ID: 1008052751

View in Genome Browser
Species Human (GRCh38)
Location 6:46916482-46916504
Sequence GCTCTGAGCACATCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008052751_1008052753 -8 Left 1008052751 6:46916482-46916504 CCTGCTGCTGATGTGCTCAGAGC 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1008052753 6:46916497-46916519 CTCAGAGCCCCTCATCGGTTTGG 0: 1
1: 0
2: 0
3: 2
4: 75
1008052751_1008052759 28 Left 1008052751 6:46916482-46916504 CCTGCTGCTGATGTGCTCAGAGC 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1008052759 6:46916533-46916555 ACCACACTTTTTTGGACATTGGG 0: 1
1: 0
2: 0
3: 10
4: 162
1008052751_1008052757 20 Left 1008052751 6:46916482-46916504 CCTGCTGCTGATGTGCTCAGAGC 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1008052757 6:46916525-46916547 GTCATCTCACCACACTTTTTTGG 0: 1
1: 0
2: 1
3: 9
4: 117
1008052751_1008052758 27 Left 1008052751 6:46916482-46916504 CCTGCTGCTGATGTGCTCAGAGC 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1008052758 6:46916532-46916554 CACCACACTTTTTTGGACATTGG 0: 1
1: 0
2: 0
3: 18
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008052751 Original CRISPR GCTCTGAGCACATCAGCAGC AGG (reversed) Intronic
900243393 1:1627183-1627205 GCTCTGGGCGCCTCCGCAGCAGG - Exonic
900313513 1:2046157-2046179 GCTCTGGGCACAGCAGCCGTGGG - Intergenic
900384210 1:2402055-2402077 ACCCTGGGCACAGCAGCAGCAGG - Intronic
900693928 1:3998473-3998495 GCTCAGAGGACATCAGCATGAGG + Intergenic
903141880 1:21344201-21344223 GCTCTGGGCACAGCAGGGGCTGG + Intronic
903298496 1:22361338-22361360 CCTCCCAGCACATCACCAGCAGG + Intergenic
903692492 1:25184236-25184258 GCTCTGGGCACAGCACCAGGAGG - Intergenic
904054186 1:27659460-27659482 ACACAGAGCACATCAGCGGCAGG + Intergenic
904538711 1:31218394-31218416 GCACTCAGCACAGCAGCACCTGG - Intronic
904743079 1:32693592-32693614 GCTCAGAGCACATGTGCTGCTGG - Intronic
905456223 1:38090051-38090073 CCTGTGAGCCCATCAGCGGCAGG - Intergenic
905646128 1:39626190-39626212 GCCCTCTGCACACCAGCAGCAGG - Exonic
907355164 1:53866459-53866481 CCCCTGAGCCAATCAGCAGCTGG + Intronic
907859243 1:58335402-58335424 GTTCTGAGCAAAGCAACAGCAGG + Intronic
912949076 1:114108050-114108072 GATCTGAGCTCAGTAGCAGCTGG + Intronic
916607035 1:166353213-166353235 GATCTGAGAGCATCAGCATCTGG + Intergenic
917982360 1:180278282-180278304 GCCCAGAGCCCTTCAGCAGCAGG - Exonic
919365274 1:196651789-196651811 GGTATGTGCAAATCAGCAGCTGG - Intergenic
919918710 1:202155206-202155228 GCTGTGAGCTCTTAAGCAGCTGG + Intronic
919929071 1:202209323-202209345 CCTCTGACCTCCTCAGCAGCAGG - Intronic
920435352 1:205943517-205943539 CCTCTGAGCCAATCAGAAGCCGG - Intergenic
920655651 1:207872637-207872659 GCTCTGAGCTTCTCAGAAGCTGG + Intergenic
921186178 1:212671499-212671521 GCTAGGATGACATCAGCAGCTGG + Intergenic
921896531 1:220407267-220407289 GCTCTTACCACATCACCTGCTGG - Intergenic
