ID: 1008069691 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:47086710-47086732 |
Sequence | CCGGATGTGAGCATCTAAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1008069691_1008069695 | 16 | Left | 1008069691 | 6:47086710-47086732 | CCTTTTTAGATGCTCACATCCGG | No data | ||
Right | 1008069695 | 6:47086749-47086771 | CATTCTGTGATTATAAGCTGAGG | No data | ||||
1008069691_1008069696 | 30 | Left | 1008069691 | 6:47086710-47086732 | CCTTTTTAGATGCTCACATCCGG | No data | ||
Right | 1008069696 | 6:47086763-47086785 | AAGCTGAGGCTTCTATTGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1008069691 | Original CRISPR | CCGGATGTGAGCATCTAAAA AGG (reversed) | Intergenic | ||