ID: 1008047284

View in Genome Browser
Species Human (GRCh38)
Location 6:46864189-46864211
Sequence TATCCTTCCCTGCTGCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008047278_1008047284 7 Left 1008047278 6:46864159-46864181 CCCTTAAGATGACCTTGTATTAG 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG 0: 1
1: 0
2: 4
3: 16
4: 213
1008047281_1008047284 -5 Left 1008047281 6:46864171-46864193 CCTTGTATTAGGATGATCTATCC 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG 0: 1
1: 0
2: 4
3: 16
4: 213
1008047279_1008047284 6 Left 1008047279 6:46864160-46864182 CCTTAAGATGACCTTGTATTAGG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG 0: 1
1: 0
2: 4
3: 16
4: 213
1008047276_1008047284 30 Left 1008047276 6:46864136-46864158 CCCTTGTCTTAACATAAGATTCT 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG 0: 1
1: 0
2: 4
3: 16
4: 213
1008047277_1008047284 29 Left 1008047277 6:46864137-46864159 CCTTGTCTTAACATAAGATTCTC 0: 1
1: 0
2: 0
3: 18
4: 213
Right 1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG 0: 1
1: 0
2: 4
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008047284 Original CRISPR TATCCTTCCCTGCTGCTGAG GGG Intronic
900254566 1:1691343-1691365 CATCCTTCCCTTCTGCTGTCTGG + Exonic
900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG + Intronic
900530011 1:3148492-3148514 TCACCTTCCCTGCTTCTGAGGGG + Intronic
901248764 1:7756207-7756229 TCTCCCTCCCTGGTGCTGTGAGG + Intronic
902509412 1:16957993-16958015 TACCCCTCCCTGCTCCTGTGGGG + Intronic
902650702 1:17835588-17835610 TATACATCCCTGCAGATGAGAGG - Intergenic
903035208 1:20488368-20488390 GCTCCTTCCTTGCTGCTGAGAGG + Intergenic
905932265 1:41797443-41797465 TTCCCTTCCCTCCTTCTGAGAGG + Intronic
906142942 1:43544515-43544537 TCTCCCTCCCTGCTGGGGAGAGG + Intronic
906667473 1:47631904-47631926 TATTCATCCCAGCGGCTGAGCGG - Intergenic
908726818 1:67185234-67185256 TCTCCTTCTCTGCAGCTGTGTGG - Intronic
909015008 1:70371410-70371432 TAGCCTGCCTTGCTGGTGAGTGG - Intronic
909033421 1:70568681-70568703 TATACTTCCCTGCCCCTCAGAGG - Intergenic
910191244 1:84598136-84598158 CATCCTACCCCGCAGCTGAGGGG + Intergenic
910451331 1:87349036-87349058 TGTCCTGCCCTGGTTCTGAGGGG - Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
912391686 1:109307250-109307272 TCTCCCTCCCTGGTGCTGTGGGG - Intergenic
913213778 1:116603187-116603209 TTTCCTGCCCTGCTGCCCAGGGG - Intronic
915707249 1:157856668-157856690 TATCCTTCCCTGCTTTGAAGGGG + Intronic
916278699 1:163024117-163024139 TGGCCTTCCCCACTGCTGAGTGG - Intergenic
916381273 1:164214590-164214612 TCTCGTGCCCTGCTGGTGAGAGG + Intergenic
919777891 1:201206072-201206094 TATCCTTCCCAGCTTCAGTGAGG - Exonic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
923674011 1:236064898-236064920 TCTCCTGCCCTGGAGCTGAGTGG - Exonic
924548252 1:245050454-245050476 TATATTTCCCTAGTGCTGAGGGG + Intronic
