ID: 1008052357

View in Genome Browser
Species Human (GRCh38)
Location 6:46913199-46913221
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008052352_1008052357 -10 Left 1008052352 6:46913186-46913208 CCGGGGAAAGTCAAGTTTTAAGA 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1008052357 6:46913199-46913221 AGTTTTAAGAAGAAGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr