ID: 1008042817

View in Genome Browser
Species Human (GRCh38)
Location 6:46819765-46819787
Sequence CTGTCCACACAGATTTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008042817_1008042820 -2 Left 1008042817 6:46819765-46819787 CCAAGCCAAATCTGTGTGGACAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1008042820 6:46819786-46819808 AGGAGCTTCAGCCTCTCTAGTGG 0: 1
1: 0
2: 0
3: 21
4: 182
1008042817_1008042821 -1 Left 1008042817 6:46819765-46819787 CCAAGCCAAATCTGTGTGGACAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1008042821 6:46819787-46819809 GGAGCTTCAGCCTCTCTAGTGGG 0: 1
1: 0
2: 2
3: 27
4: 278
1008042817_1008042823 18 Left 1008042817 6:46819765-46819787 CCAAGCCAAATCTGTGTGGACAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1008042823 6:46819806-46819828 TGGGAAGAAAGACTCTGAAGAGG 0: 1
1: 0
2: 3
3: 50
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008042817 Original CRISPR CTGTCCACACAGATTTGGCT TGG (reversed) Intronic
900842765 1:5068351-5068373 CTGGTCACACAAATTTGGCTGGG + Intergenic
902368451 1:15991666-15991688 CTGTCCCCACAGATCTCTCTCGG + Intergenic
903338782 1:22641840-22641862 GTGTCCACATCGATTTTGCTGGG - Intergenic
903356805 1:22753509-22753531 CTGACCACCCAGACTGGGCTTGG - Intronic
903507172 1:23845742-23845764 CTGTCCCCGCAGAGTTTGCTTGG - Exonic
904551166 1:31319706-31319728 CTGCCCAGAGTGATTTGGCTAGG + Intronic
905165527 1:36080316-36080338 CTATCCATACAGCTTTGTCTGGG - Intergenic
905242449 1:36589651-36589673 CTGTCCACACAGCTTCAGCCAGG - Intergenic
906606121 1:47173557-47173579 ATGACCACACAGTTTTGTCTTGG + Intergenic
909388585 1:75090549-75090571 CTGTCCACACAGATTTAAAGAGG + Intergenic
911233870 1:95388730-95388752 CTTTGCACACAGGTTTGGGTGGG + Intergenic
911461374 1:98195430-98195452 ATGTCCACAGAGTTTTGGCTTGG + Intergenic
912003305 1:104860817-104860839 CTCTTCAGACAGAATTGGCTGGG - Intergenic
914915586 1:151817241-151817263 TTGTCCCCACAGATTTTGCAAGG + Exonic
917674041 1:177302402-177302424 CTGTGCACAGGGGTTTGGCTGGG + Intergenic
921220529 1:212970438-212970460 CTGTCCACCCAGAGGTTGCTAGG + Intronic
922887313 1:229030059-229030081 CTGACCACACAGAGGTGCCTGGG - Intergenic
1064567442 10:16656235-16656257 GTTTCCATACAGATTTGCCTTGG + Intronic
1069138568 10:64796026-64796048 CTTTTCCCACAGATTTTGCTTGG + Intergenic
1069228036 10:65968773-65968795 CTCTACACACAGATTTGGGGTGG - Intronic
1069655300 10:70083356-70083378 CTTGCCACAGAGATTTGGGTGGG - Intronic
1070670956 10:78376897-78376919 GTGTCCACACAGACTTTCCTGGG - Intergenic
1070722098 10:78764065-78764087 TTATCCACACAGATGGGGCTGGG - Intergenic
1073568269 10:104554369-104554391 CTGGCCCAACAGAGTTGGCTTGG + Intergenic
