
1021378430 7:19937344-19937366 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1021381899 7:19977784-19977806 GGGGGCTGGGGGGCTAGGGGAGG + Intergenic
1021385633 7:20026342-20026364 GGGGGCTGTGGGGCTAGTGGAGG + Intergenic
1021991889 7:26148259-26148281 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1021991912 7:26148306-26148328 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1021991935 7:26148353-26148375 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1022635202 7:32125717-32125739 GGGGGTTGGGGGGCGAGGGGAGG + Intronic
1022916470 7:34959713-34959735 GGGGGCTGGGGGGCTAGGGGAGG + Intronic
1023273166 7:38488519-38488541 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1023311279 7:38888955-38888977 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1024034654 7:45497098-45497120 GGTGGCTGGTGGGGGAGTGGAGG - Intergenic
1024308285 7:47946304-47946326 AGGGGCTGGGGGGCAAGGGGAGG + Intronic
1024566898 7:50688775-50688797 GGGGTCGGGTGGGTGAGGGGGGG + Intronic
1024660271 7:51486505-51486527 GGGGGGTGGGGGGCAAGAGGAGG - Intergenic
1024885252 7:54134893-54134915 GGAGGGTGGGGGGCGAGGGGAGG - Intergenic
1025174059 7:56787798-56787820 TGGGGCTGGGGAGCGCGCGGTGG - Intergenic
1025206383 7:56995701-56995723 GGGGGCTGGGAGGAGAGGGGAGG + Intergenic
1025698042 7:63790157-63790179 TGGGGCTGGGGAGCGCGCGGTGG + Intergenic
1026048047 7:66921468-66921490 CGGGGCTGGAGGGCGGGCTGGGG + Intronic
1026152621 7:67801069-67801091 GGGGGATGGGGGGCTAGGGGAGG + Intergenic
1026236936 7:68535125-68535147 GGGGGGTGGTGGGCGGCGGGGGG + Intergenic
1026236947 7:68535144-68535166 GGGGGGTGGTGGGCGGCGGGGGG + Intergenic
1026236957 7:68535164-68535186 GGGAGGTGGTGGGCGGGGGGTGG + Intergenic
1026429819 7:70333806-70333828 GGGGGGTGGAGGGCTAGGGGAGG + Intronic
1026844955 7:73693542-73693564 GGGTGCGGGTGGGGGAGCTGAGG + Intronic
1027087504 7:75275067-75275089 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1027134506 7:75614551-75614573 GGGGCCTGGTAGGAGAGGGGTGG + Intronic
1027337833 7:77173086-77173108 GGGGGTTGGGGGCCGAGGGGAGG + Intronic
1027732428 7:81891789-81891811 AGGGGCTGGTGGGGGAGAGATGG + Intergenic
1027945127 7:84734660-84734682 GGGGGATGGGGGGTGAGGGGAGG + Intergenic
1028027219 7:85859796-85859818 GTGGGGTGGTGGGCGGGAGGAGG - Intergenic
1028116782 7:87006373-87006395 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1028227423 7:88266536-88266558 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
1028567073 7:92245726-92245748 GGGCGCGGGTGGGAGCGCGGGGG - Intronic
1028641179 7:93043639-93043661 GGGGGCTGCGGAGCGGGCGGGGG + Intergenic
1028659403 7:93251516-93251538 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1029157335 7:98526489-98526511 GGGGGCTAGTGGGCCAGAGGAGG + Intergenic
1029175720 7:98663041-98663063 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1029400474 7:100342288-100342310 AGGGGCAGGTGGGGGAGGGGAGG - Intronic
1029460085 7:100689354-100689376 GGAGGCTGATGGGGGCGCGGCGG + Exonic
