ID: 1008064357

View in Genome Browser
Species Human (GRCh38)
Location 6:47031675-47031697
Sequence TCCAAGATTTAGTAGGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008064357 Original CRISPR TCCAAGATTTAGTAGGTTTA GGG (reversed) Intronic
903272375 1:22197796-22197818 TCCAAGAACTAGTAGGTTCTGGG + Intergenic
903813504 1:26047497-26047519 TCCAGGATTCAGTAGGTCTGGGG + Intergenic
904555013 1:31355841-31355863 TCCAAGATTTAGAGGGTAAAAGG - Intronic
905688045 1:39922806-39922828 TCCATGATTTAGCAGGAGTATGG - Intergenic
906576827 1:46898719-46898741 TCCAACATTTGATAGGTTGAAGG - Intergenic
906630617 1:47364189-47364211 TCTAAGGTTTAGTAGTCTTATGG + Intronic
907505207 1:54913229-54913251 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
909451535 1:75802987-75803009 TTCATGATTTAATAGGTTAATGG - Intronic
909739209 1:79007044-79007066 TCCAAAACTCAGTAGGTTTCAGG + Intergenic
910271124 1:85395733-85395755 TGCAAGTTTTAGAAGATTTATGG + Intronic
913137168 1:115903039-115903061 TATTAGATTTAGTAGGATTAGGG + Intergenic
916051691 1:161040945-161040967 TACAAGATTTAGCAGGTATTAGG + Intronic
918613651 1:186519859-186519881 TCAAAGATTTGGTAAGTTGAAGG - Intergenic
921092510 1:211857195-211857217 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
921959383 1:221018776-221018798 TCCAAGTTTTAATAAGGTTAGGG + Intergenic
922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG + Intronic
922684048 1:227625605-227625627 TCCAACAGTTAGTAGGGTTTCGG + Intronic
923995321 1:239487399-239487421 TTCAGAATTTAGTAGTTTTAAGG + Intronic
924522437 1:244816699-244816721 TCCAAGATTTAGGGGGTTAGAGG + Intergenic
1066037869 10:31511948-31511970 ACCAAGATTTTATAGGTTTATGG + Intronic
1069108435 10:64412118-64412140 TCCATGACTTATTATGTTTATGG + Intergenic
1070432539 10:76355655-76355677 TCCAAGATATATTTGGTTGAGGG + Intronic
1075258817 10:120945583-120945605 TCAAATACTCAGTAGGTTTATGG - Intergenic
1078220683 11:9349255-9349277 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
1078804619 11:14685365-14685387 TCAAATACATAGTAGGTTTAGGG - Intronic
1079820317 11:25118921-25118943 TCCAAGGCTTATTAGGTTTGTGG + Intergenic
1080069512 11:28063570-28063592 GATAAGGTTTAGTAGGTTTAAGG - Intronic
1081110946 11:39132452-39132474 TTCAAGATTTACTAGTTCTAAGG + Intergenic
1083422634 11:62563613-62563635 TTCAATGTTTAGTAGATTTATGG - Intronic
1084418469 11:69048606-69048628 TTGCTGATTTAGTAGGTTTAAGG + Intergenic
1085090311 11:73706537-73706559 TCCCAGATTTATAAGATTTATGG - Intronic
1087019467 11:93587970-93587992 TCCAGTATTTTGTAGGCTTATGG - Intergenic
1091500002 12:1007150-1007172 TGCAAGAACTAGAAGGTTTAAGG + Intronic
1092294292 12:7185859-7185881 TCCAACAGTTAGTAGGGTTTGGG - Intergenic
1093725409 12:22502644-22502666 TTCTAGATGAAGTAGGTTTAAGG - Intronic
1094668853 12:32549027-32549049 TCCAAGATATACTAGCTCTATGG + Intronic
1098301265 12:69056310-69056332 TCCAAGATTTCCTAGGTCTGAGG - Intergenic
1100635317 12:96429987-96430009 TCCAAGATTAAATATGTTGATGG + Intergenic
1103803813 12:123557058-123557080 TCCAACAGTTAGTAGGGTTTTGG - Intergenic
1104193077 12:126502141-126502163 TCCAAGATTTTCTAAGTTAAAGG + Intergenic
1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG + Intergenic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1109220650 13:59637800-59637822 GCCTTGCTTTAGTAGGTTTAAGG + Intergenic
1109646021 13:65257800-65257822 TGCAAAATTTAGTAGATGTATGG - Intergenic