1065494463 10:26314577-26314599 GGTTTGAGCACATCAGGAGCGGG + Intergenic
1065902493 10:30221241-30221263 GCTCTGAACATCTTAGCAGCCGG - Intergenic
1067004965 10:42651907-42651929 GCTCCGACCACACCAGAAGCTGG + Intergenic
1067478410 10:46580563-46580585 GCTCAGTGCACATAAGCAACAGG + Intronic
1067616328 10:47761224-47761246 GCTCAGTGCACATAAGCAACAGG - Intergenic
1067711321 10:48653476-48653498 CTTCTGAGAACATTAGCAGCAGG - Intronic
1068145287 10:53061898-53061920 GCTGTGAGCACAAAAGCATCAGG + Intergenic
1068905293 10:62315437-62315459 GCTCTCAACACCTCAGCAACAGG + Intergenic
1071604083 10:86972637-86972659 GCTCTGCCCTCATCAGCAGGTGG - Intronic
1073863110 10:107770290-107770312 GCTCTGAGCAGATCTTCAGAGGG + Intergenic
1076324380 10:129609683-129609705 GCTCTGAGCAAAGAAGCACCAGG - Intronic
1076478741 10:130770072-130770094 CCTCTGGGTACATCAGCTGCAGG - Intergenic
1077179231 11:1204737-1204759 GCTCTGAGCTCCTGGGCAGCAGG + Intergenic
1077179268 11:1204873-1204895 GCTCTGAGCTCCTGGGCAGCAGG + Intergenic
1078531694 11:12141432-12141454 GCTCTGACCACATGAGGAGGAGG - Intronic
1079247943 11:18766948-18766970 GCTCTCAGGCCCTCAGCAGCAGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083765566 11:64839908-64839930 GCTCTGACCCCCTCAGCTGCAGG + Intronic
1084533164 11:69741249-69741271 GCTCTGAGGCCATCAGAACCTGG + Intergenic
1085917770 11:80910807-80910829 ACTCTGAGCAGGTCAGTAGCTGG + Intergenic
1086663878 11:89456483-89456505 ACTCTGAGCAGATCTTCAGCAGG + Intronic
1087713515 11:101582463-101582485 GCTGTGACCACATGTGCAGCGGG - Intronic
1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG + Exonic
1091032325 11:132201875-132201897 GCTTCGAGCACATCATTAGCAGG + Intronic
1091818681 12:3458350-3458372 GCTCTGTGCCCATCAGCACCTGG - Intronic
1091934257 12:4422975-4422997 ACTCTTAGCACTGCAGCAGCCGG - Intergenic
1093498536 12:19783894-19783916 GCGCTGTGCAGATCAGCGGCGGG + Intergenic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1099947268 12:89258834-89258856 TCTCTGATCACATCTGAAGCAGG - Intergenic
1102184319 12:110935783-110935805 GCTCTGAGAAGATCTGCAACTGG - Intergenic
1102556416 12:113729629-113729651 GCTCAGAGCTCACCTGCAGCTGG + Intergenic
1103228605 12:119309040-119309062 GCTCTGAGCACATTGCCTGCAGG + Intergenic
1104337689 12:127915401-127915423 TCTCTTAGCACATCAGCTCCTGG + Intergenic
1104750473 12:131235188-131235210 GCTCTGAGCCGAGCAGCAGGTGG + Intergenic
1104782247 12:131429274-131429296 GCTCTGAGCCGAGCAGCAGGTGG - Intergenic
1105412776 13:20185136-20185158 GCTCAGAGGCCAACAGCAGCTGG - Intergenic
1106788352 13:33129651-33129673 CGTCGGAGCACAGCAGCAGCGGG - Exonic
1115172802 14:30528274-30528296 GCTTTGTGCACTTCAGCACCAGG + Intergenic
1117069008 14:52039623-52039645 GCTCTCAGCATAGGAGCAGCAGG + Intronic
1117350988 14:54881645-54881667 GCTCTGTGCACTCCAGCAGATGG - Intronic
1118315730 14:64724958-64724980 GCTCAGAGCATTTCAGCAGTTGG + Intronic
