ID: 1008069693 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:47086729-47086751 |
| Sequence | ATGAAAGGATTAGCAAAATC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008069693_1008069696 | 11 | Left | 1008069693 | 6:47086729-47086751 | CCGGATTTTGCTAATCCTTTCAT | No data | ||
| Right | 1008069696 | 6:47086763-47086785 | AAGCTGAGGCTTCTATTGAGTGG | No data | ||||
| 1008069693_1008069697 | 12 | Left | 1008069693 | 6:47086729-47086751 | CCGGATTTTGCTAATCCTTTCAT | No data | ||
| Right | 1008069697 | 6:47086764-47086786 | AGCTGAGGCTTCTATTGAGTGGG | No data | ||||
| 1008069693_1008069695 | -3 | Left | 1008069693 | 6:47086729-47086751 | CCGGATTTTGCTAATCCTTTCAT | No data | ||
| Right | 1008069695 | 6:47086749-47086771 | CATTCTGTGATTATAAGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008069693 | Original CRISPR | ATGAAAGGATTAGCAAAATC CGG (reversed) | Intergenic | ||