1075206800 10:120456051-120456073 CTGCTCACACAATTTTGGCTGGG + Intergenic
1077205551 11:1341471-1341493 CTGTCCGCACAGTTTAGGGTGGG + Intergenic
1077205559 11:1341529-1341551 CTGTCCGCACAGTTTAGGGTGGG + Intergenic
1081484287 11:43515945-43515967 CTGTCAACACAGTGTTGGGTAGG - Intergenic
1081878455 11:46427678-46427700 CTGTGCAATCAGATTTGGGTGGG + Intronic
1083363842 11:62129544-62129566 CAGTCCGCACAGAACTGGCTAGG - Intronic
1083626597 11:64075028-64075050 CTGTCCGCACACAGGTGGCTAGG - Intronic
1086348112 11:85918504-85918526 CTGTCCACCCAGTTTTGGGTTGG + Intronic
1092741381 12:11633513-11633535 CTGGCCATACAATTTTGGCTTGG + Intergenic
1094365604 12:29676838-29676860 CTGCCCACACTGATATGGCCTGG - Intronic
1094495537 12:30987166-30987188 CTGCCCACAAAGATGTGGCCTGG + Intronic
1098743534 12:74205462-74205484 CTGTGATCACAGATTTGGGTTGG + Intergenic
1103327795 12:120133076-120133098 CTGTCCCCACAGAGAAGGCTGGG + Intronic
1103867501 12:124064537-124064559 CTGTCCACCAAGAGTTTGCTGGG + Intronic
1112040826 13:95546233-95546255 CTGTACACAAAGAGTTGTCTTGG + Intronic
1112813087 13:103241910-103241932 CTGTCCTCAAAGCTTTGACTGGG + Intergenic
1114924855 14:27383877-27383899 CTGTCCCCACAGCAGTGGCTAGG + Intergenic
1115110433 14:29814639-29814661 CTCTCCACTCAGCTTAGGCTCGG + Intronic
1118930470 14:70235510-70235532 ATGTCTACACAGATCTGGCCAGG + Intergenic
1118954390 14:70466661-70466683 ATGTCTACACAGATCTGGCCAGG - Intergenic
1124075709 15:26442582-26442604 CTTTCCACACCGAATTGTCTTGG + Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1126078995 15:44939961-44939983 CTTTCCCCACTGAGTTGGCTGGG + Intergenic
1129178714 15:73858101-73858123 TTGGCCACCCAGCTTTGGCTCGG - Intergenic
1133205012 16:4228008-4228030 CTGTCCCCACACACCTGGCTGGG - Intronic
1133633306 16:7642382-7642404 CTATCCCCACAGCTATGGCTGGG + Intronic
1134850338 16:17473803-17473825 CTGGCCACACTGATTGGTCTCGG - Intergenic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1139169011 16:64608311-64608333 ATATCCACACAGAGTTGGTTTGG + Intergenic
1140571013 16:76106244-76106266 GTGTCCTCACAGAGTAGGCTGGG + Intergenic
1143205546 17:5137639-5137661 CTGTCCCCACAGATCTCTCTCGG + Exonic
1144753135 17:17663785-17663807 CTGGCCACACTGATTTGGTGAGG - Intergenic
1144876590 17:18400331-18400353 CTGTCCCCACAGATCTCTCTCGG + Intergenic
1145155636 17:20544089-20544111 CTGTCCCCACAGATCTCTCTCGG - Intergenic
1145798271 17:27668255-27668277 CTGTCCCCACAGATCTCTCTTGG - Intergenic
1145838197 17:27970730-27970752 CTTGCCACACTGATTGGGCTGGG + Intergenic
1146366503 17:32233057-32233079 TTGTTAACACAGATTTTGCTGGG - Intronic
1146496182 17:33324552-33324574 CTGTACACACAGATCTAGGTAGG - Intronic
1146843079 17:36168156-36168178 CTGTCCCCACAGATCTCTCTCGG - Exonic
