ID: 1008042360

View in Genome Browser
Species Human (GRCh38)
Location 6:46815736-46815758
Sequence AAACCCCACGGTCAGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008042360_1008042364 -7 Left 1008042360 6:46815736-46815758 CCTGAGTCCTGACCGTGGGGTTT 0: 1
1: 0
2: 1
3: 1
4: 92
Right 1008042364 6:46815752-46815774 GGGGTTTTGATAATGATGGATGG No data
1008042360_1008042365 11 Left 1008042360 6:46815736-46815758 CCTGAGTCCTGACCGTGGGGTTT 0: 1
1: 0
2: 1
3: 1
4: 92
Right 1008042365 6:46815770-46815792 GATGGATAGTATGATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008042360 Original CRISPR AAACCCCACGGTCAGGACTC AGG (reversed) Intronic
902194543 1:14788663-14788685 AGTCACCACGGTCAGGCCTCTGG - Intronic
902554397 1:17238539-17238561 AGACCCCAGACTCAGGACTCAGG - Intronic
907038152 1:51235033-51235055 AGACCCCACGCTAAGGACTGGGG - Intergenic
911169245 1:94753926-94753948 AAACAACACTCTCAGGACTCCGG + Intergenic
918002864 1:180514167-180514189 AGACTCCAAGGTCAAGACTCTGG - Intergenic
919785134 1:201253960-201253982 AGACACCACAGTCAGAACTCAGG + Intergenic
1062955737 10:1539135-1539157 AAACTCCAGGGGCAGCACTCTGG + Intronic
1066034448 10:31467731-31467753 AACCCCCACTGTCAGAACACAGG + Intronic
1069659075 10:70111717-70111739 AAACCCCACTCTTGGGACTCGGG - Exonic
1072546310 10:96442208-96442230 AATCCCCACCGTCAGGGCTGAGG + Intronic
1076614702 10:131747848-131747870 AAGCCCCATGGTCAGGCCCCAGG + Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1080628158 11:34050233-34050255 AAAGACCACGGTAAGGACTTTGG - Intergenic
1081378156 11:42384224-42384246 AAACACCACAGTAAGGACTGTGG + Intergenic
1083462820 11:62825888-62825910 AAAGCCCCCGGACAGTACTCAGG + Intronic
1084478279 11:69401137-69401159 AATTCCCACGGTCATGACTGCGG + Intergenic
1084804896 11:71571925-71571947 AAAGCCCACTCTGAGGACTCCGG - Intergenic
1089661599 11:119989672-119989694 AATCCCCACTCTCAGCACTCAGG - Intergenic
1094365166 12:29672329-29672351 AAACCACAGGGTCAGTACCCAGG + Intronic
1095965871 12:47866640-47866662 AAAACCCAAGGCCAGGCCTCAGG - Intronic
1096256978 12:50069014-50069036 AAAGGCCACGGTGAGGATTCTGG - Intronic
1097120433 12:56727220-56727242 ATAACCTACGGTCAGGAGTCCGG - Intronic
1098918680 12:76283017-76283039 AAAGGCCAGGGTTAGGACTCAGG - Intergenic
1107913059 13:45123653-45123675 AAAACCTACGGGCAGGACTGGGG + Intronic
1113387213 13:109859775-109859797 AAATCCCATGGTCAGGTGTCTGG + Intergenic
1120492004 14:85190153-85190175 AAACCCCAGGGCCAGCACTGTGG + Intergenic
1125019321 15:34969467-34969489 AAACCCCACCACCAGGCCTCGGG + Intronic
1131252447 15:90839395-90839417 AGGCCCCACGAACAGGACTCTGG + Intergenic
1136004505 16:27319424-27319446 AAACACCATGGTGAGGACTGAGG - Intronic
1137722814 16:50637796-50637818 AACCCCCACGCTCAGAGCTCAGG - Exonic
1146212740 17:30954887-30954909 GAACCCCACCGTCTGGGCTCTGG + Intronic
1147803789 17:43114561-43114583 AAACCCCAAGTTAAGAACTCTGG + Intronic
1148049940 17:44764954-44764976 AAACCACATGAGCAGGACTCTGG + Intronic
1149567990 17:57653025-57653047 ACGCCCCACGGACAGGGCTCTGG + Intronic
1151743985 17:76001707-76001729 AAACTCCACAGTCAGGGCCCCGG - Intronic
1153660970 18:7325853-7325875 GAAGCCCACTGTCAGGACACTGG + Intergenic
1158800275 18:60898885-60898907 AAACCTCAGGCTCATGACTCTGG + Intergenic
1160508185 18:79438787-79438809 ATACCCCAAGCTCAGGACGCAGG + Intronic
1161397302 19:4051674-4051696 AAAGCCCACGGCAAGGTCTCCGG + Intronic
1161684564 19:5696434-5696456 AGACCCCAGGGTCAGGGCTGGGG + Intronic
1162120133 19:8460094-8460116 AGATCACACAGTCAGGACTCAGG - Intronic
1163654905 19:18539891-18539913 GAACCCCACGTGCAGGACACTGG + Intronic
1164583376 19:29449198-29449220 AAACCCCACGGTAAGCACAGTGG + Intergenic