1063297993 10:4825961-4825983 AAACCTTCCCTGCTCCTGCGTGG + Intronic
1063448727 10:6136864-6136886 CAGCCTTCCCTGCAGCTAAGGGG + Intergenic
1067428526 10:46227053-46227075 TAGCCTCCCCTGCAGCTCAGCGG + Intergenic
1067666647 10:48284997-48285019 TCTCCTTGCCCGATGCTGAGCGG + Intergenic
1069877816 10:71573957-71573979 GATCCTTCCCGGCTGCTAATTGG + Intronic
1070145381 10:73770061-73770083 TATCCTTTCCTCCTCCTAAGAGG - Intronic
1070955789 10:80462496-80462518 CAGCCTTTCCTGCTGCTGAGGGG - Intronic
1072632780 10:97158076-97158098 TATCCTCCCCTCGTGCTGGGTGG - Intronic
1075311433 10:121417189-121417211 CATCCTTCTGTGCTGGTGAGTGG - Intergenic
1075609702 10:123842548-123842570 TATCTTTTCCTGAGGCTGAGAGG + Intronic
1078645241 11:13136015-13136037 TATCCTTCCCTCCTGATGGGAGG - Intergenic
1080245209 11:30172384-30172406 TTTTCTTTCCTGTTGCTGAGGGG - Intergenic
1085725372 11:78950354-78950376 TACCCTACCCTGCTGCACAGAGG - Intronic
1089149409 11:116353194-116353216 TACCCTTGCCTTCTGCTTAGAGG - Intergenic
1090429458 11:126634027-126634049 CATCCTTCCCTCCTGCTCTGGGG + Intronic
1094025596 12:25958083-25958105 TGTCATTGCCTGCTGCTAAGAGG + Intergenic
1095542888 12:43330935-43330957 TATCATTTGCTGCTGGTGAGTGG + Intergenic
1095766848 12:45905192-45905214 TCTCCTCCCATGATGCTGAGAGG + Exonic
1099519450 12:83642366-83642388 GCTGCTTCCCTGCTGCTGGGTGG + Intergenic
1101083140 12:101209304-101209326 CATCTTTCCCTTCTACTGAGAGG - Intronic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102150258 12:110684674-110684696 TTTCCTTCTCTGCTTCTGGGAGG + Intronic
1102339843 12:112112945-112112967 TGTCCTTACCTGCCGCTGGGAGG + Intergenic
1102655772 12:114481136-114481158 TTTCCTGCCCTGGTGCTAAGAGG + Intergenic
1103044358 12:117723070-117723092 TAACCTCCCCTGCCACTGAGGGG - Intronic
1103506725 12:121446028-121446050 TTGCCTTGCCTGGTGCTGAGGGG - Intronic
1103890316 12:124233653-124233675 TATCCTTTCCTGGTTCTGGGAGG + Intronic
1104415637 12:128594954-128594976 TGTCCGTCCCGGCTGCTGAAGGG + Intronic
1104440210 12:128788031-128788053 TCTACTTCTCTGATGCTGAGAGG + Intergenic
1104852487 12:131883961-131883983 CATCCTTTCCTGTGGCTGAGCGG - Intergenic
1105217008 13:18293738-18293760 TTTCCTGCCCTGCTGTTCAGGGG - Intergenic
1106210418 13:27638133-27638155 TGTGCTTCCCTCCTGCTGTGGGG - Intronic
1107166832 13:37292269-37292291 TATCATTCCATGTTGCAGAGAGG + Intergenic
1108434100 13:50384900-50384922 TCTCCACCCCTGCTGCAGAGAGG + Intronic
1108460992 13:50667088-50667110 TGGCCTTCCCGGCTGCTGTGGGG + Intronic
1110602558 13:77391729-77391751 TATTCTTTCCTGCTGCAGAGTGG + Intergenic
1113031931 13:106002946-106002968 TATCCTACCATGATGCTTAGTGG - Intergenic
1113651631 13:112037356-112037378 TCCCCTTCCCTGCTGCTGAGGGG + Intergenic
1118363771 14:65077038-65077060 CATCCTTTCCTGCTGTTGTGTGG - Intronic
1121247687 14:92474242-92474264 TATCTTTTCCTGATTCTGAGCGG + Intronic
1124689237 15:31807945-31807967 GAAGCTTCCCTGCTGCTGATAGG + Intronic