1146855384 17:36256097-36256119 CTGTCCCCACAGATCTCTCTCGG - Exonic
1146865237 17:36332278-36332300 CTGTCCCCACAGATCTCTCTCGG + Exonic
1146871290 17:36380008-36380030 CTGTCCCCACAGATCTCTCTCGG - Exonic
1146878650 17:36431090-36431112 CTGTCCCCACAGATCTCTCTCGG - Exonic
1146882598 17:36452236-36452258 CTGTCCCCACAGATCTCTCTCGG - Intergenic
1147068097 17:37932872-37932894 CTGTCCCCACAGATCTCTCTCGG + Exonic
1147074176 17:37980632-37980654 CTGTCCCCACAGATCTCTCTCGG - Intronic
1147079627 17:38012427-38012449 CTGTCCCCACAGATCTCTCTCGG + Intronic
1147085698 17:38060170-38060192 CTGTCCCCACAGATCTCTCTCGG - Exonic
1147095568 17:38136369-38136391 CTGTCCCCACAGATCTCTCTCGG + Intergenic
1147101645 17:38184136-38184158 CTGTCCCCACAGATCTCTCTCGG - Intergenic
1147878840 17:43641190-43641212 CCGTCCACACAGGCTTGACTGGG - Exonic
1149846243 17:60010642-60010664 CTGTCCCCACAGATCTCTCTCGG - Intergenic
1150084592 17:62267221-62267243 CTGTCCCCACAGATCTCTCTCGG - Intergenic
1150706162 17:67489262-67489284 CTGTCCTCACAGATGTGGTATGG + Intronic
1155756447 18:29503199-29503221 TTTTGCACATAGATTTGGCTTGG - Intergenic
1158248771 18:55463033-55463055 GTGTTCACACAAATTTGGGTTGG - Intronic
1161130129 19:2583488-2583510 CTTGCCACACAGCTTGGGCTGGG - Intronic
1161130579 19:2586263-2586285 CTTGCCACACAGCTTGGGCTGGG - Intronic
1163785342 19:19272299-19272321 CTGTGTACAAAGATTTGTCTTGG - Intronic
1163810308 19:19427364-19427386 CTGTCCTCTCAGAATTAGCTTGG + Intronic
1164955658 19:32381308-32381330 TTGTCAAAACAGAATTGGCTGGG + Intronic
1165130872 19:33631149-33631171 CTGCCCACACAGGTTGAGCTGGG + Intronic
1167858571 19:52264216-52264238 CTGTCCTCACAGAGTTGGTAGGG + Intergenic
927716989 2:25359520-25359542 CTGTCCACACAGAATTTCCCAGG + Intergenic
927920989 2:26971382-26971404 CTTTCCGAATAGATTTGGCTGGG + Intronic
928111809 2:28516706-28516728 CTGGGCACACAGATATGGCTAGG + Intronic
928173842 2:29021241-29021263 CTCTCCACTCAGACTTGCCTAGG + Intronic
930211117 2:48638216-48638238 CTGGCCTCACAGAATTAGCTGGG - Intronic
930611203 2:53545945-53545967 CTGTGCAGACACATTTGGGTTGG - Intronic
937046208 2:118853381-118853403 GTGTCCACACAGACTGGCCTTGG + Intergenic
938760961 2:134425640-134425662 CTGACCTGACAGATGTGGCTTGG - Intronic
940964352 2:159821163-159821185 CTTTCCACACTGAATTGTCTTGG - Intronic
941245330 2:163088724-163088746 CTGTCCACACAGATGAGTTTAGG + Intergenic
943197351 2:184771377-184771399 GTGTCCAGACAGGTTTTGCTGGG + Intronic
946221212 2:218228726-218228748 CTTTCCTCACAGATTTCGATGGG + Exonic
946420722 2:219563091-219563113 CTGTCCCCAGAGATTTCCCTTGG + Intronic
946997095 2:225405810-225405832 CTGTCCATATAGATTTGATTGGG + Intronic