1029496334 7:100897057-100897079 GGGCGCTGCGGGGCGCGCGGCGG - Intergenic
1029502433 7:100940750-100940772 GGGGGCTGGCGGGCTGGGGGAGG - Intergenic
1029871094 7:103693344-103693366 GGGGGTTGGGGGGCAAGGGGAGG + Intronic
1030455067 7:109762071-109762093 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1030462567 7:109858668-109858690 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1030549210 7:110937052-110937074 GGGGGTTTGAGGGCTAGCGGGGG + Intronic
1030573537 7:111257923-111257945 GGGGGCTGGGGGGCTGGGGGAGG - Intronic
1030897221 7:115075875-115075897 GGGGGGTGGGGGGCTAGTGGAGG - Intergenic
1030963795 7:115963004-115963026 CGGGGCTGGTCGGGGAGAGGGGG - Intronic
1031043396 7:116862393-116862415 GGCGCCTGGTGGCCGGGCGGGGG - Intronic
1031856421 7:126928224-126928246 GGGGGGTGGGGGGCAAGGGGAGG + Intronic
1031878481 7:127168858-127168880 GGGGGCTGAGGGGCCAGGGGAGG + Intronic
1032423530 7:131802231-131802253 GGGGGCTGGTGGGGGAGCAGAGG - Intergenic
1032717314 7:134520621-134520643 GGGGGCTGGGGAGCTAGGGGAGG + Intergenic
1033154706 7:138946970-138946992 GGGGGCTGCTGGGAGACCAGGGG - Intronic
1033227472 7:139573046-139573068 GGTGGATGGTGGGCGAGGGCAGG + Exonic
1033571771 7:142636476-142636498 GGGGGATGGAGGGCTAGGGGAGG + Intergenic
1033598169 7:142871040-142871062 GGGGGCTGGTGGAGAGGCGGAGG - Exonic
1033762084 7:144446578-144446600 GGGGGTTGGTGGGCAATGGGAGG + Intergenic
1034004869 7:147459991-147460013 AGGGGATGGTGGGCTAGGGGCGG + Intronic
1034270992 7:149803387-149803409 GGGGGCTGGTGGGCCTGTGTGGG - Intergenic
1034456692 7:151174568-151174590 GGGTGCGGGTGGGCAAGCGGTGG - Intronic
1034456751 7:151174783-151174805 GGGGCCTGGAGGGCGCGAGGCGG - Intergenic
1035013245 7:155739820-155739842 GGGGGCTGGTGCTGGGGCGGGGG - Exonic
1035122371 7:156579241-156579263 GGGAGGTGGTGGGGGGGCGGGGG + Intergenic
1035169603 7:157010193-157010215 GGCGGCGGCGGGGCGAGCGGCGG - Exonic
1035181122 7:157090430-157090452 AGGGGCTGGAGGGAGAGAGGAGG + Intergenic
1035535735 8:389904-389926 AGAGGCTGGTGGGGGAGCAGAGG - Intergenic
1035774536 8:2177990-2178012 GGAGGGTGGTGGGCGGGAGGAGG + Intergenic
1035812345 8:2503338-2503360 GAGGGCAGGTGGGCGGACGGGGG + Intergenic
1036131521 8:6118580-6118602 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1036651131 8:10644720-10644742 GGTGGCTGGTGTGAGAGCTGTGG - Intronic
1036737220 8:11330115-11330137 CGGGGCTGCTGGCCGGGCGGGGG - Intergenic
1037238679 8:16752156-16752178 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1037261966 8:17019636-17019658 GGGGGGTGGTGGGCGTGGGGTGG - Intergenic
1037459694 8:19096529-19096551 GAGGGGTGGTGGGTGAGCAGGGG + Intergenic
1037531931 8:19784701-19784723 GGGGGCTGGGGGGCAAGGGGAGG + Intergenic
1037739783 8:21599032-21599054 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1037768966 8:21788022-21788044 GGGGGCTGGCGGGAGGTCGGCGG - Intronic
1037834828 8:22209705-22209727 GGGGCCAGGAGGGCGAGGGGTGG - Intronic