1125543965 15:40489052-40489074 TAATCTTCCCTCCTCCTGAGTGG - Intergenic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1129530040 15:76258376-76258398 GATGCTTCCCTGCAGCTGACCGG - Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130390403 15:83448988-83449010 TATCCTGACCTGCAGCTCAGGGG + Intronic
1132792215 16:1697873-1697895 TTTCTTTCCCTTCTCCTGAGTGG + Intronic
1133721117 16:8495279-8495301 TCTCCATCTCTGGTGCTGAGGGG - Intergenic
1135464766 16:22675809-22675831 TCCCCTTTCCTGCTGCTCAGTGG - Intergenic
1136391767 16:29969864-29969886 TGTGCTTCCCTGGTGCTGGGTGG + Intronic
1137780761 16:51096013-51096035 TTTCCTTCCCCCCTGCTGCGGGG + Intergenic
1141004514 16:80339704-80339726 CATCCTTCCCTGCCCCTGGGAGG - Intergenic
1143893930 17:10122257-10122279 CATCCTTCCCTCCCACTGAGGGG + Intronic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1144754157 17:17669334-17669356 CAGCCTTCCCTTCTGCTCAGTGG - Intergenic
1144826521 17:18108456-18108478 AAGCCTTCCCCGCTGCTCAGAGG - Intergenic
1147587792 17:41662689-41662711 CTTCCTTCCCTGCTGCTGTTAGG + Intergenic
1148088372 17:45007927-45007949 TTCCCCTCCCTGCTGCAGAGAGG - Intergenic
1150995029 17:70307363-70307385 TACCCTTCAGTCCTGCTGAGTGG - Intergenic
1151209782 17:72535921-72535943 TATCCTACCCTTCCCCTGAGTGG + Intergenic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1153334459 18:3907865-3907887 TATTCTTCCATCCTGCTGGGAGG - Intronic
1154976355 18:21461175-21461197 TCCCCTTCCCTGCTGATCAGTGG + Intronic
1159308398 18:66675888-66675910 TGTCAATCACTGCTGCTGAGAGG + Intergenic
1159552034 18:69905197-69905219 GATCCTGCCCTGCTGCAGGGTGG - Intronic
1160023729 18:75202080-75202102 TATCTTACCCTGCTGGTAAGTGG - Exonic
1160414790 18:78701033-78701055 TACCCCTCACTGCTGCTGTGAGG - Intergenic
1160690738 19:459922-459944 TAACCTTCCCCTCTGCTGACGGG - Intronic
1165358129 19:35316605-35316627 CTTCCCTCCCGGCTGCTGAGAGG - Intergenic
1168233573 19:55048075-55048097 TGTCCTTCCCTGCTGCTGTTGGG - Intronic
925894406 2:8460253-8460275 TATCTCTCCCTGCTGTTGACAGG + Intergenic
929603155 2:43217598-43217620 TATCCTGCCCCACTGCTGTGTGG + Intergenic
929799698 2:45089013-45089035 TTTCCTTCCCTGCTGCTCTGGGG - Intergenic
930708039 2:54523740-54523762 GATCCTTCTGTGTTGCTGAGTGG + Intronic
931661033 2:64563260-64563282 TATCCTTGGCTGATGTTGAGAGG + Intronic
931943030 2:67273909-67273931 TACCCTTCAGTGCTGCTGTGAGG - Intergenic
932276053 2:70453209-70453231 TCTCCTTACCTGTTTCTGAGTGG + Exonic
934297317 2:91752944-91752966 TTTCCTGCCCTGCTTCTCAGGGG + Intergenic
934580102 2:95430916-95430938 TATCCTTGACTGCTGGTGATGGG - Intergenic
934599345 2:95645809-95645831 TATCCTTGACTGCTGGTGATGGG + Intergenic
938582764 2:132662188-132662210 TATCCATACCTGCTTCTGAAGGG - Intronic
940722852 2:157300702-157300724 GATCATTCCCTGCTCCCGAGTGG + Exonic
941201448 2:162516347-162516369 AATGGGTCCCTGCTGCTGAGTGG + Intronic
947471322 2:230403860-230403882 TTTCATCCCCAGCTGCTGAGTGG + Intergenic
