ID: 1008053986

View in Genome Browser
Species Human (GRCh38)
Location 6:46927762-46927784
Sequence CTCTATGAAAGCTGGTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008053986_1008053988 1 Left 1008053986 6:46927762-46927784 CCTAGGTACCAGCTTTCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1008053988 6:46927786-46927808 ACTCAGAACAGCATCATAATAGG No data
1008053986_1008053989 10 Left 1008053986 6:46927762-46927784 CCTAGGTACCAGCTTTCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 106
Right 1008053989 6:46927795-46927817 AGCATCATAATAGGCGATAAAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008053986 Original CRISPR CTCTATGAAAGCTGGTACCT AGG (reversed) Intronic
906225860 1:44120578-44120600 CTTTATGAAAGCTGGTTCTGTGG + Intronic
906844099 1:49172076-49172098 CTCTATAATAGCTGGAACATAGG - Intronic
910375903 1:86570146-86570168 CCCTAAGAAAGCTGGTATCAGGG - Intronic
915555399 1:156658127-156658149 CTCTATGAGAACTGGAACCCTGG + Exonic
918464232 1:184805691-184805713 CTCTATGAAGGCTGGGACGCGGG + Intronic
918609374 1:186469940-186469962 CTCTATGAAAAATTATACCTGGG - Intergenic
918628311 1:186684086-186684108 CTCCATGAAAACCAGTACCTGGG + Intergenic
920307863 1:205030601-205030623 TCCTATGAAAGCTGGCAGCTAGG + Intergenic
1064765450 10:18665797-18665819 ATCTAGGAAAGATGGTATCTGGG + Intronic
1064944369 10:20771610-20771632 CACTCTGAAAGCTGGATCCTAGG - Intergenic
1072434153 10:95400380-95400402 CTCTTTCAAAGATGGTACCAAGG + Intronic
1072894453 10:99354666-99354688 TTCTTGGAGAGCTGGTACCTGGG + Intronic
1077518152 11:3014808-3014830 CTCTTTGCAAGTTGGTTCCTGGG + Intronic
1077796584 11:5498771-5498793 GTCTATTAAATCTGTTACCTGGG - Intronic
1078641190 11:13098309-13098331 CTCTATGTAGGGTGGTGCCTGGG + Intergenic
1079104993 11:17565151-17565173 CTATATGTAATCTGGTACCCTGG - Intronic
1080898498 11:36465969-36465991 CTCCATGAGAGCAGGCACCTTGG - Intergenic
1086169574 11:83820546-83820568 CACTCTGAAAGCAGGTACCAAGG - Intronic
1087991112 11:104745941-104745963 CTCTCTGAAGCCTGCTACCTGGG + Intergenic
1088011469 11:105006618-105006640 CTGAATGAGAGCTGGTATCTTGG + Intronic
1088749957 11:112835095-112835117 ATCTGTGAAAGCTGGTGGCTTGG + Intergenic
1089545047 11:119217618-119217640 CTATATCAAGTCTGGTACCTGGG - Intronic
1093393826 12:18655902-18655924 CTCTATGTAATGTGGTACCCTGG + Intergenic
1097657096 12:62378992-62379014 CTCCATGAAAGCAGGTACCAGGG - Intronic
1098138329 12:67426648-67426670 CTCTTTGAAAGCAAGTCCCTGGG - Intergenic
1098361036 12:69654940-69654962 CTCTATGATATCTGTTTCCTTGG + Exonic
1102146315 12:110657721-110657743 CTCTATGAAAACTCATCCCTGGG + Intronic
1103212059 12:119174498-119174520 CTCCATGAAAGCAGGACCCTTGG - Intergenic
1104539860 12:129653925-129653947 CTCAATGTAACCTGGTACCTTGG - Intronic
1105636955 13:22224944-22224966 CTCTATGAAAATTAGTACCTGGG + Intergenic
1108373589 13:49793377-49793399 CTCAATGAGAGCAGGTACTTTGG + Intergenic
1111335132 13:86811421-86811443 TTCTATGGAAACTAGTACCTAGG + Intergenic
