ID: 1008062586

View in Genome Browser
Species Human (GRCh38)
Location 6:47014171-47014193
Sequence TCTGATCTGCAAAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 1, 2: 6, 3: 41, 4: 384}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008062583_1008062586 -6 Left 1008062583 6:47014154-47014176 CCCTTGGTCTTTTGTTTTCTGAT 0: 1
1: 0
2: 5
3: 75
4: 841
Right 1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG 0: 1
1: 1
2: 6
3: 41
4: 384
1008062580_1008062586 11 Left 1008062580 6:47014137-47014159 CCAGAGGAACTATTGGCCCCTTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG 0: 1
1: 1
2: 6
3: 41
4: 384
1008062584_1008062586 -7 Left 1008062584 6:47014155-47014177 CCTTGGTCTTTTGTTTTCTGATC 0: 1
1: 0
2: 4
3: 43
4: 523
Right 1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG 0: 1
1: 1
2: 6
3: 41
4: 384
1008062582_1008062586 -5 Left 1008062582 6:47014153-47014175 CCCCTTGGTCTTTTGTTTTCTGA 0: 1
1: 1
2: 1
3: 80
4: 743
Right 1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG 0: 1
1: 1
2: 6
3: 41
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008062586 Original CRISPR TCTGATCTGCAAAATGAGGT TGG Intronic
901091264 1:6643141-6643163 TCTGATCTGCCACAGGAGGGAGG + Intronic
901234154 1:7658606-7658628 TCTTATCTGTAAAATGAGTCTGG + Intronic
902065516 1:13682496-13682518 TCTGATGTGAAAAGTGAGTTGGG - Intergenic
903330633 1:22595306-22595328 GCTCATCTGCAAGAAGAGGTGGG + Exonic
903411315 1:23145771-23145793 ACTCATCTTAAAAATGAGGTTGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
904910871 1:33933228-33933250 TCTGCTCTGCCAACTTAGGTTGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905907248 1:41627275-41627297 TCTCACTTGCAAAATGAGGCTGG - Intronic
906646247 1:47477570-47477592 TCTCATCTGCAAGATGGTGTGGG - Intergenic
906847330 1:49207233-49207255 TCAGTTCTGCTAAATCAGGTAGG - Intronic
907344517 1:53763666-53763688 ACAGCTCTGCAAAATGAGGTGGG + Intergenic
907400193 1:54220470-54220492 GCTGATCTGCAAAGTGGGGCAGG + Intronic
907615648 1:55922793-55922815 ACAAATCTACAAAATGAGGTAGG - Intergenic
908282762 1:62559710-62559732 TCTTTTCTGCACAGTGAGGTAGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
910418703 1:87031253-87031275 TCTTATCTCCAAAATGGGATAGG + Intronic
910982618 1:92974114-92974136 TTTAATCTGCACAACGAGGTTGG - Intergenic
911664035 1:100534231-100534253 TCTGCCCTGCAAATTTAGGTGGG + Intergenic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
912853824 1:113149600-113149622 TCTGGTCTGCTAAAAGAGGAGGG - Intergenic
916016846 1:160757342-160757364 GCTGATCTGGAAAAGGAGGTGGG + Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917592316 1:176488985-176489007 TCTCATCTGTATAATAAGGTTGG + Intronic
921292291 1:213670067-213670089 TGTCATCTGCAAAATGAAGCAGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921549391 1:216515108-216515130 TCTCATCTGTAAAATAAGGCAGG - Intronic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
921990394 1:221359919-221359941 TATGATCTGCAAATTTAGTTAGG - Intergenic
922224944 1:223637900-223637922 TCTAATCTGTAAAATGAGTTTGG + Intronic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924641098 1:245834632-245834654 TCAGAACTGTGAAATGAGGTTGG - Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063103946 10:2976070-2976092 TCTGATGTACAAAATTAGTTAGG + Intergenic
1064193966 10:13230627-13230649 TCTGATGTGCAAGAGGAGGCTGG + Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1066181956 10:32971244-32971266 GCTGTTCTGCAAAATACGGTGGG - Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069855952 10:71441126-71441148 TCTCCTCTGTAAAATGAGCTGGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070789790 10:79182204-79182226 TTTCATCTGAAAAATGAGCTTGG - Intronic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071580147 10:86761828-86761850 ACAGATATGAAAAATGAGGTGGG + Intronic