1164802870 19:31092201-31092223 AAACCCCAAGGTCAAGAGGCAGG + Intergenic
1165435367 19:35792152-35792174 AAACCCCAAGGCCGGGACTTGGG + Intergenic
1168404855 19:56105347-56105369 AAACTCCACGGGGAGGACACAGG + Intronic
925856276 2:8132830-8132852 AAAACCCACAGCCAGGACTTGGG - Intergenic
927208662 2:20625489-20625511 AAACCTCAGGGCTAGGACTCAGG + Intronic
940431287 2:153593082-153593104 AAACCTCATGGCCAGAACTCGGG + Intergenic
940877647 2:158914157-158914179 AGACCCCTCAGTCAGGAGTCTGG - Intergenic
945370237 2:209007106-209007128 AAACCCAACACTCAGGAATCTGG + Intergenic
1169087338 20:2835628-2835650 AATCCCCATGGTCAGCACTGGGG - Exonic
1174104537 20:48153049-48153071 AAACCCCACCCTGTGGACTCAGG - Intergenic
1175789182 20:61731045-61731067 AGACCCCAGGGTGAGGTCTCTGG - Intronic
1182421782 22:30252009-30252031 CAACGCCACGGCCAGGCCTCTGG - Intergenic
1185167752 22:49271954-49271976 AAACCCCAAGGTCAAGTCTGTGG + Intergenic
950659249 3:14456617-14456639 TACCCCCACAGTCAGGGCTCTGG - Intronic
952407397 3:33016679-33016701 AAACCACACTGTCAAGACTAAGG - Intronic
952959270 3:38579548-38579570 AACCCCCAGGGTCAGGGCCCTGG - Intronic
955782839 3:62504613-62504635 AAACCTCACTGTCAGAATTCTGG - Intronic
958936540 3:100261378-100261400 AACTCCCACAGCCAGGACTCCGG - Intronic
967612961 3:191529404-191529426 AAGCCCCACAGTCAGCCCTCCGG - Intergenic
969215503 4:5719222-5719244 AAACCCGAAGGTCAGGAGTTGGG - Intronic
971345803 4:25810681-25810703 AGACCCCACGTTCAGGACTCCGG - Intronic
975888566 4:78995912-78995934 AAACCCAACGGGGAGGTCTCTGG - Intergenic
980004642 4:127527882-127527904 CAACCACACTGTCAGGCCTCTGG + Intergenic
984866328 4:184283776-184283798 CAACCCCAAGGCCAGGACACGGG - Intergenic
987288601 5:16486593-16486615 AAGACCCAAGGCCAGGACTCTGG + Intronic
990624104 5:57592514-57592536 AGACCCCATTGTCAGGATTCTGG + Intergenic
994199201 5:96953103-96953125 AAACCCCACGGGCTGGTCCCAGG - Intronic
997707077 5:135965860-135965882 AAAACCAAGGGTCAAGACTCTGG - Intergenic
998201929 5:140131821-140131843 GAACTCCACAGTCAGGATTCAGG + Intergenic
999254778 5:150204209-150204231 AATCTCCACAGCCAGGACTCTGG - Intronic
1000142297 5:158417221-158417243 AAACCCCACAGTCATGGCTGTGG + Intergenic
1001590256 5:172859849-172859871 AAACTCCACAGTCAGTACTTTGG + Intronic
1002148999 5:177211207-177211229 AGTCCCCACGACCAGGACTCCGG - Exonic
1005974781 6:30789797-30789819 TAACCCCAGGGTCAGGAATCCGG - Intergenic
1008042360 6:46815736-46815758 AAACCCCACGGTCAGGACTCAGG - Intronic
1018501444 6:164414645-164414667 AAACACCTCGCTAAGGACTCAGG - Intergenic
1023841589 7:44101413-44101435 GATCCCCACAGTCAGAACTCAGG + Intergenic
1026858684 7:73770772-73770794 CAACCCCACCGCCCGGACTCAGG - Intergenic
1029805931 7:102996118-102996140 AAAGTCCAGGCTCAGGACTCAGG - Intronic
1029985584 7:104920189-104920211 AAAGACCAAGATCAGGACTCTGG + Intergenic
1034016740 7:147595904-147595926 AAAGCCCAGGGTAAGGCCTCAGG - Intronic
1039544493 8:38399178-38399200 AATAACCACAGTCAGGACTCAGG - Intronic
1047554305 8:125912126-125912148 AACCGCCAAGGCCAGGACTCAGG - Intergenic
1048790514 8:138099219-138099241 AAACACAACGTTCATGACTCTGG - Intergenic
1049126249 8:140791589-140791611 AAAGCCCATGTTTAGGACTCTGG + Intronic
1050303496 9:4283234-4283256 AAACAGCACAGTAAGGACTCCGG - Intronic
1050304998 9:4298267-4298289 AAACCACAGGGTGAGGACACTGG - Intronic
1189539827 X:41974509-41974531 AAACACCACAGTGAAGACTCAGG + Intergenic
1195799167 X:108687673-108687695 AGAGCCCACGGTCAAGACTTGGG + Exonic
1197702646 X:129610881-129610903 AAAGCCCACAGTCAAGACACTGG + Intergenic
1197852596 X:130879140-130879162 AAACCCCACGGTCAAGGTTTGGG + Intronic
1198035910 X:132801105-132801127 AAACACCAGAGTCAGGAGTCAGG - Intronic