1038091742 8:24262067-24262089 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1038101421 8:24381294-24381316 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1038271236 8:26077889-26077911 GGGGGCTGCTTGGAGAGCAGAGG - Intergenic
1038358671 8:26855578-26855600 GGGGGTTGGGGGGCAAGAGGAGG + Intronic
1038500150 8:28037115-28037137 GGGAGTTGGTGAGCGAGTGGCGG - Intronic
1039199292 8:35070545-35070567 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1039402786 8:37285241-37285263 GGGGGGCGGTGGGTGAGGGGAGG + Intergenic
1039454239 8:37697078-37697100 GAGGCCTGCGGGGCGAGCGGGGG - Intronic
1039567976 8:38564742-38564764 GGGGGCCGGTGGGGGGCCGGTGG - Intergenic
1039631884 8:39121449-39121471 GGGGGGTGGAGGGCTAGGGGAGG + Intronic
1039777713 8:40753036-40753058 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1039830934 8:41213734-41213756 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1040355499 8:46613879-46613901 AGGGGGTGGTGGGCTAGGGGAGG + Intergenic
1040484392 8:47856223-47856245 GGGGGGTGGTGGTGGAGCTGGGG + Intronic
1040673128 8:49716249-49716271 GAGGGCTAGTGGGCGACCTGAGG - Intergenic
1040737094 8:50521267-50521289 GGGGGCTGGGGGTCTAGGGGAGG + Intronic
1041113004 8:54504912-54504934 GGGGGTTTGGGGGCGAGGGGAGG + Intergenic
1041270273 8:56104253-56104275 GGGGGCGGCTGGCCGGGCGGGGG + Intergenic
1041438549 8:57868730-57868752 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1041523103 8:58776500-58776522 AGGGGCTGCTGGCCGGGCGGGGG - Intergenic
1041677197 8:60548618-60548640 TGGGGCGGCTGGCCGAGCGGGGG + Intronic
1041882747 8:62770886-62770908 GGAGGCTGGTGGGCGGGGGGTGG + Intronic
1041987103 8:63935263-63935285 GGGGGCTAGGGGGCTAGGGGAGG - Intergenic
1042116093 8:65433158-65433180 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1042170359 8:65985310-65985332 GGGGGGTGGGAGGCGAGGGGTGG + Intergenic
1042326558 8:67534859-67534881 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1042902797 8:73746247-73746269 GGGCGCTGGAGGCGGAGCGGCGG - Intronic
1043247668 8:78025954-78025976 TGGTGATGGTGGGGGAGCGGGGG + Intergenic
1043354967 8:79401554-79401576 GGGGGTTCGTGGGGGGGCGGGGG - Intergenic
1043646671 8:82530209-82530231 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1044284215 8:90392748-90392770 GGGGGCTGGAGAGCAAGGGGAGG + Intergenic
1044732721 8:95243634-95243656 GGGGGCTAGGGGGCTAGGGGAGG + Intergenic
1045068701 8:98477708-98477730 GGGGGGGGGTGGGCGGGGGGGGG + Intronic
1045305275 8:100952207-100952229 CCGCGCTGGAGGGCGAGCGGAGG + Intronic
1045391181 8:101716318-101716340 GGGGGGTGGTGGGCAAGGGGAGG + Intronic
1045496320 8:102712488-102712510 TGGGGATGGTGGGCGGGGGGGGG - Intergenic
1045547302 8:103140599-103140621 GGGAGGGGGCGGGCGAGCGGGGG + Intronic
1045701706 8:104873792-104873814 GGGGGGCGGTGGGGGGGCGGCGG + Intronic
1045839897 8:106566964-106566986 GGGGGTTGGAGGGCAAGGGGAGG + Intronic
1045952979 8:107872843-107872865 GGGGGGTGGAGGGTGAGTGGAGG - Intergenic
1046073158 8:109282681-109282703 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1046260612 8:111762712-111762734 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1046382137 8:113465191-113465213 GGGGCCTGTTGGGGGATCGGGGG + Intergenic