1071786912 10:88911370-88911392 TCTGATGTGCCTAATGATGTAGG + Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1073234098 10:101998774-101998796 TCTTATTTGCCAAGTGAGGTAGG - Intronic
1073608323 10:104918284-104918306 TCTCATCTGTAAAATGTTGTTGG - Intronic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074383601 10:112999930-112999952 TCTCATCTGTAAAATGAATTGGG + Intronic
1074760543 10:116664420-116664442 TCTCTTCTGCGAAATGAGGAGGG - Intronic
1075275114 10:121086215-121086237 TCTCATTTGTAAAATGAAGTTGG - Intergenic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1077048728 11:557247-557269 TCTGATCTGTAGAATGCGTTGGG - Intronic
1077676795 11:4201887-4201909 TCTTAACTGCAAAATAAGTTGGG - Intergenic
1078746034 11:14115038-14115060 TCTGATCTGTAAAATGTTCTGGG + Intronic
1080181634 11:29432806-29432828 TCTCATCTGTAAAATGAGCTAGG + Intergenic
1080419877 11:32100339-32100361 TCTGCTCTGGAAACTGGGGTGGG + Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081679657 11:44992709-44992731 TCTCATCTGTAAAATAGGGTTGG + Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086668699 11:89520020-89520042 TATGAAGTGTAAAATGAGGTAGG + Intergenic
1086722690 11:90140678-90140700 TCTGATCTGCAAATGAGGGTGGG - Intronic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088753256 11:112863921-112863943 TCAGAGCTGCAAAATGAAGGGGG - Intergenic
1091544418 12:1491740-1491762 TCTGATTTGCAACATGAAGCTGG - Exonic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092728274 12:11505382-11505404 TCTTGTCTGGAAAATGGGGTTGG - Intergenic
1093277015 12:17141398-17141420 TTTGGTCTACAAAATGAGGCAGG - Intergenic
1097915598 12:65017629-65017651 TCTCATCTGTAAAATGATGCTGG + Intergenic
1098625522 12:72660951-72660973 TCTGATATCCAACATGTGGTTGG - Intronic
1100723851 12:97387547-97387569 TCTGAAATTCAAAATGAAGTAGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101686599 12:107029873-107029895 TATGCTCTGAAAAATCAGGTGGG + Intronic
1101827537 12:108232235-108232257 TCTCATCTGTAAAATGGGTTGGG + Intronic
1102568566 12:113813199-113813221 TCTAATCTGTAAAATGATGGGGG + Intergenic
1102818195 12:115886016-115886038 TCTGATGAGCAAAATGACTTGGG - Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103013847 12:117478974-117478996 TGTGATCTGCAAGTTGATGTGGG - Intronic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103718797 12:122962334-122962356 TCATATCTGCAAAATGGGCTGGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105442684 13:20428690-20428712 TCTGACCTCCAATTTGAGGTAGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1108206002 13:48091283-48091305 TCTGATGAGCAAAATAAGATTGG + Intronic
1108767713 13:53653281-53653303 TCTGATCCTCAAAATAAGGTTGG - Intergenic
1109850923 13:68062099-68062121 TCTGATCTGGTACATGGGGTAGG - Intergenic
1110111205 13:71748247-71748269 TCTGCTCAGCAAAAAGTGGTAGG + Intronic
1111008970 13:82287030-82287052 TGTGACCTCCAAAATTAGGTGGG - Intergenic
1111975290 13:94960927-94960949 CCTGATTTTCAAAATGTGGTAGG + Intergenic
1112228920 13:97568484-97568506 ACTGATATGGAAAATGAGGCAGG - Intergenic
1113546504 13:111154874-111154896 TCTTATCTGTAAACTGAGATGGG + Intronic
1113556278 13:111238315-111238337 TCTCATTTGTAAAATGAGATTGG + Intronic
