ID: 1008069696 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:47086763-47086785 |
Sequence | AAGCTGAGGCTTCTATTGAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1008069693_1008069696 | 11 | Left | 1008069693 | 6:47086729-47086751 | CCGGATTTTGCTAATCCTTTCAT | No data | ||
Right | 1008069696 | 6:47086763-47086785 | AAGCTGAGGCTTCTATTGAGTGG | No data | ||||
1008069691_1008069696 | 30 | Left | 1008069691 | 6:47086710-47086732 | CCTTTTTAGATGCTCACATCCGG | No data | ||
Right | 1008069696 | 6:47086763-47086785 | AAGCTGAGGCTTCTATTGAGTGG | No data | ||||
1008069694_1008069696 | -4 | Left | 1008069694 | 6:47086744-47086766 | CCTTTCATTCTGTGATTATAAGC | No data | ||
Right | 1008069696 | 6:47086763-47086785 | AAGCTGAGGCTTCTATTGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1008069696 | Original CRISPR | AAGCTGAGGCTTCTATTGAG TGG | Intergenic | ||