ID: 1008069691 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:47086710-47086732 |
| Sequence | CCGGATGTGAGCATCTAAAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008069691_1008069696 | 30 | Left | 1008069691 | 6:47086710-47086732 | CCTTTTTAGATGCTCACATCCGG | No data | ||
| Right | 1008069696 | 6:47086763-47086785 | AAGCTGAGGCTTCTATTGAGTGG | No data | ||||
| 1008069691_1008069695 | 16 | Left | 1008069691 | 6:47086710-47086732 | CCTTTTTAGATGCTCACATCCGG | No data | ||
| Right | 1008069695 | 6:47086749-47086771 | CATTCTGTGATTATAAGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008069691 | Original CRISPR | CCGGATGTGAGCATCTAAAA AGG (reversed) | Intergenic | ||