1046547309 8:115668488-115668510 GGGGGCTGCGGGGGGCGCGGGGG - Intronic
1047178522 8:122565370-122565392 GGGGGCTGGGGGGCTGGCGGAGG + Intergenic
1047369005 8:124239720-124239742 GGGGGATGGAGGGCAAGGGGAGG - Intergenic
1047499605 8:125431088-125431110 GCGGGCTGCAGGGCGAGCCGGGG - Exonic
1047649258 8:126901733-126901755 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1047744641 8:127835445-127835467 GGGGGATGGGGGGCAAGGGGAGG + Intergenic
1047892852 8:129331589-129331611 GGTGGGTGGGGGGCTAGCGGAGG + Intergenic
1048214297 8:132481002-132481024 GGGCGCGGGTGGGAGCGCGGAGG - Intergenic
1048490524 8:134888068-134888090 GGGGCCTGGAGGGCGAGGTGGGG - Intergenic
1048533192 8:135269469-135269491 GGGGAATGGGGGGCGCGCGGTGG - Intergenic
1048756002 8:137738878-137738900 GGGGGGTGGTGGACTAGGGGAGG - Intergenic
1048868404 8:138777510-138777532 GGGGGGTGGTGGGCAAGGGGAGG - Intronic
1048926857 8:139279018-139279040 GGGGGGTGGAGGGTGAGGGGAGG + Intergenic
1049179129 8:141212133-141212155 GTGGGCGGGCGGGCGGGCGGCGG - Intronic
1049204633 8:141358033-141358055 GGGGGATGCTGGGCGTGCAGGGG - Intronic
1049432465 8:142571674-142571696 GTGGGCCTGTGGGGGAGCGGGGG - Intergenic
1049620917 8:143597968-143597990 GGGGGCTGGGGCGGGCGCGGGGG - Exonic
1049639345 8:143707607-143707629 CGGGGCTGGTGGCCGGGCCGGGG - Intronic
1049745960 8:144263440-144263462 GGGGGCTGGGGAGCCAGGGGTGG - Intronic
1049867872 8:144950633-144950655 GGGGGGTTGTGGGAGCGCGGGGG - Intronic
1050033676 9:1412875-1412897 GAGGGATGGTGGGAGATCGGAGG + Intergenic
1050855180 9:10345408-10345430 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1050865006 9:10487701-10487723 GGGGGGTGGAGGGTGAGGGGAGG + Intronic
1051926172 9:22329554-22329576 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1052146590 9:25058288-25058310 AGGGGATGGGGGGCAAGCGGAGG - Intergenic
1052416373 9:28183303-28183325 GAGGGGTGGGGGGCGAGGGGAGG + Intronic
1052539793 9:29795823-29795845 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1052579886 9:30341754-30341776 GGGGGGTGGAGGGCTAGGGGAGG - Intergenic
1052599748 9:30610237-30610259 GGGGGCTGGGGGGCTAGGGGAGG + Intergenic
1052657591 9:31382847-31382869 GGGGGATGGGGGGCTAGGGGAGG - Intergenic
1052854912 9:33401201-33401223 GGGGGCTGGAGGGTGAGAAGAGG + Intronic
1052884298 9:33628691-33628713 GGGGGATGGAGGGCTAGGGGAGG + Intergenic
1053028237 9:34749765-34749787 GGGGGATGGGGGGCAAGGGGAGG - Intergenic
1053129073 9:35605294-35605316 GCGGGCGGGCGGGCGGGCGGCGG - Exonic
1053438437 9:38093955-38093977 GGGGGCATGTGGGAGAGCGCTGG + Intergenic
1053489440 9:38487994-38488016 GGTGGGTGGTGGAGGAGCGGCGG + Intergenic
1053682934 9:40497530-40497552 GGGGGCTGGAGGGTGAGAAGAGG + Intergenic
1053932915 9:43125844-43125866 GGGGGCTGGAGGGTGAGAAGAGG + Intergenic
1054280780 9:63127398-63127420 GGGGGCTGGAGGGTGAGAAGAGG - Intergenic
1054394050 9:64637525-64637547 GGGGGCTGGAGGGTGAGAAGAGG + Intergenic