948251789 2:236535583-236535605 CTGTCCCCGCAGAGTTGGCTTGG + Intergenic
948641422 2:239378139-239378161 CTGTGCACATAGATCTGGCCCGG + Intronic
949003290 2:241630125-241630147 CAGTGCACACAGATTGGGCGAGG - Intronic
1169128507 20:3149108-3149130 CAGTCCTCACAGATTTGACCAGG + Exonic
1170608239 20:17889980-17890002 ATGTCCAGACTGATGTGGCTGGG - Intergenic
1172887405 20:38240582-38240604 CTTTCCCCAAAGATTTGGCTCGG + Exonic
1178920012 21:36732533-36732555 CTGTCCATAGAGATTTGGGGAGG - Intronic
1179416371 21:41201785-41201807 CTGTCAACACAGATTTTCTTCGG - Intronic
1181001016 22:19987754-19987776 CTGTCCCCACAGAGTTCGATGGG + Intronic
1182300806 22:29335827-29335849 CTGTCCTCACAGATCTGTCCGGG - Intronic
1183368837 22:37421032-37421054 CTGTCCACTGAGATTTTGATTGG - Intronic
1183487287 22:38095658-38095680 CTTTCCACAAAAATTAGGCTGGG - Intronic
1183776509 22:39969616-39969638 CAAACCACACAGATCTGGCTGGG + Intronic
1184606530 22:45577642-45577664 CTGTGCACACAGAGTGGCCTTGG - Intronic
952832335 3:37575630-37575652 CAGTCAACACAAATTGGGCTTGG - Intronic
962255324 3:133866444-133866466 CTGACCACCCAGAGTTGGCGTGG - Intronic
962864141 3:139433425-139433447 ATGTCCACAGAGACTTGGATGGG + Intergenic
967767335 3:193295658-193295680 CTGTCCTCACATATAAGGCTCGG - Intronic
970859741 4:20688097-20688119 CTTTCCACACAGCGTTGGCTAGG - Intergenic
972690681 4:41394898-41394920 CAGTCCACACAGATTTTAATGGG - Intronic
974795981 4:66750409-66750431 CTGTCCACACTGATTTAGATGGG - Intergenic
979138060 4:117135694-117135716 CTGTCCACAGACATGTGTCTTGG - Intergenic
980003932 4:127519547-127519569 CTGTACAAACCGATTTGCCTAGG + Intergenic
988078804 5:26389043-26389065 CTTGGCACACAGATTTGACTGGG + Intergenic
989437937 5:41436106-41436128 CTGGCCACCCACATTTGGATGGG + Intronic
991718571 5:69475006-69475028 ATGTCCAGAGAGAGTTGGCTAGG - Intergenic
993584920 5:89712180-89712202 CTGTCCTTACAGCTTTGTCTGGG + Intergenic
993990374 5:94649480-94649502 CAGTCCAAACAGAATTGGTTTGG - Exonic
996233605 5:121098878-121098900 CTGGCCCCATAGAATTGGCTGGG - Intergenic
1001308203 5:170590997-170591019 CTGACCACACAGACTTCCCTTGG + Intronic
1007819290 6:44548880-44548902 CTCTCCACACAGATTTACTTTGG + Intergenic
1008042817 6:46819765-46819787 CTGTCCACACAGATTTGGCTTGG - Intronic
1008976706 6:57435437-57435459 CTGTAAGCACAGTTTTGGCTGGG - Intronic
1009264842 6:61540615-61540637 CTGTCCATTGAGATTTGGTTTGG - Intergenic
1012461143 6:99462322-99462344 CTTTCCACACAGTATTGGTTAGG - Intronic
1015217469 6:130766920-130766942 CTCTCCACACAAATGGGGCTGGG + Intergenic
1016036832 6:139391912-139391934 CTGTCAATACAGGTATGGCTGGG + Intergenic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1019876761 7:3819125-3819147 CTGTTCAGAAAGATTTGGATAGG + Intronic
