ID: 1008059693

View in Genome Browser
Species Human (GRCh38)
Location 6:46984426-46984448
Sequence AAGCTCATCTCTGGGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008059693_1008059696 2 Left 1008059693 6:46984426-46984448 CCATCTCTCCCAGAGATGAGCTT No data
Right 1008059696 6:46984451-46984473 AGTGAAAGTGAAGAATTTCCTGG No data
1008059693_1008059697 3 Left 1008059693 6:46984426-46984448 CCATCTCTCCCAGAGATGAGCTT No data
Right 1008059697 6:46984452-46984474 GTGAAAGTGAAGAATTTCCTGGG No data
1008059693_1008059699 5 Left 1008059693 6:46984426-46984448 CCATCTCTCCCAGAGATGAGCTT No data
Right 1008059699 6:46984454-46984476 GAAAGTGAAGAATTTCCTGGGGG No data
1008059693_1008059698 4 Left 1008059693 6:46984426-46984448 CCATCTCTCCCAGAGATGAGCTT No data
Right 1008059698 6:46984453-46984475 TGAAAGTGAAGAATTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008059693 Original CRISPR AAGCTCATCTCTGGGAGAGA TGG (reversed) Intergenic
No off target data available for this crispr