1054501680 9:65878805-65878827 GGGGGCTGGAGGGTGAGAAGAGG - Intronic
1055030622 9:71768900-71768922 GCGGGCGGGCGGGCGGGCGGTGG + Intronic
1055074174 9:72196734-72196756 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1055177484 9:73337492-73337514 GGGGGGTGGAGGGCAAGTGGAGG + Intergenic
1055244685 9:74225298-74225320 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1055338122 9:75253614-75253636 GGGGGCTGGTGGGGAGGTGGAGG - Intergenic
1055403386 9:75948301-75948323 GGGGGTGGGGGGGCGAGGGGAGG - Intronic
1055408297 9:75999202-75999224 GGGGGCTGGGGGGCTAGGGGAGG - Intronic
1055481873 9:76716801-76716823 GGGGGTTGGGGGGCGAGGGGAGG - Intronic
1055580843 9:77705043-77705065 GGGGGCTAGGGGGCTAGGGGAGG - Intergenic
1055637974 9:78296699-78296721 GGGGGCTGGTGGTGGAGAGGTGG + Intergenic
1055949680 9:81719292-81719314 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1055982252 9:82015735-82015757 GTGGGGTGGGGGGAGAGCGGAGG - Intergenic
1056332847 9:85535974-85535996 GGAGGCTGGTAGGCGAGGAGAGG - Intergenic
1057117441 9:92539338-92539360 GGTGGGGGGTGGGGGAGCGGGGG - Intronic
1057751626 9:97796934-97796956 CGGGGCGGGTGGCCGGGCGGGGG - Intergenic
1057802884 9:98200555-98200577 GCGGGGTGGTGGGGGGGCGGGGG + Intronic
1057875417 9:98749946-98749968 GGAGGCTGGTGGGCCTGTGGAGG + Intronic
1057894004 9:98891667-98891689 GGGGGCTGGGGGGCTAGGGAAGG + Intergenic
1058034014 9:100231499-100231521 GGGGGGTGGGGGGCAAGGGGAGG - Intronic
1058225094 9:102350398-102350420 GGGGGCTGGGGGGCGCAGGGAGG + Intergenic
1058559454 9:106209586-106209608 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1058661361 9:107271770-107271792 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1058819798 9:108719431-108719453 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1059053707 9:110956237-110956259 GGGGGTTGGGGGGCTAGGGGAGG + Intronic
1059178509 9:112189869-112189891 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1060516000 9:124266142-124266164 TGGGGCCGGTGGGTGAGAGGTGG + Intronic
1060817722 9:126644125-126644147 CGGGGCTGGTGGGCCCGCGCTGG + Intronic
1060993567 9:127862502-127862524 GGGGGGTGGGGGGAGAGCAGGGG + Intergenic
1061368658 9:130185807-130185829 GTGGGCTGCTGGGCGCGCAGGGG - Intronic
1061609796 9:131739197-131739219 GAGGGCAGGTGGGGGACCGGTGG - Intronic
1061632722 9:131883329-131883351 GGGGACTGGTGGGGGTGTGGCGG + Intronic
1061635870 9:131908139-131908161 CGGGGCGGCTGGCCGAGCGGGGG - Intronic
1061673498 9:132202403-132202425 GGGGGCAGGTGGGCTGCCGGTGG + Intronic
1061673889 9:132204446-132204468 GTGGGCAGGTGGGCGCGGGGAGG + Intronic
1062022671 9:134326701-134326723 GGGGGCCGGCGGGCGGGAGGGGG + Intronic
1062054459 9:134463712-134463734 GGGGGATGGGGGGCGTGCAGAGG - Intergenic
1062086188 9:134650034-134650056 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1062222495 9:135424964-135424986 GGAGGCTGGGGGGCGGGGGGTGG - Intergenic
1062402275 9:136377954-136377976 AGTGGCTGGGGGGCCAGCGGGGG - Exonic
