ID: 1008069694

View in Genome Browser
Species Human (GRCh38)
Location 6:47086744-47086766
Sequence GCTTATAATCACAGAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008069694_1008069697 -3 Left 1008069694 6:47086744-47086766 CCTTTCATTCTGTGATTATAAGC No data
Right 1008069697 6:47086764-47086786 AGCTGAGGCTTCTATTGAGTGGG No data
1008069694_1008069696 -4 Left 1008069694 6:47086744-47086766 CCTTTCATTCTGTGATTATAAGC No data
Right 1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG No data
1008069694_1008069699 27 Left 1008069694 6:47086744-47086766 CCTTTCATTCTGTGATTATAAGC No data
Right 1008069699 6:47086794-47086816 ATCTGCAGTAGAAGCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008069694 Original CRISPR GCTTATAATCACAGAATGAA AGG (reversed) Intergenic
No off target data available for this crispr