ID: 1008035641

View in Genome Browser
Species Human (GRCh38)
Location 6:46742302-46742324
Sequence CTGGACAAGGGCTCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008035635_1008035641 4 Left 1008035635 6:46742275-46742297 CCAGAGAGGCTAGAAAGGATGAC No data
Right 1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG No data
1008035634_1008035641 7 Left 1008035634 6:46742272-46742294 CCACCAGAGAGGCTAGAAAGGAT No data
Right 1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008035641 Original CRISPR CTGGACAAGGGCTCCTTGGT GGG Intergenic
No off target data available for this crispr