1114368095 14:22052267-22052289 ACAGATCTGCAAAATGTGGGAGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115157836 14:30360541-30360563 ACTCATTTGCTAAATGAGGTAGG + Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1117003746 14:51397115-51397137 TCTGATCTGCAAGAGGAGACTGG + Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118166547 14:63341803-63341825 TCTGCACTCCAAAAAGAGGTTGG + Intergenic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119831011 14:77702708-77702730 TCTATTCTGCAAAATGAGATGGG + Intronic
1119887961 14:78159792-78159814 GCTGGTCTATAAAATGAGGTGGG - Intergenic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120154901 14:81082810-81082832 TTTCATCTGCAAAATTAGATGGG - Intronic
1120719441 14:87874459-87874481 TCTTATCTACAAAATGGGGGTGG + Intronic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1124618756 15:31262101-31262123 TTTCCTCTGTAAAATGAGGTAGG + Intergenic
1126600991 15:50427360-50427382 TTTCATCTGCAAAATGAAATAGG - Intronic
1126925535 15:53581670-53581692 TCTGCTCTGCGAAGTGAGTTAGG - Intronic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127985090 15:64063313-64063335 TCTTACCTGTAAAATGAAGTTGG + Intronic
1128736731 15:70057845-70057867 CCTGCTCTGTAAAAAGAGGTGGG - Intronic
1128826596 15:70723598-70723620 TGAGATCTGAAAAATGAGTTAGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129839343 15:78734226-78734248 TCTGAACTGCAAAACCAGATGGG + Intergenic
1130034503 15:80344720-80344742 TCTGAGCCCAAAAATGAGGTGGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1134201143 16:12200122-12200144 TTTCATCTGTACAATGAGGTTGG + Intronic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1135038308 16:19096911-19096933 TCTGATCTGGAAAAGGTGGCTGG - Intergenic
1136158159 16:28399523-28399545 TCTCATCTGTAAAATAAGGCAGG - Intronic
1136204928 16:28715760-28715782 TCTCATCTGTAAAATAAGGCAGG + Intronic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1138724378 16:59119898-59119920 CCTGATCAGCAAGAGGAGGTAGG - Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1143208975 17:5169124-5169146 TCTGTTCTGGAACATCAGGTTGG + Intronic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1144618466 17:16798599-16798621 TCTGTTCTGGAACATCAGGTTGG + Intronic
1144894240 17:18517094-18517116 TCTGTTCTGGAACATCAGGTTGG - Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145137991 17:20427146-20427168 TCTGTTCTGGAACATCAGGTTGG + Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146227589 17:31080162-31080184 TCTGATAGGCAAAATGAGAAAGG - Intergenic
1146558298 17:33846474-33846496 TCTGATCTGCAGAGTGGGATGGG + Intronic
1146594930 17:34160149-34160171 TCTCATCTGTAAAATGGGCTTGG - Intronic
1147651600 17:42065406-42065428 TCTGATCTGCAAAGTAAGCATGG - Intergenic
1148558978 17:48595190-48595212 GCTGATCTGCTACTTGAGGTGGG + Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149871154 17:60183074-60183096 TCTGTTCTGGAACATCAGGTTGG - Intronic
1151071271 17:71215299-71215321 ACTAATCTGAAAAATGAGTTAGG + Intergenic
1151200235 17:72462585-72462607 TCTGTTCTGCAAAATCTTGTGGG - Intergenic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1156818333 18:41339829-41339851 TCTGCTCTGAAGCATGAGGTGGG - Intergenic
1157145283 18:45156296-45156318 TCTGATGTGAAAACTGAGGCAGG - Intergenic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1159801995 18:72912579-72912601 ACAGATCAGGAAAATGAGGTGGG - Intergenic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1164407506 19:27965164-27965186 TCTTATCTGTAAAATGGTGTTGG + Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166371766 19:42305753-42305775 TCTGACCTGTAAAATTGGGTTGG - Intronic