1112185910 13:97127575-97127597 CTCTCTGAAGTCTGCTACCTGGG - Intergenic
1115136644 14:30117317-30117339 CTTTTTGAAAACTGGTACATGGG - Intronic
1116053133 14:39829060-39829082 TTCTGTGAAAGCTGGTACTCAGG + Intergenic
1121956000 14:98213894-98213916 CACTATCAAAGCTGCTACTTAGG + Intergenic
1127952371 15:63821862-63821884 CTCCATGAAAGCAGGAACCTTGG - Intronic
1128930906 15:71704194-71704216 CTCTAAGAAAACTGGTTTCTTGG - Intronic
1138629079 16:58279271-58279293 CACTTGGAAAACTGGTACCTTGG + Intronic
1138932532 16:61677966-61677988 CTCTCTGAAGCCTGCTACCTTGG + Intronic
1139385342 16:66565260-66565282 CTATCTGAGAGCTGGTGCCTGGG - Intronic
1140941648 16:79726705-79726727 ATCTATGAAAGGTGCTTCCTGGG + Intergenic
1141202432 16:81908308-81908330 CTCTATGTTATCTGGTACCCTGG + Intronic
1142969906 17:3604261-3604283 CTCTTTGAGAGCAGGTGCCTAGG - Intergenic
1144659327 17:17058249-17058271 CTCTTTGCAAGCAGGGACCTGGG + Intronic
1151598692 17:75093465-75093487 CTCTGTGACACCTGGTACTTGGG + Intronic
1155976091 18:32133407-32133429 TTTTATGTATGCTGGTACCTGGG + Intronic
1156936254 18:42712287-42712309 CTCTCTGAAAGCTTTTACCTGGG - Intergenic
1156996094 18:43468693-43468715 CTCTATTAAAGTTGTTACATGGG + Intergenic
1157783048 18:50457201-50457223 CTCTCTGAAGCCTGCTACCTGGG - Intergenic
1158338683 18:56441547-56441569 CTTCATGAAAGCAGGGACCTTGG + Intergenic
1158531673 18:58268292-58268314 CTCTGTGAGGGCTGCTACCTAGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1166022791 19:40048235-40048257 CTCTATGATTGCTTGAACCTGGG - Intronic
928433977 2:31241881-31241903 CACTTTGAAAGCTGGCACCGAGG - Intronic
935458969 2:103306234-103306256 TTTTATGAAAGCAGGTACATGGG - Intergenic
936466273 2:112753986-112754008 CTCTATGAAGGCAGAAACCTTGG + Intronic
947018937 2:225653352-225653374 CTCAATGAAAGCAGGTTCTTGGG + Exonic
1170500028 20:16965720-16965742 CTCTTTGAGGGCTGTTACCTAGG + Intergenic
1170668391 20:18406696-18406718 CTGTGTTCAAGCTGGTACCTAGG - Intronic
1171368510 20:24644690-24644712 CTCTCAGATAGCTGGTTCCTGGG - Intronic
1173105977 20:40134180-40134202 CTTTACTAAAGCTGGTACATTGG - Intergenic
1173720891 20:45257047-45257069 CTTTATGAAAACAGGTAACTAGG - Intergenic
1174623948 20:51898891-51898913 CTCTATGAAAATTGTTTCCTAGG - Intergenic
1175356490 20:58373072-58373094 GCCTTTGAAAGCAGGTACCTGGG - Intergenic
1175479837 20:59302856-59302878 CCCCATGAAAGCTGCTACCAAGG - Intronic
1180613068 22:17109841-17109863 CTCTCTCAAAGCTGGGATCTGGG - Exonic
950500411 3:13360044-13360066 CTCTATGAAAGCTGGCATAGCGG + Intronic
951362822 3:21744922-21744944 CCCTATGAAAGCTAGTACTCGGG - Intronic
951580818 3:24160543-24160565 CTCTACAACAGCTGGTACCGAGG + Intronic
956587318 3:70878445-70878467 CTCTACCAAAGCAGTTACCTTGG + Intergenic
958530833 3:95328837-95328859 CTCTGTCAAGGCTGGGACCTTGG - Intergenic
960428448 3:117538263-117538285 CTTAATGAAAGGTGGTATCTTGG + Intergenic
962276191 3:134015471-134015493 CTCTCTGAAACTTTGTACCTTGG - Intronic
966392677 3:179468917-179468939 CTCTCTGAAGCCTGCTACCTGGG + Intergenic
