ID: 1008035635

View in Genome Browser
Species Human (GRCh38)
Location 6:46742275-46742297
Sequence GTCATCCTTTCTAGCCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008035635_1008035638 -8 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035638 6:46742290-46742312 AGGATGACATGTCTGGACAAGGG No data
1008035635_1008035643 8 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035643 6:46742306-46742328 ACAAGGGCTCCTTGGTGGGAGGG No data
1008035635_1008035639 0 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035639 6:46742298-46742320 ATGTCTGGACAAGGGCTCCTTGG No data
1008035635_1008035640 3 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035640 6:46742301-46742323 TCTGGACAAGGGCTCCTTGGTGG No data
1008035635_1008035641 4 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG No data
1008035635_1008035645 24 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035645 6:46742322-46742344 GGGAGGGATATGAGATACCAAGG No data
1008035635_1008035637 -9 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035637 6:46742289-46742311 AAGGATGACATGTCTGGACAAGG No data
1008035635_1008035642 7 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035642 6:46742305-46742327 GACAAGGGCTCCTTGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008035635 Original CRISPR GTCATCCTTTCTAGCCTCTC TGG (reversed) Intergenic
No off target data available for this crispr