1167557352 19:50204539-50204561 TCTGATGTGGAAACTGAGGCAGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926448862 2:12977589-12977611 ACTTATATGTAAAATGAGGTTGG - Intergenic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
930688452 2:54333586-54333608 TTTTAACTGCAAAATGATGTGGG + Intronic
931603581 2:64029255-64029277 ACTGATCTGCAAAGTAAAGTTGG - Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
932828219 2:74960460-74960482 TCTGATCTGTAACATGATGAGGG - Intronic
933069585 2:77840277-77840299 TCTCATCTCTAAAATAAGGTTGG - Intergenic
934783487 2:96987822-96987844 TCTGAGGGGGAAAATGAGGTCGG - Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935127146 2:100234671-100234693 TCTCATCTGCAACGTGTGGTTGG + Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936828535 2:116611200-116611222 TCTTATTTGCAAAATAAAGTAGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937239335 2:120450256-120450278 ACTCATCTGCCAAATGAGGCTGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938833893 2:135079827-135079849 TCTCATCTATAAAATGAGGTTGG + Intronic
939303509 2:140379024-140379046 TTTCATCTGGAAAATGAAGTAGG + Intronic
940150158 2:150591407-150591429 TCTCATTTACCAAATGAGGTTGG + Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941759680 2:169228132-169228154 TCTTATTTGCAAATTGAGGGAGG - Intronic
943674614 2:190704922-190704944 TTTGATTTGAAGAATGAGGTGGG + Intergenic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
946121849 2:217523214-217523236 TCTCATCTGCAAAATTAAGGTGG - Intronic
946437059 2:219664210-219664232 TCTGTTGTGCAAAAGGAGGAGGG + Intergenic
946695098 2:222348813-222348835 GCTGCTCTGGAAAAGGAGGTGGG - Intergenic
946853766 2:223933124-223933146 TCTCCTCTACAAAATGAGGCTGG - Intronic
946854424 2:223939183-223939205 TCTGATTTGGAAAGTCAGGTGGG - Intronic
947550335 2:231041139-231041161 TCTGATTTGCAAAAGTGGGTGGG - Intronic
947885133 2:233563281-233563303 TCTTATCTGGAAAAAGAAGTTGG + Intronic
948243251 2:236456269-236456291 CCTCATCTTAAAAATGAGGTAGG - Intronic
1169483910 20:6010284-6010306 TCAGATCTGCAAAAAAAAGTTGG + Intronic
1169941170 20:10938875-10938897 TCAGATCTGCAGAATGAAGGGGG - Intergenic
1170998382 20:21388603-21388625 TCTGGGTGGCAAAATGAGGTGGG + Intronic
1171090963 20:22285470-22285492 TCTGTTCAGCAACATGAGCTTGG - Intergenic
1172154085 20:32811304-32811326 TCTGATCTGGGGAAAGAGGTTGG + Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1172624006 20:36337104-36337126 TCTGATGCGCAGAATGAGTTTGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1173073305 20:39791363-39791385 TCTCATGTGCTAAATGTGGTGGG - Intergenic
1173099955 20:40076989-40077011 TCTGGGGTGCAAAATGAGATAGG + Intergenic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174468681 20:50738700-50738722 AATTATCTGGAAAATGAGGTGGG + Intronic
1174706811 20:52664751-52664773 TCTCATCTGCAAGATGAGGTGGG - Intergenic
1174854601 20:54031425-54031447 TCTGCTCTCCAAATTTAGGTGGG + Intronic
1178161247 21:29918373-29918395 TCTTGTCTGTAAAATGAGATTGG - Intronic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178473524 21:32916826-32916848 TCTCATCTACAAACTGAGGGTGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179123499 21:38570522-38570544 TGTGATCTATAAAATGAGGGTGG - Intronic
1179994863 21:44969360-44969382 TCTCATCTGAAAAATGTGCTTGG + Intronic
1180906945 22:19420573-19420595 TCTGTTTTGCAAAATGAGGGGGG - Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1184340626 22:43884019-43884041 TCTCCTCTGCAAAATGAGACTGG - Intronic
951501768 3:23395730-23395752 TCTGAACTGCAAAACTAGGAAGG + Intronic
954016950 3:47701700-47701722 TCTGCTCAGCAGACTGAGGTAGG + Intronic