966739742 3:183221566-183221588 CTGTGGGAAAGCTGGAACCTAGG + Intronic
972553628 4:40159305-40159327 TTATACGAAAGCTGGTACTTTGG + Intergenic
972564047 4:40254215-40254237 CTCTATGAAAGCGGGAACTTTGG - Intergenic
976963919 4:91012097-91012119 CTCTTAGAAAACTGGTGCCTTGG - Intronic
980159942 4:129148794-129148816 GACTCTGAAAGCTGGTAACTTGG - Intergenic
981558977 4:146026371-146026393 CTCTATAAAACCTGCTGCCTTGG - Intergenic
984074576 4:175159513-175159535 TTCTCTGAAGGCTGCTACCTAGG - Intergenic
984586290 4:181568594-181568616 CTCAGGGAAATCTGGTACCTAGG + Intergenic
986237468 5:5925671-5925693 CTATATGAAAGCCTGTGCCTGGG + Intergenic
987297450 5:16566471-16566493 CTGCATTAAAGCTGGTAGCTGGG - Intronic
989526312 5:42457161-42457183 CTCTCTGAGAGCAAGTACCTGGG + Intronic
990774864 5:59294837-59294859 CTTTATGAAAGCTAATAACTAGG + Intronic
991773038 5:70057655-70057677 CTCTCTGAAGCCTGCTACCTGGG + Intronic
991852331 5:70933079-70933101 CTCTCTGAAGCCTGCTACCTGGG + Intronic
993962260 5:94313794-94313816 CTGTATGAAAACTGATAGCTAGG - Intronic
994997930 5:107088402-107088424 CTTTATAAAGACTGGTACCTGGG + Intergenic
999973086 5:156884310-156884332 CTCTATGAAAACAGTCACCTTGG - Intergenic
1001273424 5:170332653-170332675 CTCTCTGAAGCCTGCTACCTGGG - Intergenic
1002327322 5:178418397-178418419 CTCCAGGAAAGCTGGAACGTAGG - Intronic
1004218109 6:13720874-13720896 CTCAATGATATCTGGCACCTTGG - Intergenic
1008053986 6:46927762-46927784 CTCTATGAAAGCTGGTACCTAGG - Intronic
1008165838 6:48137254-48137276 GTCTATGAAAAATAGTACCTAGG + Intergenic
1009777468 6:68222983-68223005 CTCTAAGAAGACTGGTACCTCGG + Intergenic
1011874827 6:91945160-91945182 ATTTATGAAAGCTGGTTCTTTGG + Intergenic
1013573606 6:111455327-111455349 CTTAATGAAAGCAGGTACCTTGG - Intronic
1015934722 6:138397197-138397219 CTCTATGACTTCTGGGACCTCGG + Intergenic
1019919818 7:4156410-4156432 CTCCATTAAAGCTGGGACCAAGG + Intronic
1024140466 7:46458027-46458049 CTCTCTGAGGGCTGCTACCTGGG - Intergenic
1026001418 7:66561621-66561643 CTTTATTAAAGGTAGTACCTAGG - Intergenic
1042817437 8:72892772-72892794 CTCTATGAAAACTGTTACCCAGG + Intronic
1045836482 8:106527288-106527310 CTCCATGAGAGCAGGTACCATGG - Intronic
1047156219 8:122321727-122321749 CTCTTTGAAAGCACATACCTAGG - Intergenic
1049347003 8:142144443-142144465 CATTATGAAAGCTGCTCCCTGGG + Intergenic
1051364698 9:16313288-16313310 GTCCATGAAACCTGGAACCTGGG + Intergenic
1054909394 9:70440044-70440066 GTCTGTGAAAACTGGTATCTTGG - Intergenic
1056302030 9:85251762-85251784 CTCTGTGAGGGCTGGGACCTTGG - Intergenic
1057423323 9:94929126-94929148 TTATCTGAAACCTGGTACCTAGG + Intronic
1059745236 9:117193873-117193895 CTCTCTGAAAACTGGCATCTGGG + Intronic
1185849557 X:3472879-3472901 CTCTCTGAAGCCTGCTACCTGGG - Intergenic
1192763178 X:74118134-74118156 GTCTATGCAAGCTGGTGCCTGGG - Intergenic
1193806502 X:86002182-86002204 CTCTCTGAAAGCTGGAACCTGGG + Intronic
1198798939 X:140430297-140430319 AACCATGAAAGCTGGTAGCTTGG + Intergenic
1200813669 Y:7509682-7509704 CTCTCTGAAGCCTGCTACCTGGG + Intergenic