1062421276 9:136483777-136483799 GGAGGCTGGAGGGCAGGCGGCGG + Exonic
1062443934 9:136585534-136585556 GGTGGCTGGAGGGCGAGGGCAGG + Intergenic
1062556162 9:137114267-137114289 CGGAGCTGGCGGCCGAGCGGGGG - Exonic
1062565567 9:137162574-137162596 GGGCGCCTGTGGGCGGGCGGGGG - Exonic
1062574452 9:137199916-137199938 CGGGGCTGGGGGGCGGGTGGAGG + Exonic
1062653430 9:137590129-137590151 GGGGGCGGTTGTGCGGGCGGCGG - Intronic
1203469848 Un_GL000220v1:111594-111616 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1203477669 Un_GL000220v1:155566-155588 GGGCGGTGGTGGGCCCGCGGGGG + Intergenic
1203361316 Un_KI270442v1:220827-220849 TGGGCCTGGTGGGCGCCCGGAGG - Intergenic
1185453035 X:292967-292989 GGGGGCACCTGGGAGAGCGGAGG - Intronic
1185461674 X:335502-335524 GGCGGCTGATGGGGGAGCAGGGG + Intronic
1185657852 X:1700572-1700594 GGGGGCTGGGGGGCAAGGGGAGG - Intergenic
1185689103 X:2138693-2138715 GGGGGCGGGGGGGGGGGCGGGGG - Intergenic
1185807272 X:3070048-3070070 GGGAGCTGGGGGGCCAGTGGAGG - Intronic
1185988202 X:4860302-4860324 GGGGGATGAGGGGCGAGGGGAGG + Intergenic
1186519243 X:10191180-10191202 GGGGGATGGTTGGGGAGCAGGGG - Intronic
1186539912 X:10389730-10389752 GGGGGGTGGCGGGCGGGGGGAGG + Intergenic
1186554312 X:10541334-10541356 GGGGGGTGGTGGGAGGGCAGGGG - Intronic
1186626444 X:11298761-11298783 TAGGGCTGCTGGGCGGGCGGAGG - Exonic
1186755079 X:12662343-12662365 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1186901992 X:14066387-14066409 GGGGGGGGGGGGGCGGGCGGCGG - Intergenic
1186904528 X:14097333-14097355 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1186919186 X:14259395-14259417 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1186929699 X:14375074-14375096 AGGGGCTGGGGGGCTAGGGGAGG + Intergenic
1187173742 X:16875758-16875780 GGGGGGTGGTGGGCTGGGGGAGG + Intergenic
1187255131 X:17635434-17635456 GGGGGATGGAGGGCGAGAGAGGG - Intronic
1187548663 X:20279366-20279388 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1187574478 X:20540156-20540178 GGGGGCTGGGGGGCTGGGGGAGG - Intergenic
1187597981 X:20796155-20796177 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1187611537 X:20948927-20948949 GGGGTCTGGTGGCAGAGAGGTGG - Intergenic
1187669056 X:21650425-21650447 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1187726430 X:22208028-22208050 GGGGGGTGGGGGGCTAGGGGAGG - Intronic
1188826576 X:34842292-34842314 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1189168906 X:38890005-38890027 GGGGGGTGGGGGGTGAGGGGAGG + Intergenic
1189322320 X:40094479-40094501 CCGGGCTGGTGGGAGCGCGGGGG - Intronic
1189352593 X:40287405-40287427 AGGGGCTGGGGGGTGAGAGGAGG - Intergenic
1189359414 X:40338078-40338100 GGGGGGTGGAGGGCAAGGGGAGG + Intergenic
1189533517 X:41912023-41912045 GGGGGTTGGGGGGCAAGGGGAGG - Intronic
1189710196 X:43802778-43802800 GGGGGTTGGGGGGCAAGGGGAGG + Intronic
1189875292 X:45430403-45430425 GGGGGCTGGGGGGCTGGGGGAGG - Intergenic
1190174796 X:48139416-48139438 TGGGGCTGCTGGCCGGGCGGGGG - Intergenic