954440321 3:50518206-50518228 ACTGATGGGCAAACTGAGGTTGG - Intergenic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955219479 3:57011874-57011896 TCTGATTTGCACTATGAGGAAGG + Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
958002158 3:87763619-87763641 AATGATCTGCAAAATAAGGGGGG - Intergenic
958159045 3:89792619-89792641 TCTTATTTCCAAAATGTGGTTGG + Intergenic
958173421 3:89965205-89965227 TCTGGTCTGCTAAATTAGGAAGG - Intergenic
960265937 3:115621237-115621259 TCTAATACTCAAAATGAGGTAGG - Intergenic
960789597 3:121413870-121413892 TCTTATTTGTAAAATGAGGGGGG - Intronic
961200156 3:125039014-125039036 TCTAATCTCCAATATGAGGAGGG - Intronic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
965356183 3:167675984-167676006 TATGATCACAAAAATGAGGTAGG + Intergenic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
966167987 3:177042705-177042727 TCTTATGTGTAAAATGAGATGGG - Intronic
967316953 3:188158693-188158715 TCTCATCTGCAAAATGAGACTGG - Intronic
967328288 3:188264553-188264575 GCTGATTTTTAAAATGAGGTAGG + Intronic
968389198 4:174998-175020 TCTGATCTGCAAAATGCCATGGG - Intergenic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
970569805 4:17368639-17368661 TCTCATCTAAAACATGAGGTTGG - Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971449719 4:26788394-26788416 TGTAAACTGCAAAATTAGGTGGG + Intergenic
971517339 4:27504074-27504096 TCTGATCTTAAATATGAGGATGG - Intergenic
971950292 4:33335938-33335960 TAAGATGTGAAAAATGAGGTTGG + Intergenic
972339683 4:38140729-38140751 TTTCATGTACAAAATGAGGTGGG - Intergenic
972647070 4:40979059-40979081 TCTCATCTGCACAATGAGTTCGG + Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
975693851 4:76992534-76992556 TCTCATCTGTAAATTGAGTTTGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976787983 4:88844427-88844449 TCAGATCTGCAAAATGACCTTGG - Intronic
977415705 4:96730294-96730316 TCTTATCTGCCACATGAGGAAGG - Intergenic
979499170 4:121419048-121419070 TCTCATCTGCAAAAGTAAGTAGG + Intergenic
981473815 4:145167357-145167379 TCTGATTTTCAAAATGAAATAGG + Intronic
983261674 4:165463689-165463711 GTTTATCTGCAAAATGAAGTTGG + Intronic
983335540 4:166387171-166387193 TCTTCTATGCAAAATGGGGTTGG + Intergenic
984193815 4:176634769-176634791 TCTCATCTGCAACATGACTTTGG - Intergenic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
986172183 5:5324105-5324127 TCTGCTCTGTAAAATGGGATTGG - Intergenic
986367587 5:7048864-7048886 TCTGTTCTGGACAATGAGGAAGG + Intergenic
986394830 5:7318306-7318328 TCTCATCTACAAAATAAGGGTGG + Intergenic
986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG + Intergenic
987756635 5:22105387-22105409 TCTTATTTGAAAAATGAGGCTGG - Intronic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
988704734 5:33713940-33713962 TCTTATCTGTAAAAGAAGGTTGG - Intronic
988861496 5:35285101-35285123 TCTCATCTGCAAAATAAATTTGG + Intergenic
988878925 5:35478863-35478885 TCTTATTTGCAAAATCAGCTTGG + Intergenic
989131490 5:38111556-38111578 CCTGATGTGCAAAATGAACTGGG - Intergenic
989771004 5:45145256-45145278 TATTATCTGCAAAGAGAGGTAGG + Intergenic
991990795 5:72337109-72337131 TCTCATTTGTAAAATGAGATAGG - Intronic
992666109 5:79011265-79011287 TCTCATATGGAAAATGAGTTTGG - Intronic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
995737604 5:115318872-115318894 TCTGAGCTAGAAAATAAGGTTGG + Intergenic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996485547 5:124029595-124029617 TATGCTCTGCAGAATCAGGTGGG - Intergenic
997083892 5:130773616-130773638 TCTCATCTATAAAATAAGGTTGG + Intergenic
