ID: 1008069696

View in Genome Browser
Species Human (GRCh38)
Location 6:47086763-47086785
Sequence AAGCTGAGGCTTCTATTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008069693_1008069696 11 Left 1008069693 6:47086729-47086751 CCGGATTTTGCTAATCCTTTCAT No data
Right 1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG No data
1008069694_1008069696 -4 Left 1008069694 6:47086744-47086766 CCTTTCATTCTGTGATTATAAGC No data
Right 1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG No data
1008069691_1008069696 30 Left 1008069691 6:47086710-47086732 CCTTTTTAGATGCTCACATCCGG No data
Right 1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008069696 Original CRISPR AAGCTGAGGCTTCTATTGAG TGG Intergenic
No off target data available for this crispr