1118833333 14:69456245-69456267 GCTTTGAGAAGAGCAGCAGCTGG + Intronic
1118857327 14:69633938-69633960 GCCTGGAGCACAGCAGCAGCTGG + Intronic
1122143935 14:99677719-99677741 GCTCTGAGCAAAACAGCTTCTGG - Exonic
1122214059 14:100192132-100192154 GCCCTGAGCCCATCCGCATCTGG - Intergenic
1124069857 15:26381216-26381238 GTTCTGAGCACATACTCAGCAGG + Intergenic
1124373213 15:29115155-29115177 GGTCTGGGGACAGCAGCAGCAGG + Intronic
1124694929 15:31856838-31856860 GCTCTGAGCTCTTTCGCAGCCGG + Intronic
1126518015 15:49557116-49557138 ACTCTGAGCATATCATCAGAGGG - Intronic
1127722299 15:61715178-61715200 GCTCTGGGCCCCTCAGCAGCAGG - Intergenic
1128638407 15:69317819-69317841 TCTCTGAGCTCAGCACCAGCAGG + Intronic
1128916279 15:71565871-71565893 GTTCTAAGCACCTCAGAAGCTGG - Intronic
1129233340 15:74208917-74208939 CCTCTGAGCCCAGCACCAGCTGG + Intronic
1129672633 15:77615804-77615826 GCACTGAGCCCAGCACCAGCAGG + Exonic
1129757285 15:78106032-78106054 GCTCTGGGGACATCAGAAGCTGG - Intronic
1130353953 15:83113352-83113374 ACCCTGAGCACTTTAGCAGCAGG + Intronic
1131602439 15:93863195-93863217 TCTCTGAGAGCACCAGCAGCAGG + Intergenic
1132860922 16:2071378-2071400 GGTGTGTGCACATCAGCAGGTGG + Intronic
1134113119 16:11528356-11528378 GCTCTTATCACAGCAGCAGCGGG + Intergenic
1139363680 16:66419463-66419485 GCACTGGCCACTTCAGCAGCAGG + Intergenic
1139648875 16:68351764-68351786 GCTCTGAGCACCACAAGAGCAGG - Intronic
1140195949 16:72855569-72855591 GCTCTTATCACCTCAGCAGAGGG + Intronic
1140889558 16:79273244-79273266 GCTCTGACCACTGCAGAAGCTGG - Intergenic
1141218879 16:82050420-82050442 GCTTTGACTACATCAGAAGCAGG - Intronic
1141576301 16:84966318-84966340 GAGCTGAGTACTTCAGCAGCTGG - Intergenic
1142388828 16:89784748-89784770 GCTCAGAGCAGATCTGCAGGAGG + Intronic
1144638882 17:16926907-16926929 GCTCCTATCACATCAGGAGCAGG - Intergenic
1147660086 17:42112678-42112700 GCGCTGAGCACAGCGGCACCAGG - Exonic
1149241279 17:54652673-54652695 ACTCTGAGAACCTCAGCAGCTGG - Intergenic
1149559271 17:57596541-57596563 GCTCTGTGCACGGCAGCAGGCGG - Intronic
1150436878 17:65160762-65160784 ACTCTGAGCACAGCAGCCTCAGG + Intronic
1150796180 17:68239156-68239178 GCTCTATGCAAAGCAGCAGCAGG - Intergenic
1152876775 17:82790810-82790832 GCTCTGAGCCCAGCAGGAGGAGG - Intronic
1153490667 18:5644685-5644707 GCTCTGAGCACATCAGGCTGGGG - Intergenic
1153496312 18:5703495-5703517 GCCATGAGGACATCAGCAGGTGG - Intergenic
1153906490 18:9666133-9666155 GCTCTGAGCACCCCAGCAGCAGG - Intergenic
1154330889 18:13428332-13428354 GCTCTGGGCAGAGGAGCAGCAGG + Intronic
1156450422 18:37263449-37263471 GCTCTGACCACATGGGCTGCAGG + Intronic
1157495261 18:48152625-48152647 ACTCTGAACACCTCAGCACCAGG - Intronic
1159274228 18:66194285-66194307 GCTCTGAGCAGATCTACAGAAGG - Intergenic
1159722789 18:71913962-71913984 GTTCTGAGGACAGCAGCAGTAGG - Intergenic