997333983 5:133091188-133091210 TCTGAACTGAAAACTGAGCTAGG - Exonic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998466224 5:142346370-142346392 TTAGAAATGCAAAATGAGGTGGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999399501 5:151253445-151253467 TCTGGTCTGTACAATGAGGGTGG + Intronic
1000665474 5:163990102-163990124 TCTTATCTTCAGAATGAGATTGG - Intergenic
1001769380 5:174281508-174281530 CTTGTTCTGCAAAATGGGGTTGG - Intergenic
1001912509 5:175532648-175532670 TCAGTTCTTCAAACTGAGGTAGG + Intergenic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002151460 5:177235638-177235660 TCTCATATGCAAAAGGAGCTGGG - Intronic
1002718701 5:181245286-181245308 TCTCATCTGTGAAATGAGATTGG + Intronic
1002941245 6:1718268-1718290 TCTGTGCTGCAAAATGAGGGAGG - Intronic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1004339508 6:14795805-14795827 TCTGAATTGCAAAATGGGGGAGG - Intergenic
1004803084 6:19172503-19172525 TCTGATTTGCTATATGAGGTTGG - Intergenic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1005699476 6:28385925-28385947 TCTCAACTGTATAATGAGGTTGG - Intronic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1011986964 6:93459229-93459251 CCTAATCTATAAAATGAGGTTGG + Intergenic
1012662388 6:101918034-101918056 TCCCATCTATAAAATGAGGTGGG + Intronic
1012860943 6:104558802-104558824 TCCCATCTGTAAAATGAGGCTGG + Intergenic
1013638455 6:112050634-112050656 TTTAATCTGTTAAATGAGGTTGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015403035 6:132808393-132808415 CTGGATCTGCAAAATGAAGTAGG - Intergenic
1016388930 6:143555816-143555838 TTTTATCTGCAAATGGAGGTGGG - Intronic
1016754411 6:147668137-147668159 TCTGAAAAGGAAAATGAGGTTGG - Intronic
1017266511 6:152452245-152452267 ACTGATGAGAAAAATGAGGTGGG + Intronic
1018270380 6:162071049-162071071 TCAGATGTGCTAAAAGAGGTTGG + Intronic
1019035192 6:169048776-169048798 TCTGCTCAGCAGAATGAGGGAGG - Intergenic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1021763895 7:23927895-23927917 TCTCATCTGTCAAATGAAGTGGG - Intergenic
1022643814 7:32212555-32212577 TATGCTCTGGGAAATGAGGTGGG - Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023301452 7:38776549-38776571 TCTGACCTATAAAATAAGGTTGG - Intronic
1023817499 7:43961890-43961912 TCTGCTCTGCAGAATGGGTTTGG + Intergenic
1024336864 7:48217622-48217644 TCTCATCTTCAAACTGAGGAAGG + Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024486825 7:49928796-49928818 TCTGAGCTACATCATGAGGTAGG - Intronic
1026568668 7:71510859-71510881 TGAGACCTGCAAGATGAGGTTGG + Intronic
1026840336 7:73667453-73667475 TCTCTTCTGTAAAATGGGGTTGG - Intergenic
1026928959 7:74212573-74212595 TCTCATCTATAAAATGAGGTCGG - Intronic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027109220 7:75423789-75423811 TCTCATCTGACAAATGAGGAAGG + Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028854715 7:95577511-95577533 TCCGATCTGTAACATGAGGTGGG + Intergenic
1028872729 7:95786847-95786869 TCTGATCTGCTAAAGGAGTTTGG + Intronic
1029585633 7:101468977-101468999 TCTCATCTGTGAAATGGGGTTGG + Intronic
1030229211 7:107188081-107188103 CCTGATCTGAAAAATGGGATTGG + Intronic
1030631376 7:111899624-111899646 TGAGATCTGTAAAATGAGGCCGG + Intronic
1030930602 7:115519660-115519682 TCTGAACTGCAAAACCTGGTAGG + Intergenic
1031462970 7:122074645-122074667 TTTTATATGCAATATGAGGTAGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1037185367 8:16056638-16056660 TCTAATCTACAAAATGGAGTTGG - Intergenic
1037276307 8:17183511-17183533 TCTGATCTCCAGAATGAGACAGG - Intronic
1037608358 8:20456225-20456247 TCTCATTTGCAAACAGAGGTTGG + Intergenic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038509709 8:28120714-28120736 TCTTATGTGTAATATGAGGTGGG + Intronic