1022889145 7:34677854-34677876 CTGTCCACACTCCTTTAGCTGGG - Intronic
1023868150 7:44248599-44248621 CTGTCCCCAAGGATCTGGCTGGG - Intronic
1024683306 7:51717271-51717293 CTTTGCACAAAGATTAGGCTGGG - Intergenic
1025204697 7:56985473-56985495 CTGATCACACAGATCTGGGTGGG - Intergenic
1025862921 7:65349317-65349339 AAGAGCACACAGATTTGGCTGGG - Intergenic
1027973377 7:85116856-85116878 CTTTCCACACTGATTTGCATAGG + Intronic
1031479127 7:122257201-122257223 CTGTACAGACAGATCTTGCTGGG + Intergenic
1033029409 7:137810653-137810675 CTGTCTATAAAGAATTGGCTGGG + Intronic
1033804101 7:144935512-144935534 CTTTACACACTGATATGGCTTGG + Intergenic
1034491208 7:151394061-151394083 CTGTCCGCACAGGTTTCCCTTGG - Intronic
1035862665 8:3046764-3046786 GTGAGCACACAGATGTGGCTGGG - Intronic
1036180427 8:6579884-6579906 CTGCCCACACAGAACTGGCCTGG + Intronic
1036198482 8:6744966-6744988 TGCTCCACACAGACTTGGCTCGG - Intronic
1038191577 8:25325935-25325957 CTGTCCAAACAGGTATGGCAGGG + Intronic
1038503996 8:28068595-28068617 TTGACCACACAGAGTTGGCCTGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1043359437 8:79454081-79454103 CACTCCACAGAGATTTGTCTGGG + Intergenic
1044310855 8:90690439-90690461 CTCACCACACAGATATGTCTAGG + Intronic
1044954694 8:97467875-97467897 CTGTCCAGTTAGCTTTGGCTAGG - Intergenic
1044959423 8:97515780-97515802 CTATCAACATAGTTTTGGCTGGG - Intergenic
1045402526 8:101833478-101833500 CTGTCCAAACTGCCTTGGCTAGG + Intronic
1050555480 9:6785819-6785841 CTCTGCACACTGCTTTGGCTGGG - Intronic
1051017337 9:12494701-12494723 CAGAACACATAGATTTGGCTCGG + Intergenic
1054744562 9:68841624-68841646 CTATCCACAGAGATTTAACTTGG + Intronic
1055438418 9:76315614-76315636 TTCTCCACACAGATCTGCCTGGG - Intronic
1056304767 9:85279155-85279177 CTGTGGACACAATTTTGGCTAGG + Intergenic
1059668062 9:116467950-116467972 CTGGCCACACAACGTTGGCTAGG + Intronic
1061356038 9:130105828-130105850 CTGTCTACAAAAAATTGGCTGGG - Intronic
1061494453 9:130963707-130963729 CTGACCACACTGATTTAGCAGGG + Intergenic
1187018531 X:15355080-15355102 CTCTACACACAGTTTTGGCAAGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189424085 X:40882519-40882541 GTGTCCACACAGAGTGGGCTGGG + Intergenic
1189745432 X:44163507-44163529 CTGTGCACACAGGTTTGCCATGG - Intronic
1190668918 X:52721432-52721454 GTGACCACACATTTTTGGCTGGG + Intergenic
1190670499 X:52736972-52736994 GTGACCACACATTTTTGGCTGGG - Intergenic
1195121854 X:101762438-101762460 CTGTCCCCACAGAATTGTGTAGG + Intergenic
1198600609 X:138281307-138281329 CTGTCCTCACTGATCTGGTTTGG + Intergenic
1199176528 X:144793789-144793811 CTGTCCCCACTGATATGGTTTGG - Intergenic
1200477009 Y:3650160-3650182 CTGTGCACAAAGCCTTGGCTAGG - Intergenic