947472874 2:230414425-230414447 TCTCCTTCCCTGCTGCCAGGAGG + Intergenic
948301201 2:236908807-236908829 TATCCTTCCCTTCCCCTTAGTGG + Intergenic
1170044717 20:12072885-12072907 TCTCCTTCCCTGCTCCCCAGTGG + Intergenic
1170773477 20:19355002-19355024 TAGCCTTCTCTGATGCTAAGAGG - Intronic
1171419156 20:25006309-25006331 TAGCTTTCCATGTTGCTGAGAGG - Exonic
1171437000 20:25131570-25131592 TGTCCTTCCCAGGTGCTGTGGGG - Intergenic
1172043126 20:32060111-32060133 TTTCCTTGGCTGCCGCTGAGTGG - Intronic
1174199479 20:48797413-48797435 TATTGTTCCCAGCTCCTGAGAGG - Intronic
1175975859 20:62710101-62710123 TCTTCTTCCCTCCTGTTGAGGGG + Intronic
1177941303 21:27415387-27415409 TATCTTTCTGTGCTGCTGAATGG + Intergenic
1179483689 21:41694907-41694929 TCTCCATCCTTGCTGCTCAGAGG + Intergenic
1179939132 21:44627006-44627028 TCCCCTTCCTTGTTGCTGAGAGG - Intronic
1180126995 21:45799688-45799710 TATCCGTGCCTGGTCCTGAGGGG + Intronic
1181116543 22:20635456-20635478 TACCCTGCCCTGGTGCTGTGGGG - Intergenic
1182115949 22:27756452-27756474 TCTCCTTCCCTGGGGCTCAGTGG - Intronic
1182492402 22:30682168-30682190 TGTCCCTCCCTGCTGCAGTGAGG + Intergenic
1183060927 22:35335950-35335972 CATCTTTCCCAGCTGCTGTGCGG - Intronic
1183168272 22:36164253-36164275 TTTCCATTCCTGCTTCTGAGTGG + Intronic
1183547767 22:38464094-38464116 GATCTGTCCCTGCTGCTGGGTGG - Intergenic
1184653062 22:45928025-45928047 TCTCCTCCCCTGCTGCCTAGAGG + Intronic
950430665 3:12949180-12949202 TCTCCTGCCCAGCTGCTCAGGGG + Intronic
950431684 3:12954507-12954529 TTTCCTTCCCTCCTGCTGAGGGG - Intronic
950477563 3:13223563-13223585 TTTCCTGCCCTTCTGCTGGGAGG - Intergenic
950826786 3:15831504-15831526 TATCCTTCCCTCCTTCCCAGTGG + Intronic
953828822 3:46277897-46277919 CATCACTCCCTGCTGCTGATAGG - Intergenic
959898824 3:111636951-111636973 TATCTTTTCCTGCTTCTAAGTGG + Intronic
960705020 3:120473465-120473487 TCCCCTGCCCTACTGCTGAGGGG - Intergenic
961672840 3:128547495-128547517 TCTCCTTCCCTGTTGCTGCAGGG - Intergenic
961787014 3:129353422-129353444 TTTCCTTCCCTTCTGCTGGGAGG + Intergenic
962514297 3:136135590-136135612 TAACCTGCCCAGCTGGTGAGTGG - Intronic
964727071 3:159824454-159824476 TGTTCTTCCCAGCTGGTGAGTGG - Intronic
968981345 4:3851411-3851433 AATGCTTCCCAGCTGCTGGGAGG + Intergenic
969897992 4:10322868-10322890 GATCCTTTCCTGCTGCTGCTGGG + Intergenic
970925902 4:21452053-21452075 TATCCTTCCCAGCTTCTGGAAGG - Intronic
971762110 4:30780175-30780197 TATCCTTCCCTGATTCAGAAAGG + Intronic
972683034 4:41325253-41325275 TATAATTCCTTGCTGCTCAGGGG - Intergenic
973719167 4:53706015-53706037 TTTCCTTTCTTGCTGCAGAGTGG - Intronic
973830443 4:54754118-54754140 TATCCTGCCAAGCAGCTGAGGGG + Intergenic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
974840222 4:67290804-67290826 TATTCTTCCTTGGTGCTGAGGGG - Intergenic
976528747 4:86125513-86125535 TATGCTCCCCTGCTGCTCAAGGG + Intronic