1161074865 19:2280716-2280738 CCTCTGGGAACAGCAGCAGCTGG - Intronic
1161200601 19:3012693-3012715 GCTCTGAGGAAAGCAGCAGCTGG + Intronic
1164719169 19:30419741-30419763 GATGTGAGCACATCAGGAGACGG - Intronic
1167573756 19:50307303-50307325 GCACTTGGCACATCAGCAGAGGG + Intronic
1167573866 19:50308412-50308434 GCACTTGGCACATCAGCAGAGGG - Intronic
1168137407 19:54360658-54360680 GCTCTGAGCCCACCAGATGCTGG + Intronic
1168303628 19:55421425-55421447 GCTCTGAGCACATGAACTTCAGG + Intergenic
1168374163 19:55861421-55861443 GCTCTGTGCTCACCACCAGCGGG + Exonic
931085889 2:58830463-58830485 GCTCTGAGCTGGTCAGCAGGTGG + Intergenic
932578317 2:72975172-72975194 GATGTGAGAACATCTGCAGCAGG - Intronic
932697556 2:73969374-73969396 GCTCAGAGCCCACCTGCAGCTGG - Intergenic
935457043 2:103282316-103282338 GCTCTGGGCACTGCAGGAGCTGG - Intergenic
936083889 2:109453457-109453479 TGTGTGAGCACATCAGCACCAGG + Intronic
936245757 2:110825899-110825921 TTTCTGAGCACATCAGCAGGAGG + Intronic
937257350 2:120564828-120564850 TCCCTGAGCTCAGCAGCAGCTGG - Intergenic
938260401 2:129891762-129891784 GCTGCCAGCACAGCAGCAGCAGG - Intergenic
938384188 2:130852904-130852926 GCTGGGAGCTCAGCAGCAGCCGG + Intronic
941901145 2:170679679-170679701 GCCCTGAGCTACTCAGCAGCAGG - Intergenic
942655159 2:178207592-178207614 GCTGTGAGTACATCTGCATCAGG + Intronic
945866533 2:215182429-215182451 GCTCTGACCTCCCCAGCAGCAGG - Intergenic
946148355 2:217747821-217747843 ACATTGGGCACATCAGCAGCAGG - Intronic
948412106 2:237771659-237771681 CCTCTGAACACACCTGCAGCTGG + Intronic
948522813 2:238551410-238551432 GGTGTGAGCACATCATCAGAAGG - Intergenic
1169083773 20:2814894-2814916 GCTCTGACCTCATAAGCAGCTGG - Intergenic
1172442185 20:34973615-34973637 CATCTCAGCCCATCAGCAGCGGG - Intergenic
1173017515 20:39238968-39238990 GCGCTCAGCACATCAGAAGTGGG - Intergenic
1174740104 20:53004622-53004644 TCCCTGAGCTCATAAGCAGCAGG - Intronic
1176207076 20:63895038-63895060 TCTCTGAGCGCATGCGCAGCCGG + Intergenic
1178834467 21:36084876-36084898 ACTCAGAGCTCATCAGCTGCTGG + Intergenic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1183467177 22:37985620-37985642 GTTCTGAGCTCCTCAACAGCAGG + Intronic
1184877538 22:47285005-47285027 GCTCTGAGCTCACCAGCTGCAGG + Intergenic
951306457 3:21068887-21068909 GCTCTGGGAACACCGGCAGCAGG - Intergenic
953051726 3:39350246-39350268 GCTCTGACCACACCGGAAGCTGG + Intergenic
954366816 3:50150895-50150917 GCTCTGAGCCGATCAAAAGCTGG - Intergenic
954417480 3:50400480-50400502 GCTCTGAGCACATCATGTGAGGG - Intronic
954758978 3:52860577-52860599 GCTCTCAGCACAGCAGCTGGAGG - Intronic
957928098 3:86841043-86841065 ACTCTGAGCACTCCTGCAGCAGG + Intergenic
960531701 3:118772729-118772751 GCTCAGAGAACAAAAGCAGCAGG + Intergenic
962316950 3:134364929-134364951 GCCCTGAGCTCAGCAGCAGGAGG - Intronic
962904604 3:139790340-139790362 GCTCTGAGGACAAAAGCAGATGG + Intergenic