1116037765 14:39648670-39648692 TCCTAGAATTATTAAGTTTAAGG - Intergenic
1117183278 14:53214268-53214290 TGCATGATTCAGTGGGTTTAGGG + Intergenic
1117980786 14:61340335-61340357 ACCAATATTTACTAGGTTGAGGG - Intronic
1118085648 14:62413062-62413084 TCCAAGATAAATTATGTTTAAGG - Intergenic
1118105322 14:62652587-62652609 TACAACATTTGGTAGGTTAAGGG + Intergenic
1122015421 14:98791098-98791120 TCCAACCTTCAGTAGGTTCACGG + Intergenic
1127073657 15:55306321-55306343 TCCAACAGTTAGTAGGGTTTTGG + Intronic
1127372365 15:58353510-58353532 TCCATAATTTCCTAGGTTTATGG + Intronic
1128714343 15:69896362-69896384 TCCAAGATTTCCTGGTTTTATGG - Intergenic
1134285772 16:12860894-12860916 TATCAGACTTAGTAGGTTTAGGG - Intergenic
1137069882 16:35894731-35894753 TCATAGATTAAGTAGATTTAGGG + Intergenic
1141335320 16:83149111-83149133 TCCAAGATACAGTAGTTCTATGG + Intronic
1142892490 17:2953417-2953439 TCCAAGATATATTAAGTTGAGGG - Intronic
1143696647 17:8625444-8625466 TCCCTGATTCAGTAGGTATAGGG + Intronic
1146997706 17:37335211-37335233 TCCAACAGTTAGTAGGGTTTTGG - Intronic
1149583237 17:57766394-57766416 TTCAAGATTTGGTAGGTACAAGG + Intergenic
1154283300 18:13027730-13027752 TTCAAGATTAAGTTGCTTTATGG + Intronic
1155634851 18:27940400-27940422 TCTAATATGTAGTAAGTTTAGGG + Intergenic
1156653345 18:39253352-39253374 TCCAATATTTGGTTGCTTTATGG - Intergenic
1158032907 18:52988828-52988850 TGCAATATTTAGTATGTATAAGG - Intronic
1158379625 18:56914626-56914648 TTAAAGATTCAGTAGGTTAATGG + Intronic
1159013285 18:63079962-63079984 TCCAGGTTTTACTAGTTTTATGG + Intergenic
1159070078 18:63613360-63613382 TCCAAGATATAGTGGGGGTATGG + Intergenic
1162266587 19:9580558-9580580 TCCAAAATTCAAGAGGTTTACGG - Intronic
925710339 2:6732917-6732939 TCCAAATTTTAGTAGGTAGATGG - Intergenic
928348074 2:30519150-30519172 TCCAACAGTTAGTAGGGTTTTGG - Intronic
931288841 2:60854900-60854922 TCCATGATTGAGTAGGTCTGGGG + Intergenic
931535669 2:63272757-63272779 TCAAATATTTGGTAGATTTATGG - Intronic
933182341 2:79241621-79241643 TCCAAGAATTGGAAGTTTTAAGG + Intronic
934221632 2:90089444-90089466 GGCAAGGTTTAGTAGGTTTGTGG - Intergenic
935513846 2:104009068-104009090 TTCAAGATGTATTAGGTTGAAGG - Intergenic
937484826 2:122304450-122304472 TCTCAGATTTAGGAGCTTTAGGG - Intergenic
939464008 2:142533742-142533764 TCCAAGAGTTACAATGTTTAGGG + Intergenic
941505200 2:166335508-166335530 TCCAAAATTTAGAAGGTCAACGG - Intronic
1170319712 20:15081850-15081872 TCCAAGATACAGATGGTTTAAGG - Intronic
1172408578 20:34706409-34706431 TCCATGAATTAGTAGGTTCTTGG + Intronic
1172893580 20:38284019-38284041 TCCTTGATTTAGTAGGTCTGGGG - Intronic
1177579820 21:23007061-23007083 GCACAGATTTAGCAGGTTTATGG + Intergenic
1182929721 22:34161178-34161200 TCAAAAATTTAGGAGGTTGAGGG - Intergenic
1183908057 22:41057839-41057861 TCAAACATTTAGCAGGTTTCTGG - Intergenic
949475594 3:4442182-4442204 TCCAATAAGGAGTAGGTTTAAGG + Intronic
951801441 3:26600996-26601018 TGCAAGATTCAGTAGGTCAACGG + Intergenic
951926212 3:27911406-27911428 TCCACCATTTAGTAGTTGTATGG + Intergenic
952045244 3:29311095-29311117 TCCTTGATTCAGTAGGTTAATGG + Intronic
952830803 3:37563360-37563382 TCCAAAATTTAGGGGGTTGAAGG - Intronic
955363794 3:58294855-58294877 TGGATGATTTATTAGGTTTAAGG + Intronic
955531149 3:59874451-59874473 TTGCAGATTTAGTAGGTCTAGGG + Intronic