978382004 4:108138923-108138945 TATCCTTCCAGGCTACTTAGAGG - Intronic
978633599 4:110777498-110777520 TATCCTTGCCTGGTGTTGATGGG - Intergenic
978713568 4:111814895-111814917 TTTCCTTCCATGCTGCAGAAAGG + Intergenic
980487748 4:133481747-133481769 TATCTTTCTCTGTTGCTGATAGG + Intergenic
982703788 4:158685796-158685818 TCCCCTTCCCTTCTGCTGAAAGG - Intronic
985509652 5:305614-305636 CATCCTTCCCTGCTGGTGTGTGG + Intronic
986330269 5:6712728-6712750 TGTCCTTCCCGGCTCCGGAGCGG + Intergenic
986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG + Intronic
988845691 5:35125372-35125394 CATCTTTCCCTGATGGTGAGGGG + Intronic
990678539 5:58215803-58215825 TGTCCTTCCATGCTCCTGTGGGG + Intergenic
992907108 5:81357423-81357445 AGTCTTTCCTTGCTGCTGAGAGG + Intronic
995493402 5:112716120-112716142 TTTCCTTCCCTGCTGCTTTTTGG + Intronic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
996318431 5:122187548-122187570 TTTCCTTCCCCACTCCTGAGAGG + Intergenic
997802714 5:136882596-136882618 TTTCCTTACCTGCCTCTGAGTGG + Intergenic
998038422 5:138935732-138935754 TCTCCTTTCCTGGGGCTGAGAGG + Intergenic
998150047 5:139751700-139751722 TCTCCTTCCCTGATGATGGGCGG - Intergenic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
1001211736 5:169816074-169816096 TATATTTATCTGCTGCTGAGAGG - Intronic
1001454102 5:171847675-171847697 GACCCGGCCCTGCTGCTGAGTGG - Intergenic
1001880351 5:175238541-175238563 TCTACTTCCCTGCAGTTGAGTGG + Intergenic
1002400438 5:178988897-178988919 TGTCCTTCACTGCTGCAGGGGGG + Intronic
1007321631 6:41032311-41032333 CATCCTTTCCTGCTTCTGTGGGG + Intronic
1007731574 6:43950795-43950817 TATCAAGCCCTGTTGCTGAGTGG + Intergenic
1007735259 6:43978323-43978345 GAGCCCTCCCTGCTGCTGTGAGG - Intergenic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1009425810 6:63512424-63512446 TATCCTTCATTGCTGCAAAGTGG + Intergenic
1010027452 6:71236268-71236290 TCTCCTTCCCTGATTCTCAGGGG + Intergenic
1010888407 6:81272627-81272649 CATCTTTCTCTGGTGCTGAGTGG - Intergenic
1012985656 6:105873748-105873770 TTTCTGTCCCTGCTGCTGTGGGG - Intergenic
1013342223 6:109225913-109225935 TCATCTTCCCTGATGCTGAGAGG - Intergenic
1015982557 6:138853761-138853783 TATCTTACCCTGCTGCACAGTGG + Intronic
1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG + Intergenic
1016374798 6:143409458-143409480 CATGCTGCCCTGCTGATGAGTGG - Intergenic
1016776317 6:147908591-147908613 TCTCTTTCCCTGCTGCAAAGTGG - Intergenic
1017886874 6:158606980-158607002 TCTCCTTTCCTGCTCCTGTGAGG + Intronic
1018418394 6:163621082-163621104 TTTCTCTCCCTGCTGCTGCGTGG + Intergenic
1020138162 7:5598074-5598096 TATCCCTCCCTGCTGGGGTGTGG + Intronic
1020192563 7:6011277-6011299 TCTTCTACCCTGCTGGTGAGCGG - Intronic
1021921337 7:25488465-25488487 TCTCCCTCCATGCTGCTCAGAGG + Intergenic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1024606671 7:51027723-51027745 TGTCCTTCCCTCCCGCAGAGTGG + Exonic
