ID: 1008069693

View in Genome Browser
Species Human (GRCh38)
Location 6:47086729-47086751
Sequence ATGAAAGGATTAGCAAAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008069693_1008069697 12 Left 1008069693 6:47086729-47086751 CCGGATTTTGCTAATCCTTTCAT No data
Right 1008069697 6:47086764-47086786 AGCTGAGGCTTCTATTGAGTGGG No data
1008069693_1008069696 11 Left 1008069693 6:47086729-47086751 CCGGATTTTGCTAATCCTTTCAT No data
Right 1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG No data
1008069693_1008069695 -3 Left 1008069693 6:47086729-47086751 CCGGATTTTGCTAATCCTTTCAT No data
Right 1008069695 6:47086749-47086771 CATTCTGTGATTATAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008069693 Original CRISPR ATGAAAGGATTAGCAAAATC CGG (reversed) Intergenic