964049611 3:152374361-152374383 GCTCTGAGGGCATCTTCAGCTGG + Intronic
965208965 3:165759878-165759900 GCTTTGAGCAGATGAGCAACAGG - Intergenic
967003320 3:185358213-185358235 GCTCTGAGCTTCCCAGCAGCAGG + Intronic
967045060 3:185728727-185728749 GCTCACAGCTCATAAGCAGCAGG + Intronic
967825059 3:193870912-193870934 CCTCTGAGTACATCAACAACAGG - Intergenic
969063474 4:4458515-4458537 GTTGTGAGCACAACAGCATCTGG + Intronic
969929153 4:10613329-10613351 GCACTGGGCACATCAGCTGTGGG + Intronic
970401096 4:15718698-15718720 GCTCTGAGGACCCCAGCACCGGG - Intronic
971029371 4:22620563-22620585 GCTCTGCCCGCAGCAGCAGCAGG + Intergenic
971104513 4:23508212-23508234 TCTCTGAGCAAGTCAGCAGCAGG - Intergenic
976868744 4:89764397-89764419 GCTCTGTGCTCACCAGCAGAAGG - Intronic
978143960 4:105349913-105349935 AACCTGAGCACATCAGCTGCTGG + Intergenic
978419945 4:108521022-108521044 GCTCTGAGCCAATCAGCAAGTGG - Intergenic
981640953 4:146943267-146943289 GATCTGAGAACATTAGCAGCAGG + Intronic
982417788 4:155157292-155157314 GCTTTGAGAACACAAGCAGCTGG + Intergenic
984231608 4:177107433-177107455 GCTATGAGCCAATGAGCAGCAGG - Intergenic
984887391 4:184462229-184462251 GCTCTGAGCCACTGAGCAGCTGG + Intronic
985553078 5:543082-543104 GGTCTCAGCACCACAGCAGCCGG + Intergenic
985694348 5:1331461-1331483 GCTCAGCGCCCATGAGCAGCCGG + Intronic
985702860 5:1384024-1384046 GCGCTGAGCCCATCAGGGGCAGG + Intergenic
985793555 5:1945806-1945828 GCTGTGAGCACATCTGCTGTGGG - Intergenic
988567270 5:32329463-32329485 GCTTTGAGTAGATCAGCAGATGG + Intergenic
988870494 5:35384622-35384644 GCTCTGGGCTCAACATCAGCTGG - Intergenic
991976094 5:72184948-72184970 GCCCTGAGCTCATCAGCAGTCGG + Intronic
997588704 5:135060032-135060054 GCTTTCAGAACAGCAGCAGCAGG + Intronic
998430087 5:142063220-142063242 GCTCTGGGCAGAGCTGCAGCTGG - Intergenic
999072562 5:148761675-148761697 CTTCTGAGCACATTAGAAGCAGG + Intergenic
1000314714 5:160078639-160078661 GCTATGTACAAATCAGCAGCAGG + Intronic
1002164556 5:177336366-177336388 GCTCTGCGCAGAGCAGCAGGAGG + Intronic
1003607663 6:7579071-7579093 GCTAAGAGCATATGAGCAGCTGG + Intronic
1005357670 6:24999942-24999964 TCTCTGAGCCCATCAGTATCAGG + Intronic
1005806293 6:29476953-29476975 GCTCTGTCCACTTCAGGAGCAGG + Intergenic
1007109715 6:39306014-39306036 GCTCTGAGCCCCTCAAGAGCAGG + Intronic
1008052751 6:46916482-46916504 GCTCTGAGCACATCAGCAGCAGG - Intronic
1010381587 6:75231734-75231756 GCTTTGGGCACAGCAGCACCTGG + Intergenic
1011465611 6:87653319-87653341 TCTCTAAGCACATCAGAAGGTGG - Intronic
1011531822 6:88331333-88331355 GCTCTGAAGTCCTCAGCAGCAGG + Intergenic
1012718068 6:102701933-102701955 GTTCTGAGCACATGAACACCTGG + Intergenic
1012839086 6:104306723-104306745 GCTCTGACCAAACCAGAAGCTGG - Intergenic
1017166305 6:151411392-151411414 CCTCTGTGCACATGAGCAGCTGG - Intronic
1018067233 6:160132620-160132642 GCTGTGAGCACATCAGCATGGGG - Intronic