1026127013 7:67587903-67587925 TTTCCTTCCTTCCTGCTGAGAGG + Intergenic
1028373683 7:90121855-90121877 TATCAAGCCCTGCTGCAGAGAGG + Intergenic
1029832657 7:103277828-103277850 TATCAAGCCCTGCTGCAGAGAGG - Intergenic
1030138451 7:106282148-106282170 TGTCTTTCACTGCTTCTGAGCGG - Intronic
1030150797 7:106403059-106403081 TTTCCTTCCCTGAAGCTAAGTGG - Intergenic
1033040926 7:137917613-137917635 TACCCTTCCCTTCTTCTTAGCGG - Intronic
1034240077 7:149603629-149603651 TACCCCTTCCTGCTGCTGTGGGG - Intergenic
1037538663 8:19851337-19851359 TATGCATCCCTACTGCTGACTGG - Intronic
1037923558 8:22826969-22826991 TCTCTTTCACTGATGCTGAGAGG + Intronic
1040387029 8:46920810-46920832 CACCCATCCCTGCTGGTGAGGGG - Intergenic
1040706312 8:50132879-50132901 TATCCCTGGCTTCTGCTGAGAGG + Intronic
1042695420 8:71548839-71548861 TATCTTTCACTGCTCCTGATTGG - Intronic
1042748005 8:72128181-72128203 AATAGTTCCCTGCTGCAGAGAGG - Intergenic
1045937423 8:107697116-107697138 CATCCCTCCCTGATTCTGAGAGG + Intergenic
1046095314 8:109552158-109552180 TATCCTTCCTTGCAGCTAGGGGG - Intronic
1047170745 8:122490213-122490235 TCTGTTTCCCAGCTGCTGAGGGG - Intergenic
1048833645 8:138498251-138498273 TCTCCTTGCCTGCTGCTGCTAGG - Intergenic
1049815633 8:144598042-144598064 TCTCCTTCCCTGCTGGCGGGTGG - Intronic
1050910660 9:11065292-11065314 AATCTTTCTCTGCTGCAGAGAGG - Intergenic
1052264414 9:26554691-26554713 TTCCCTTCCCTGCTCCTGTGTGG + Intergenic
1052819823 9:33129707-33129729 TCTCCTTCCCTGCTGCTCCCAGG - Intronic
1056663364 9:88560872-88560894 TATCCATCTCTGCTGCTGTGGGG - Intronic
1057218864 9:93244906-93244928 TGGGCTGCCCTGCTGCTGAGTGG + Intronic
1059458616 9:114415422-114415444 TCTCCTTCCATTCTTCTGAGTGG + Intronic
1061022210 9:128023206-128023228 TACCCCTTCCTGCTGCTGACTGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1185961640 X:4551383-4551405 TATCCCTCTATGCTGGTGAGGGG + Intergenic
1186126782 X:6422858-6422880 TGTCCTGCCCTTCTCCTGAGAGG - Intergenic
1186346259 X:8696212-8696234 TGTCTTTCCCTGCTTCTTAGAGG - Intronic
1187648254 X:21373867-21373889 TCGCCCTCCCCGCTGCTGAGTGG - Intergenic
1189467209 X:41286314-41286336 CAGCCTCCCCTGCAGCTGAGTGG - Intergenic
1192165614 X:68826062-68826084 TATACCTCCCTGCTGCTCATGGG + Intergenic
1195066489 X:101242614-101242636 AATCATTCCCTGCAGCTTAGAGG - Intronic
1197815161 X:130490610-130490632 AATGGTTCCCTGCTACTGAGAGG + Intergenic
1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG + Intronic
1200697524 Y:6374108-6374130 TGTCCTGCATTGCTGCTGAGGGG + Intergenic
1200700548 Y:6398516-6398538 TGTCATTCCCTGCTGTGGAGTGG - Intergenic
1201033564 Y:9766182-9766204 TGTCATTCCCTGCTGTGGAGTGG + Intergenic
1201036589 Y:9790591-9790613 TGTCCTGCATTGCTGCTGAGGGG - Intergenic
1201608379 Y:15813108-15813130 TGTCCTGCCCTTCTCCTGAGAGG - Intergenic
1202175362 Y:22093988-22094010 TGTCCTTCCTTGCTGTGGAGTGG - Intronic
1202216000 Y:22492395-22492417 TGTCCTTCCTTGCTGTGGAGTGG + Intronic