955847094 3:63176779-63176801 TCCAATATTTATTAATTTTATGG - Intergenic
957677763 3:83392838-83392860 TCCAACATTGAGAAGGGTTAAGG - Intergenic
958629431 3:96668269-96668291 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
959157221 3:102681466-102681488 TTGAAGTTTTAGTAGCTTTATGG + Intergenic
959218903 3:103489828-103489850 TCCAAGATTTGGCTGGTTTGTGG - Intergenic
959537239 3:107500282-107500304 TCAAAGATTTAGGAGGTTAATGG - Intergenic
960277746 3:115746376-115746398 TCCAACAGTTAGTAGGGTTTTGG - Intergenic
960514701 3:118590538-118590560 TCTAAGATTTAGGGGGTTAAAGG + Intergenic
963126296 3:141820057-141820079 TCCAACAGTTAGTAGGGTTTTGG - Intergenic
963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG + Intronic
966142102 3:176768469-176768491 TCTAAGAGTTATTAGCTTTAAGG + Intergenic
966986718 3:185187191-185187213 TCCAAGAATTAGTACGGTTTGGG - Intergenic
969656889 4:8503817-8503839 TCCAACATTTAGGAGGGTGAAGG - Intergenic
970281856 4:14465396-14465418 TACAAGATTAAATGGGTTTAGGG - Intergenic
974520660 4:62976651-62976673 TCCAACAGTTAGTAGGGTTTGGG - Intergenic
975313415 4:72927548-72927570 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
975327985 4:73081645-73081667 CCCAAAATTTTGTAAGTTTAAGG - Intronic
980872158 4:138623657-138623679 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
981244231 4:142515297-142515319 ACCAAGAGTTAGTGGGTTTCAGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
986603143 5:9494327-9494349 TCAAAAATTGAGTAGGTATATGG + Intronic
986632902 5:9791750-9791772 TCCAAGATTCATTTGGTTTAGGG + Intergenic
989243480 5:39226761-39226783 TTCCAGATTTAGTAGGTTTAGGG + Intronic
990252812 5:53933718-53933740 TTCAATATTCATTAGGTTTAAGG + Intronic
990617362 5:57521465-57521487 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
990857624 5:60287750-60287772 TCAAAGTTTTAGAAGTTTTAGGG - Intronic
993075553 5:83225935-83225957 TCTCAGAGCTAGTAGGTTTAGGG + Intronic
993574040 5:89579505-89579527 TCCAAGATTAAGTGGATGTATGG - Intergenic
994488883 5:100416382-100416404 TCCAAGATTTTCTATTTTTAGGG - Intergenic
995043279 5:107614291-107614313 TCGAATATTCAGTTGGTTTATGG - Intronic
995125777 5:108576009-108576031 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
996024499 5:118629641-118629663 TCCAAGATGGAGTCGGTGTAGGG - Intergenic
996215892 5:120865076-120865098 TCAAAAATTTAGTAGATTTCTGG - Intergenic
996676377 5:126179658-126179680 TTCAAGTTTTAGTAGGCTTTTGG - Intergenic
997850589 5:137329253-137329275 TCTAAGATTTGGTAGGCTCAAGG - Intronic
998776201 5:145606145-145606167 TGTCAGATTTAGTAGCTTTAGGG + Intronic
1002173572 5:177388686-177388708 TTCCAGATTCAGTAGGTCTAGGG - Intronic
1002654434 5:180732888-180732910 CCCAATATTTAACAGGTTTATGG - Intergenic
1005585006 6:27267842-27267864 TCCAAGACATATTAAGTTTAAGG - Intergenic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1008571241 6:52819093-52819115 TCCAATCTTTAGTTGGTTAATGG - Intergenic
1009682196 6:66910303-66910325 TCCAACTTTTATTAGGTTTAAGG + Intergenic
1009936810 6:70244060-70244082 TTCAAAATTCAGAAGGTTTATGG - Intronic
1010345132 6:74801472-74801494 TCCAAGATATAATAGGGGTATGG - Intergenic
1013022624 6:106234307-106234329 TCCAACAGTTAGTAGGGTTTTGG - Intronic
1013042985 6:106454542-106454564 TGCAAGATTCAGCAGGTTTGCGG + Intergenic
1013137898 6:107300069-107300091 TCCAACAGTTAGTAGGGTTTTGG - Intronic
1013235936 6:108197980-108198002 ACCCAGATTTGGGAGGTTTAAGG - Intergenic