1190526545 X:51333758-51333780 GGGGGGTGGGGGGCGAGGGGTGG + Intronic
1190529211 X:51358092-51358114 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1191096600 X:56679688-56679710 GGGGGCTGAGGGGCTAGGGGAGG + Intergenic
1191201467 X:57786987-57787009 GGGGGATGGTGGGCTATGGGAGG + Intergenic
1191225715 X:58040719-58040741 GGGTGCTGGTGGGCACGGGGTGG - Intergenic
1192043638 X:67649016-67649038 AGGGGGTGGTGGGCTAGTGGAGG - Intronic
1192137214 X:68614724-68614746 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1192220982 X:69197198-69197220 GGTGGCTGGCGGGGGAGCTGGGG - Intergenic
1192525269 X:71837421-71837443 GGGGGCTGGGGGGCTGGGGGAGG + Intergenic
1192768631 X:74166792-74166814 GGGGGCGGCTGGCCGGGCGGGGG - Intergenic
1192935281 X:75852219-75852241 GGGGGCTGTGGGGCTAGGGGAGG - Intergenic
1192946636 X:75970118-75970140 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1193011451 X:76679358-76679380 GGGGGGTGGTGGTCTAGGGGAGG + Intergenic
1193453358 X:81699087-81699109 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1193704740 X:84807711-84807733 TGGGGGTGGTGGGCGAGGGGAGG + Intergenic
1193794339 X:85854515-85854537 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1193963598 X:87955199-87955221 GGGGGCTGGGGAGCTAGGGGAGG + Intergenic
1194070928 X:89325040-89325062 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1194159118 X:90428727-90428749 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1194290226 X:92063190-92063212 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1194330456 X:92578209-92578231 GGGGGATGGGGGGCTAGGGGAGG + Intronic
1194964540 X:100272213-100272235 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1195132869 X:101871854-101871876 GGGGGGTGGGGGGTGAGGGGAGG - Intergenic
1195153965 X:102103621-102103643 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1195156035 X:102125663-102125685 GCGGGCTGGCGGGCGGGCGCGGG - Intergenic
1195298791 X:103507029-103507051 GGGGGGTGGGGGGTGAGGGGAGG - Intronic
1195350533 X:103991784-103991806 GGGGGTTGGGGGGCTAGGGGAGG + Intergenic
1195421383 X:104678822-104678844 GGGGGATGAGGGGCGAGAGGAGG + Intronic
1195758586 X:108223229-108223251 GAGGGGTGGTGGGCAAGGGGAGG + Intronic
1195764767 X:108284309-108284331 GGGGGCTGGGGGGCTGGGGGAGG + Intronic
1195845759 X:109226162-109226184 GGGGGCTGGGGGATGAGCGGAGG + Intergenic
1195897595 X:109762767-109762789 GGGGGCTGGGGGGCTAGGGGAGG + Intergenic
1195978314 X:110551645-110551667 GGGGGGTGGGGGGCGGGGGGAGG + Intergenic
1196039281 X:111184542-111184564 GGGGGATGGGGGGCTAGGGGAGG - Intronic
1196073962 X:111554145-111554167 AGGGGCTGGGGGGCTAGGGGAGG + Intergenic
1196176910 X:112648173-112648195 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1196759149 X:119185313-119185335 GGGGGTTGGGGGGCTAGGGGAGG - Intergenic