1018536597 6:164827055-164827077 GCCCTGTGCACAGCATCAGCAGG - Intergenic
1021971737 7:25971481-25971503 GGTCTCAGAACATCAGCAACAGG + Intergenic
1024013734 7:45292809-45292831 CCTCTCAGCACACCAGCAGTTGG - Intergenic
1024234155 7:47385214-47385236 GAGCTCAGCACATCAGCAGAAGG + Intronic
1026498494 7:70923288-70923310 GCTCTGGGAACTGCAGCAGCAGG - Intergenic
1032846702 7:135757431-135757453 GCTCTGCCAACAACAGCAGCAGG - Intergenic
1034321193 7:150184264-150184286 ACTCTCAGCACATCACCTGCAGG + Intergenic
1034564889 7:151905434-151905456 GCTCTGGGCATAGCAGCAGCAGG + Intergenic
1034771555 7:153783000-153783022 ACTCTCAGCACATCACCTGCAGG - Intergenic
1035595117 8:851650-851672 GATCTGAGCAATTCGGCAGCTGG - Intergenic
1036185898 8:6622135-6622157 CCTTTGAGCACATGAGCAGACGG - Intronic
1037269823 8:17114619-17114641 GCTCTGAGGACACCAGCACTTGG - Intronic
1038114559 8:24538757-24538779 TCTCTGAGCAAAACAGCAACAGG - Intergenic
1041342677 8:56862776-56862798 GTTCTGAGCATCTCAGCTGCTGG + Intergenic
1041650375 8:60296347-60296369 GGGGTGAGCACATCAGCACCAGG + Intergenic
1042983789 8:74560506-74560528 GCTATGAGCAAATCAGTATCAGG + Intergenic
1049000401 8:139822381-139822403 TCTCGGAGCACATGAGCACCTGG - Intronic
1049566596 8:143343473-143343495 ACTCTGAGCACAGCACCAGCTGG + Intronic
1049758014 8:144319377-144319399 GATGTGAGCAGATCAGCAGCTGG - Intronic
1051478484 9:17534526-17534548 CCTCTGAGCTCATCTCCAGCGGG + Intergenic
1051507573 9:17843185-17843207 GCTCTCAACACTTCAGCAGAGGG - Intergenic
1052490506 9:29160949-29160971 GCCCTGTGCACAACATCAGCAGG - Intergenic
1053178726 9:35949298-35949320 TCTCAGAGCACAGCAGCAGAAGG + Intergenic
1055908462 9:81320034-81320056 GCTCTGTGAACATCATCAGAAGG - Intergenic
1056462261 9:86819139-86819161 GCTCTGTGCAAACCTGCAGCTGG - Intergenic
1056813015 9:89778821-89778843 GATTTGAGCACAGCAGAAGCGGG + Intergenic
1057225511 9:93290985-93291007 CCTCAGCGCACATCAGCCGCAGG + Intronic
1057232837 9:93335277-93335299 TCTCTGAGCAAAACACCAGCTGG + Intronic
1057252676 9:93516344-93516366 TCTCTGAGCAAAACACCAGCTGG - Intronic
1057292243 9:93814145-93814167 GCTCTGCCCACATCAGCACTTGG - Intergenic
1059329927 9:113528513-113528535 GCTCAGAGCGCTTCAGAAGCAGG - Intronic
1060355829 9:122905904-122905926 GCTCTGAGCTCCTCAAAAGCTGG + Intergenic
1060391650 9:123282733-123282755 GCTGTGAGCTTCTCAGCAGCAGG + Intergenic
1203452957 Un_GL000219v1:137734-137756 GCTCTGAGAAAAACAGCACCGGG + Intergenic
1186371201 X:8949235-8949257 GCTCTGAGCTCTGCAGCTGCAGG + Intergenic
1186556631 X:10567016-10567038 GCTCCAAGCACATCAGCCCCCGG + Exonic
1187172954 X:16869839-16869861 GCTCCGAGCACTTCCGGAGCCGG - Exonic
1189089817 X:38069744-38069766 TGTCTGATCACATCAGCACCTGG + Intronic
1190343241 X:49313852-49313874 GCTCTGACCACACCAGAGGCTGG + Intronic
1198562976 X:137871341-137871363 GCTGTGAGCACAGCAGCAGAGGG - Intergenic
1199322052 X:146451478-146451500 GCTCTGAGAACTGCATCAGCTGG + Intergenic