1038988369 8:32838149-32838171 TCTCATCTGTTAAATGAGTTTGG + Intergenic
1040120634 8:43681200-43681222 TAGAATCTGCAAAAGGAGGTTGG + Intergenic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1040770738 8:50972010-50972032 TCAGATCTGAAAAATAAAGTTGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1041911056 8:63088421-63088443 TTTTATCTGCAAAACTAGGTAGG - Intergenic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044856446 8:96481054-96481076 TCTGCTCTGGAAGCTGAGGTGGG - Intergenic
1044941909 8:97352206-97352228 TCTGATTTACAAAATGTGTTAGG - Intergenic
1046812377 8:118546760-118546782 ACAGATCTGCAATATGGGGTGGG + Intronic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1048289148 8:133166717-133166739 TTTGATCAGCAACATGAGATTGG + Intergenic
1048609845 8:136010249-136010271 TCTCATCTCCAAAATAAGGACGG + Intergenic
1048788615 8:138079284-138079306 TATGTTCTACAAAAAGAGGTTGG + Intergenic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1048931776 8:139321066-139321088 TCTGATCTGCCAGGTGAGCTTGG - Intergenic
1050310283 9:4345675-4345697 TCTACTCTGGAAAATGAGTTTGG - Intronic
1050317327 9:4416045-4416067 TGTGCTCTGCAAAGTGAGGTCGG - Intergenic
1050917181 9:11150952-11150974 TCTCATCTACAAAAATAGGTAGG + Intergenic
1051335418 9:16061817-16061839 GCTGAGCTGCAAATTCAGGTTGG + Intergenic
1051701357 9:19827648-19827670 TTTGATTTGCAGAATGAGGGAGG - Intergenic
1052987016 9:34495139-34495161 TCTGATCTGAATAATTAGGTAGG + Intronic
1053427269 9:38018589-38018611 TTTGAACTTCAAAGTGAGGTTGG + Intronic
1054830661 9:69621061-69621083 CCTGATCTGTAAAATGGAGTTGG + Intronic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1057039841 9:91840082-91840104 TCTGCTCTGCCAGATGAAGTGGG - Intronic
1057908004 9:98997213-98997235 TCTTGTCTGTAAAATGAGGGTGG - Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058154763 9:101502738-101502760 TCTGACCTGCAAAATGCTGTAGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059057470 9:110999388-110999410 AGTGTTCTGGAAAATGAGGTAGG - Intronic
1059459286 9:114419753-114419775 TAGGATCTGTAAAATGAGGATGG - Intronic
1059577044 9:115500933-115500955 TCTGATCTTCAAATTTACGTGGG - Intergenic
1059665265 9:116440326-116440348 TCCTATCTGTAAAATGAGGTGGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060167066 9:121426237-121426259 CCTGGTCTGTAAAATGAGTTTGG - Intergenic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061676279 9:132217744-132217766 TCTAATCTGTAAAATAAGGATGG - Intronic
1062666092 9:137673358-137673380 TCTGATCTGAAAAAAGAAATAGG + Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187032714 X:15504317-15504339 TCTGATCTGTAAATTGAGATAGG - Intronic
1187060732 X:15784614-15784636 TCTGGTCTGCAAGATAGGGTTGG + Exonic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1187979591 X:24741422-24741444 CATGATCTGCAAAATGAACTTGG - Exonic
1188993243 X:36850291-36850313 ACTGATGTACAATATGAGGTTGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194897531 X:99463336-99463358 TCTGATCTGCAACAGCAGCTGGG + Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1197986408 X:132270437-132270459 TCTGATTTGCTAAATCTGGTAGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198517444 X:137424303-137424325 TCCCATCTGCAAAACCAGGTGGG + Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199927780 X:152486849-152486871 CCAGATCTGCAAAAGGTGGTTGG - Intergenic
1200041159 X:153370553-153370575 TCTGAAATGACAAATGAGGTCGG + Intergenic
1200059652 X:153478603-153478625 TCTCCTCTGTAAAATGGGGTAGG - Intronic