1197029545 X:121797290-121797312 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1197135007 X:123050816-123050838 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1197135283 X:123053023-123053045 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1197430632 X:126358752-126358774 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1197431054 X:126364214-126364236 GGGGGGTGGTGGGTGATGGGAGG + Intergenic
1197445974 X:126552609-126552631 GGTGGGCGGCGGGCGAGCGGCGG + Exonic
1197537091 X:127703870-127703892 GGGGGCTTGTGGGGGGGAGGTGG - Intergenic
1197646592 X:129024481-129024503 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1197700787 X:129598023-129598045 GTGGGCTGGGGGGCCAGCAGGGG - Intergenic
1197736049 X:129850886-129850908 CGGGGCTGCTGGCCGGGCGGGGG - Intergenic
1197804831 X:130388728-130388750 GGGGCCTGTTGGGCGGGTGGGGG + Intergenic
1197960176 X:131995489-131995511 GGGGGGTAGTGGGCTAGGGGAGG + Intergenic
1198086198 X:133284958-133284980 GGGGGGTGGTGGGCTTGGGGAGG + Intergenic
1198488078 X:137108281-137108303 GGGGGCTGGGGGGCGAGGGGAGG + Intergenic
1198519651 X:137439830-137439852 GGGGGGTGGAGGGCTAGGGGAGG + Intergenic
1198620978 X:138509239-138509261 GGGGGGTGGGGGGCAAGGGGCGG + Intergenic
1198623722 X:138544180-138544202 GTGGGGTGGTGGGAGAGGGGAGG - Intergenic
1198699302 X:139380807-139380829 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1198721206 X:139622730-139622752 GTGGGGTGGGGGGCGAGGGGAGG + Intronic
1198764567 X:140067655-140067677 GGGGGGTGGGGGGCAAGGGGAGG - Intergenic
1198833570 X:140777139-140777161 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1198879227 X:141261355-141261377 GGGGGGTGGGGGGCTAGGGGAGG - Intergenic
1198884675 X:141321417-141321439 GGGGGGTGGGGGGCAAGGGGAGG + Intergenic
1198972130 X:142293459-142293481 GGGGGTTGGGGGGCGGGGGGCGG + Intergenic
1199078891 X:143554651-143554673 GGGGGGTGGGAGGCTAGCGGAGG + Intergenic
1199437147 X:147825402-147825424 GGGGGGTGGGGGGCTAGGGGAGG + Intergenic
1199466310 X:148141475-148141497 GGGGGGTGGAGGGCTAGGGGAGG + Intergenic
1199536833 X:148912275-148912297 GGGGGGTGGAGGGCTAGGGGAGG - Intronic
1199716172 X:150508658-150508680 TGGGGCTGGTGGGAGTGGGGCGG - Intronic
1199772727 X:150984347-150984369 GGGGGCCGACGGGCGGGCGGCGG + Intronic
1199788346 X:151126146-151126168 TGGGGGTGGGGGGCGAGGGGAGG + Intergenic
1200092952 X:153644284-153644306 GGGGGCGGGTGCGGGGGCGGGGG + Intronic
1200136200 X:153875901-153875923 GGGGGCTGGTGGGCGGCTTGGGG + Exonic
1200290912 X:154872547-154872569 GGGGGGTGGGGGGCTAGGGGAGG + Intronic
1200639162 Y:5697279-5697301 GGGGGATGGGGGGCTAGGGGAGG + Intronic
1200723759 Y:6639216-6639238 GGGAGCTGGGGGGCGAGGAGAGG - Intergenic
1200725158 Y:6660780-6660802 GGGGGTTGGGGGGCAAGGGGAGG + Intergenic
1201077132 Y:10196733-10196755 TGGGCCTGGTGGGCGCCCGGAGG + Intergenic
1201177907 Y:11321291-11321313 GGGGGCTGGTGGGGTGGGGGAGG - Intergenic
1201188974 Y:11430357-11430379 GGGGACTGGGGGGAGAGGGGAGG - Intergenic
1201949282 Y:19546390-19546412 GGGGAATGGTGGGCTAGAGGAGG - Intergenic
1202112525 Y:21438324-21438346 GTGGGCTGGAGGGCTAGGGGAGG - Intergenic
1202587938 Y:26451672-26451694 GGGGGGCGGTGGGTGAGTGGTGG - Intergenic