ID: 1008069691

View in Genome Browser
Species Human (GRCh38)
Location 6:47086710-47086732
Sequence CCGGATGTGAGCATCTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008069691_1008069695 16 Left 1008069691 6:47086710-47086732 CCTTTTTAGATGCTCACATCCGG No data
Right 1008069695 6:47086749-47086771 CATTCTGTGATTATAAGCTGAGG No data
1008069691_1008069696 30 Left 1008069691 6:47086710-47086732 CCTTTTTAGATGCTCACATCCGG No data
Right 1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008069691 Original CRISPR CCGGATGTGAGCATCTAAAA AGG (reversed) Intergenic
No off target data available for this crispr