ID: 1008069697

View in Genome Browser
Species Human (GRCh38)
Location 6:47086764-47086786
Sequence AGCTGAGGCTTCTATTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008069693_1008069697 12 Left 1008069693 6:47086729-47086751 CCGGATTTTGCTAATCCTTTCAT No data
Right 1008069697 6:47086764-47086786 AGCTGAGGCTTCTATTGAGTGGG No data
1008069694_1008069697 -3 Left 1008069694 6:47086744-47086766 CCTTTCATTCTGTGATTATAAGC No data
Right 1008069697 6:47086764-47086786 AGCTGAGGCTTCTATTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008069697 Original CRISPR AGCTGAGGCTTCTATTGAGT GGG Intergenic
No off target data available for this crispr