1014024484 6:116629530-116629552 TGCAAGATTTAGTAGTCTAATGG - Intronic
1014342972 6:120231331-120231353 TCAAATATTTAGTTGCTTTATGG - Intergenic
1023588775 7:41759088-41759110 TCAAAGATTTAGGAGGTTAGAGG - Intergenic
1023762185 7:43475470-43475492 TCAAAGACTTAGTAGCATTAGGG + Intronic
1025858271 7:65303309-65303331 TCGTAGATTAAGTAGATTTAGGG + Intergenic
1027946669 7:84755615-84755637 TCTTAGATTTAATAGGTTAAAGG - Intergenic
1028331162 7:89593913-89593935 TACAAGGTTTAGTAGCTTTGAGG + Intergenic
1028587931 7:92469820-92469842 TCCAACAGTTAGTAGGGTTTTGG + Exonic
1030783371 7:113628479-113628501 TCCAAGACTCAGAAGATTTAGGG - Intergenic
1031748429 7:125536895-125536917 TCCAAAATATTGTAGGATTATGG + Intergenic
1031927679 7:127653327-127653349 TCCAAGATTTGGAAGGGTTTTGG - Intronic
1033578029 7:142704688-142704710 TCCAAGATTTAGGGGGTTAGTGG + Intergenic
1034332790 7:150297399-150297421 TCCAAGTTCTTGTATGTTTAAGG - Intronic
1034665247 7:152812479-152812501 TCCAAGTTCTTGTATGTTTAAGG + Intronic
1035343724 7:158183659-158183681 TCCAGGACTTGGTAGGGTTAAGG + Intronic
1036975729 8:13409869-13409891 TACATGATTTAGTAGGCCTACGG + Intronic
1037217025 8:16467423-16467445 ACCAAGACTTAGCAGTTTTATGG - Intronic
1037527062 8:19735967-19735989 TTCAACATTTGGTAAGTTTATGG + Intronic
1037571185 8:20158954-20158976 TCCAACAGTTAGTAGGATTTTGG - Intronic
1038171842 8:25141979-25142001 TCCAACATATTTTAGGTTTAAGG - Intergenic
1038268298 8:26052894-26052916 TCAAAGATTCAGAAGGTTGAGGG - Intergenic
1039734998 8:40322305-40322327 TCCAAGATAAAGTAGGCTTCAGG - Intergenic
1041764766 8:61406959-61406981 GACAAGATTCAGTAGTTTTAAGG + Intronic
1042782483 8:72507341-72507363 CCCAAGATCTAGTATGTTTATGG - Intergenic
1046109635 8:109707023-109707045 TCCAAGATTTTGCACTTTTAGGG + Intergenic
1047135823 8:122077166-122077188 GAAAAAATTTAGTAGGTTTAGGG + Intergenic
1052024352 9:23558264-23558286 TCCAAGATTCAGTATATCTAGGG + Intergenic
1055709252 9:79041213-79041235 TTCCAGATTCAGTAGGTCTAGGG - Intergenic
1057132329 9:92662778-92662800 CCCAAGATTTAAAAGGTTAAGGG + Intronic
1058509477 9:105701531-105701553 TTCAAGATGTAGTATTTTTACGG - Intronic
1058594709 9:106602975-106602997 TCCAAGAGATAGCAGATTTAAGG + Intergenic
1059091293 9:111361458-111361480 TCCAAGATGAGGTACGTTTAGGG - Exonic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1060681395 9:125568178-125568200 TCTAAGATTTAGGGGGTTAAAGG + Intronic
1186254036 X:7700616-7700638 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
1187019580 X:15366545-15366567 TCCAACATTTAGAAGTTTTATGG + Intronic
1190920984 X:54852240-54852262 TCTAAGATTTAGGAGGTTAGAGG - Intergenic
1191869342 X:65732642-65732664 TCCAAGATTCAGGAGTTATATGG - Intronic
1192307865 X:69982473-69982495 ATGGAGATTTAGTAGGTTTATGG - Intronic
1192339370 X:70250344-70250366 TTCAAGATTTATTAGGTTCTTGG + Intergenic
1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG + Intergenic
1194449797 X:94030410-94030432 TCCAAGATTAAGGAGTTTTCAGG - Intergenic
1195627540 X:107019668-107019690 TCCAAGATTCAATGGTTTTAAGG + Intergenic
1195630806 X:107053573-107053595 TCCAACAGTTAGTAGGGTTTTGG + Intergenic
1197671014 X:129277501-129277523 TCCAAAATATATTAGGTATATGG + Intergenic
1200120228 X:153786684-153786706 TGCATGATTTAGTAGTTTTTTGG - Intronic
1200373275 X:155750705-155750727 TACTAGATTTTGGAGGTTTAAGG + Intergenic