ID: 1008070399

View in Genome Browser
Species Human (GRCh38)
Location 6:47093579-47093601
Sequence CAAGTTGCAAAGTGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008070399_1008070404 2 Left 1008070399 6:47093579-47093601 CCATGTTCCCACTTTGCAACTTG No data
Right 1008070404 6:47093604-47093626 GGCCTCAGTTTCTTAAAATCTGG No data
1008070399_1008070407 10 Left 1008070399 6:47093579-47093601 CCATGTTCCCACTTTGCAACTTG No data
Right 1008070407 6:47093612-47093634 TTTCTTAAAATCTGGGCTTTTGG No data
1008070399_1008070408 30 Left 1008070399 6:47093579-47093601 CCATGTTCCCACTTTGCAACTTG No data
Right 1008070408 6:47093632-47093654 TGGCTCTTGATATAGAAAACAGG No data
1008070399_1008070405 3 Left 1008070399 6:47093579-47093601 CCATGTTCCCACTTTGCAACTTG No data
Right 1008070405 6:47093605-47093627 GCCTCAGTTTCTTAAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008070399 Original CRISPR CAAGTTGCAAAGTGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr